CN108676893B - Biomarker for detecting colorectal cancer and application thereof - Google Patents

Biomarker for detecting colorectal cancer and application thereof Download PDF

Info

Publication number
CN108676893B
CN108676893B CN201810806140.6A CN201810806140A CN108676893B CN 108676893 B CN108676893 B CN 108676893B CN 201810806140 A CN201810806140 A CN 201810806140A CN 108676893 B CN108676893 B CN 108676893B
Authority
CN
China
Prior art keywords
pappa
colorectal cancer
colon
tissue
expression level
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201810806140.6A
Other languages
Chinese (zh)
Other versions
CN108676893A (en
Inventor
郭永臣
鲍永华
杨万才
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangxi Baiyan Biotechnology Co ltd
Original Assignee
Jiangxi Baiyan Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangxi Baiyan Biotechnology Co ltd filed Critical Jiangxi Baiyan Biotechnology Co ltd
Priority to CN201810806140.6A priority Critical patent/CN108676893B/en
Publication of CN108676893A publication Critical patent/CN108676893A/en
Application granted granted Critical
Publication of CN108676893B publication Critical patent/CN108676893B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57446—Specifically defined cancers of stomach or intestine
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Pathology (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Oncology (AREA)
  • General Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a diagnostic marker, and particularly provides a biomarker for detecting colorectal cancer and application thereof. The invention discovers that significant difference exists between the mRNA expression level of pregnancy-associated plasma protein A (PAPPA) gene in colon adenocarcinoma tissue, colon mucus adenocarcinoma tissue, cecum adenocarcinoma tissue, sigmoid colorectal carcinoma tissue and rectum adenocarcinoma tissue and healthy control through experimental research; the expression level of the PAPPA protein in the serum of the colorectal cancer patient is also obviously higher than that of a normal human group. The invention firstly provides the correlation between the PAPPA and the colorectal cancer, and the experiment verifies that the available PAPPA can diagnose the colorectal cancer, and the invention has the characteristics of simple operation, high specificity and high sensitivity.

