CN108663522A - Carcinoma of urinary bladder detection kit - Google Patents
Carcinoma of urinary bladder detection kit Download PDFInfo
- Publication number
- CN108663522A CN108663522A CN201810541544.7A CN201810541544A CN108663522A CN 108663522 A CN108663522 A CN 108663522A CN 201810541544 A CN201810541544 A CN 201810541544A CN 108663522 A CN108663522 A CN 108663522A
- Authority
- CN
- China
- Prior art keywords
- antibody
- antigen
- nmp22
- kit according
- carcinoma
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- Cell Biology (AREA)
- Pathology (AREA)
- Food Science & Technology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a kind of carcinoma of urinary bladder detection kits.The carcinoma of urinary bladder detection kit includes the monoclonal antibody and polyclonal antibody of anti-NMP22, monoclonal antibody and polyclonal antibody are obtained by the design of multidigit point antigen sequence array, construction of recombinant plasmid, antigen prokaryotic expression, antigen protein purifying and animal immune reaction and antibody purification using mankind NUMA1 genes, wherein, multidigit point antigen sequence array is the amino acid sequence that can cover NUMA1 antigenic determinants obtained by antigen protein structural analysis and computation and stacked tile type design.It applies the technical scheme of the present invention, the amino acid sequence that can cover NUMA1 antigenic determinants that multidigit point antigen sequence array is obtained by antigen protein structural analysis and computation and stacked tile type design, greatlys improve the success rate of Antibody preparation and the sensitivity and specificity of carcinoma of urinary bladder detection kit.
Description
Technical field
The present invention relates to biomedicine fields, in particular to a kind of carcinoma of urinary bladder detection kit.
Background technology
In Patients with Urinary System Tumors, the incidence height of wing flesh cancer ranks first, and the incidence of wing flesh cancer has rising in recent years
Trend.Non- Myometrial involvement wing moon bright cancer in well differentiated or medium differentiation when most of wing skin cancer patient makes a definite diagnosis, wherein about
10% patient finally develops into Myometrial involvement wing skin cancer or metastatic wing skin cancer.In the various operative treatments for retaining wing skin
In, about 50% in 2a tumour may recur, about 10%~15% recurrent tumor grade malignancy has increase trend, therefore long-term
Follow-up early detection tumor recurrence is one of successful key of the dirty oncotherapy of wing.
Currently, clinically diagnostic measures mainly have urine sediment inspection, cystoscopy and tissue biopsy.Urine falls off thin
Born of the same parents, which learn, checks that specificity is high, but sensibility is low, is especially easy to miss inspection C1 grades of tumours (BTA90%).And cystoscope is invasive inspection, no
It can early diagnose and patient compliance is poor.
At this stage, a kind of a kind of detection method that fast qualitative again can be early diagnosed as carcinoma of urinary bladder is urgently developed,
Invention content
The present invention is intended to provide a kind of carcinoma of urinary bladder detection kit, to realize the fast of carcinoma of urinary bladder early diagnosis or prognostic monitoring
Fast qualitatively detection.
To achieve the goals above, according to an aspect of the invention, there is provided a kind of carcinoma of urinary bladder detection kit.The wing
Guang cancer detection kit includes the monoclonal antibody and polyclonal antibody of anti-NMP22, and monoclonal antibody and polyclonal antibody are profits
Pass through the design of multidigit point antigen sequence array, construction of recombinant plasmid, antigen prokaryotic expression, antigen protein with mankind NUMA1 genes
Purifying and animal immune reaction and antibody purification are obtained, wherein multidigit point antigen sequence array is by antigen protein knot
The amino acid sequence that can cover NUMA1 antigenic determinants that structure analysis calculates and stacked tile type design obtains.
Further, multidigit point antigen sequence array has amino acid sequence shown in table 1；
Table 1
Further, monoclonal antibody and polyclonal antibody are marked by horseradish peroxidase makees, antibody concentration 1mg/mL.
Further, animal immune reaction is immune BALB/c mouse and new zealand white rabbit.
Further, when construction of recombinant plasmid, used primer sequence is shown in Table 2：
Table 2
| Primer titles | Primer sequence (5'to3') |
| C001F(SEQ ID NO：31) | CGGGATCCATGTCTCCAGCTTCTCCCATGG |
| COO1R(SEQ ID NO：32) | GGAATTCCTTCTCTGTCTTCAGGTCCTGGC |
| C002F(SEQ ID NO：33) | CGGGATCCATGGGGACCCCACTCAGTATCACC |
| COO