Description

Biomarker for detecting colorectal cancer and application thereof
Technical Field
The invention relates to a diagnostic marker, in particular to application of pregnancy-associated plasma protein A (PAPPA) in detection of colorectal cancer.
Background
Pregnancy-associated plasma protein a (pappa) was originally found in the plasma of pregnant women. During pregnancy, PAPPA is produced by placental syncytium trophoblasts and secreted into the serum, levels of which are maintained throughout pregnancy. Abnormal PAPPA levels in the circulation are associated with fetal disease; for example, low PAPPA levels are associated with fetal down syndrome (trisomy 21), preterm birth, low birth weight, and early pregnancy preeclampsia. In contrast, the levels of PAPPA are elevated in diabetic nephropathy patients.
The PAPPA gene is located on chromosome 9q33.1 and encodes a 1627 amino acid 180kDa protein. PAPPA plays an important role in bone formation, inflammation and injury response (e.g. wound healing). There is increasing evidence that PAPPA is ubiquitously expressed in all normal tissues, but its levels are very low except for kidney and bone cells.
Colorectal cancer (CRC) is a common malignant tumor of the digestive system of human, the incidence rate of which is at the 3 rd position of the malignant tumor, the onset of disease is hidden, the prognosis is poor, and most patients have reached the middle and late stages of treatment and the optimal operation time is lost. Thus, early detection and diagnosis are critical to the effective treatment of tumors. The clinical diagnosis of colon adenocarcinoma mainly depends on laboratory examination such as Fecal Occult Blood (FOBT) test, cytological diagnosis, histopathological examination, serum carcinoembryonic antigen (CEA) determination and the like, fibercolonoscopy, imaging diagnosis such as colon pneumobarium double contrast, CT scanning, MRI, ultrasonic section imaging diagnosis and nuclide diagnosis, enteroscopy is the most reliable method for colon adenocarcinoma diagnosis, but has the advantages of invasiveness, high cost and poor patient compliance; small pathological changes are not easy to find in CT and ultrasonic examination, and early diagnosis of colon adenocarcinoma is limited to a certain extent; CEA is a serum marker widely applied in clinic, has low sensitivity and specificity, and is mainly used for the treatment monitoring of colon adenocarcinoma patients.
Therefore, the development of specific biomarkers that can be used for the diagnosis of patients with CRC will have important and positive significance for both the timely diagnosis and treatment of patients.
Disclosure of Invention
The invention aims to provide a novel biomarker for detecting colorectal cancer and application thereof.
In order to realize the purpose of the invention, the technical scheme of the invention is as follows:
the invention firstly provides a biomarker for detecting colorectal cancer, wherein the biomarker is pregnancy-associated plasma protein A (PAPPA) (NCBI accession No. NM-002581.3).
The invention discovers that the pregnancy related plasma protein A (PAPPA) gene has significant difference between the mRNA expression level in colon adenocarcinoma tissues, colon mucus adenocarcinoma tissues, caecum adenocarcinoma tissues, sigmoid colorectal cancer tissues and rectal adenocarcinoma tissues and healthy controls through experimental researches; the expression level of the PAPPA protein in the serum of the colorectal cancer patient is also obviously higher than that of a normal human group.
Based on the research results, the invention also provides a primer pair for detecting the biomarkers, wherein the primer pair comprises:
a forward primer: 5'-GAACGGTTCAACTTTGATGGTG-3', respectively;
reverse primer: 5'-TATTGAGATGTGTTGATCCATCC-3' are provided.
It will be understood by those skilled in the art that based on the results of the present invention, reagents for detecting the biomarkers of the present invention are within the scope of the present invention.
The reagents contain primers, such as the primer pairs described herein before, that specifically amplify the mRNA transcribed from the PAPPA gene.
Further, the invention provides an application of the reagent in preparing a colorectal cancer diagnosis reagent or a kit or other products based on the relevance of the biomarker and colorectal cancer.
Alternatively, the detection of the biomarker can be completed by using the reagent for diagnosing the colorectal cancer, which contains the reagent.
The kit can be an ELISA kit, or a fluorescent quantitative PCR kit, or the like.
The above-described preferred conditions may be combined with each other to obtain a specific embodiment, in accordance with common knowledge in the art.
The invention has the beneficial effects that:
the invention firstly provides the correlation between the PAPPA and the colorectal cancer, and the experiment verifies that the available PAPPA can diagnose the colorectal cancer, and the invention has the characteristics of simple operation, high specificity and high sensitivity.
The colitis and colon cancer have certain similarities in clinical manifestations, and symptoms of the colitis and colon cancer are manifested as necrosis, ulcer, hematochezia and the like of intestinal mucosa, but the colitis belongs to benign diseases and can be controlled by medicines, while the colon cancer belongs to malignant diseases and has no obvious effect of treatment by medicines. The two diseases are very difficult to identify by our own judgment, while in the invention, the expression of PAPPA in the colitis tissue is slightly increased, but the PAPPA is not much different from the normal colon tissue, and the detection result is negative.
The lower limit or minimum of the average expression level of PAPPA mRNA in colorectal cancer (relative fold expression, PAPPA/GAPDH) is greater than 2. While the upper or highest average expression level of PAPPA mRNA in colitis (relative fold expression, PAPPA/GAPDH) is less than 1.5.
Drawings
FIG. 1 is a graph showing the results of analysis of the Oncomine database showing the mRNA expression levels of PAPPA in human colon adenocarcinoma tissue.
FIG. 2 is a graph showing the results of analysis of the Oncomine database showing the mRNA expression levels of PAPPA in human colon mucinous adenocarcinoma tissue.
FIG. 3 is a graph showing the results of analysis of the Oncomine database to show the mRNA expression level of PAPPA in human cecal adenocarcinoma tissue.
FIG. 4 is a graph showing the results of analysis of the Oncomine database showing the mRNA expression levels of PAPPA in human sigmoid colorectal cancer tissues.
FIG. 5 is a graph showing the results of analysis of the Oncomine database showing the mRNA expression levels of PAPPA in the rectal adenocarcinoma tissue.
FIG. 6 shows the mRNA expression level of PAPPA in colorectal cancer tissues detected by qRT-PCR technology.
FIG. 7 shows the detection of the mRNA expression level of PAPPA in the colon inflammatory tissue by using the qRT-PCR technique.
FIG. 8 shows the detection of the protein expression level of PAPPA in the serum of a patient with colorectal cancer by ELISA technique.
Detailed Description
The present invention is further illustrated by the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1 on-line big data analysis
Using online gene analysis data (www.oncomine.org), PAPPA was significantly increased in colon adenocarcinoma (p ═ 3.29E-11, fig. 1), in colon mucinous adenocarcinoma (p ═ 1.95E-7, fig. 2), in cecum adenocarcinoma (p ═ 9.89E-8, fig. 3), and in sigmoid colorectal carcinoma (p ═ 1.75E-6, fig. 4) in rectal adenocarcinoma (p ═ 1.60E-5), compared to normal tissue.
Example 2 mRNA expression levels of PAPPA by qRT-PCR
1. Human colon cancer and colitis tissue specimen Collection
28 pairs of colorectal cancer tissue specimens and matched normal tissue specimens thereof, 10 pairs of colitis tissue specimens and matched normal tissue specimens thereof were collected from gastrointestinal surgery in the first subsidiary hospital of the Jining medical college, and then the specimens were stored in an environment of-80 ℃.
2. RNA extraction
RNA was extracted from frozen colon cancer and its adjacent normal colon tissue using Trizol reagent (Invitrogen, Carlsbad, CA) according to the manual procedure.
3. Detection of mRNA expression levels of PAPPA by qRT-PCR
Detecting the mRNA expression level of the PAPPA by utilizing qRT-PCR, wherein the reaction system comprises the following components: 0.15. mu.l of forward primer (20 μm), 0.15. mu.l of reverse primer (20 μm), 0.7. mu.l of cDNA, H2O9. mu.l, fluorescent dye SYBR Green (2X) 10. mu.l; reaction conditions are as follows: 2min at 50 ℃ and 2min at 95 ℃; denaturation 95 ℃ for 15sec, annealing/extension 60 ℃ for 1min, for 40 cycles.
The primers used were as follows:
PAPPA：
a forward primer: GAACGGTTCAACTTTGATGGTG, respectively;
reverse primer: TATTGAGATGTGTTGATCCATCC, respectively;
GAPDH：
a forward primer: TCTGGAAAGCTGTGGCGTGAT, respectively;
reverse primer: GCCAGTGAGCTTCCCGTTCAG are provided.
The results of PAPPA expression in colorectal cancer tissues and paracarcinoma normal tissues are shown in fig. 6: the average expression level of PAPPA was increased 3.04-fold in 28 colorectal cancer tissues compared to normal tissues (P ═ 0.0015).
The results of PAPPA expression in colon inflamed and normal tissues are shown in fig. 7: compared with normal tissues, the average expression level of the PAPPA in 10 colon inflammatory tissues is increased, however, the increase is significant, P is greater than 0.05, the difference is not significant, and the expression level is not statistically significant.
Example 3 detection of PAPPA in serum by enzyme-linked immunosorbent assay (ELISA)
1. Human serum sample collection
In the study, 40 serum samples are all obtained from the central hospital in the New rural city, wherein 20 colon cancer serum samples are obtained, and 20 normal human serum samples are obtained. All colorectal cancer patients were confirmed by pathological examination. All the study subjects were fasted for more than 8h before blood drawing, fasting venous blood was collected for about 5ml, left to stand at room temperature for 30min and then centrifuged at 3000r/min for 10min, and serum was collected and frozen at-20 ℃ for PAPPA concentration monitoring.
2. Detection of PAPPA concentration in serum by enzyme-linked immunosorbent assay (ELISA)
The concentration of PAPPA in serum samples is detected by adopting an enzyme-linked immunosorbent assay (ELISA), each group of serum samples is set to be 3 times, the OD value is detected in a multifunctional ELISA reader, and the final OD value of the group of samples is taken as the mean value of the 3 times. PAPPA expression levels were compared between the colon cancer group and the normal group, respectively.
The content of the PAPPA in the serum of the colorectal cancer patients is 6.8 +/-2.5 ng/ml, the content of the PAPPA in the serum of normal people is 5.2 +/-1.3 ng/ml, the expression level of the PAPPA protein in the serum of the colorectal cancer patients is higher than that of normal people, and the difference has statistical significance (P is 0.0022), which is shown in figure 8.
Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Sequence listing
<110> Jiangxi Baiyan Biotechnology Ltd
<120> biomarker for detecting colorectal cancer and application thereof
<141> 2018-07-18
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gaacggttca actttgatgg tg 22
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tattgagatg tgttgatcca tcc 23
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tctggaaagc tgtggcgtga t 21
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gccagtgagc ttcccgttca g 21

Claims (2)

1. A forward primer: 5'-GAACGGTTCAACTTTGATGGTG-3', respectively; reverse primer: 5'-TATTGAGATGTGTTGATCCATCC-3' in the preparation of a colorectal cancer detection kit.
2. The use according to claim 1, wherein the kit is a fluorescent quantitative PCR kit.
CN201810806140.6A 2018-07-20 2018-07-20 Biomarker for detecting colorectal cancer and application thereof Active CN108676893B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810806140.6A CN108676893B (en) 2018-07-20 2018-07-20 Biomarker for detecting colorectal cancer and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810806140.6A CN108676893B (en) 2018-07-20 2018-07-20 Biomarker for detecting colorectal cancer and application thereof

Publications (2)

Publication Number Publication Date
CN108676893A CN108676893A (en) 2018-10-19
CN108676893B true CN108676893B (en) 2022-04-19

Family

ID=63814757

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810806140.6A Active CN108676893B (en) 2018-07-20 2018-07-20 Biomarker for detecting colorectal cancer and application thereof

Country Status (1)

Country Link
CN (1) CN108676893B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103966328A (en) * 2014-05-07 2014-08-06 新乡医学院 miRNA marker related to malignant transformation of colitis and proctitis and kit
CN105441563A (en) * 2015-12-31 2016-03-30 济宁医学院 Application of PRSS8 detection reagent in preparation of early and prognostic diagnosis kit for colon cancer
CN106947818A (en) * 2017-04-11 2017-07-14 北京泱深生物信息技术有限公司 A kind of molecular marker of diagnosis and treatment adenocarcinoma of colon
CN107177666A (en) * 2017-05-15 2017-09-19 中国医学科学院北京协和医院 Application of the gene as biomarker in adenocarcinoma of colon

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU1853600A (en) * 1999-01-06 2000-07-24 Choong-Chin Liew Method for the detection of gene transcripts in blood and uses thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103966328A (en) * 2014-05-07 2014-08-06 新乡医学院 miRNA marker related to malignant transformation of colitis and proctitis and kit
CN105441563A (en) * 2015-12-31 2016-03-30 济宁医学院 Application of PRSS8 detection reagent in preparation of early and prognostic diagnosis kit for colon cancer
CN106947818A (en) * 2017-04-11 2017-07-14 北京泱深生物信息技术有限公司 A kind of molecular marker of diagnosis and treatment adenocarcinoma of colon
CN107177666A (en) * 2017-05-15 2017-09-19 中国医学科学院北京协和医院 Application of the gene as biomarker in adenocarcinoma of colon

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
NM_002581.3;Genbank;《Genbank》;20150315;第1-6页 *
Overexpression of Pregnancy-Associated Plasma Protein-A in Ovarian Cancer Cells Promotes Tumor Growth in Vivo;Henning B. Boldt等;《Endocrinology》;20110430;第152卷(第4期);第1470-1478页 *
妊娠相关血浆蛋白A与冠心病的关系研究进展;于勤;《国外医学内科学分册》;20050831;第32卷(第8期);第334-337页 *

Also Published As

Publication number Publication date
CN108676893A (en) 2018-10-19

Similar Documents

Publication Publication Date Title
AU2012272858B2 (en) Diagnostic methods for eosinophilic esophagitis
CN110484624B (en) Gastric cancer biomarker based on peripheral blood and detection method and application thereof
Hart et al. Endoscopic pancreas fluid collection: methods and relevance for clinical care and translational science
WO2017054325A1 (en) Breast cancer combined diagnosis markers and detection kit
JP2020513574A (en) Composition for diagnosing disease
JP7531916B2 (en) Esophageal cancer biomarkers and their uses
CN108676893B (en) Biomarker for detecting colorectal cancer and application thereof
TWI387750B (en) Biomarker and detection method for detecting kidney disease
CN112501294A (en) Colorectal cancer biomarker and application thereof
KR102211972B1 (en) Method for early diagnosis of breast cancer and monitoring after treatment using liquid biopsy multi-cancer gene biomarkers
JP7345860B2 (en) Gastric cancer biomarkers and their uses
CN114150048B (en) System, method and method establishment for IgA nephropathy detection
CN112210603A (en) Application of combined gene in esophageal squamous carcinoma
CN111733226A (en) Circular RNA marker for detecting Crohn&#39;s disease and application
CN113009155B (en) Application of FGF20 in preparation of reagent for diagnosing ulcerative colitis
CN111662985B (en) Application of microRNA combined CEA in preparation of cervical cancer early diagnosis kit
CN115011602B (en) circRNA marker for diagnosing acute respiratory distress syndrome, detection reagent and kit
CN114958859B (en) circRNA marker and diagnostic reagent for diagnosing acute respiratory distress syndrome
CN112176060B (en) Plasma non-coding RNA and primer set for detecting expression level thereof and colorectal cancer detection kit
JP7514458B2 (en) Method for predicting efficacy of therapeutic drugs for rheumatoid arthritis and biomarkers used therein
EP4249601A1 (en) Method for assisting determination on adaptability of esophageal cancer to endoscopic therapy, method for determining adaptability of esophageal cancer to endoscopic therapy, method for collecting data for use in determination on adaptability of esophageal cancer to endoscopic therapy, method for diagnosing adaptability of esophageal cancer to endoscopic therapy, in vitro method for assisting determination on adaptability of esophageal cancer to endoscopic therapy, method for testing on adaptability of esophageal cancer to endoscopic therapy, method for diagnosing adaptability of esophageal cancer to endoscopic therapy, diagnosis kit, and method for treating esophageal cancer
TWI690597B (en) Detection kit and detection method for urothelial carcinoma
Zou et al. Detection of α1 and β2-Microglobulin Using Gold Nanoparticle-Based Duplex Polymerase Chain Reaction Assay
Samir et al. Urinary biomarkers analysis as a diagnostic tool for early detection of pancreatic adenocarcinoma: Molecular quantification approach
Mao et al. Helicobacter Pylori Infection is Associated with an Increased Stress Ulcer Risk in Brainstem Hemorrhage Patients with Robot-Aided Stereotactic Hematoma Aspiration

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant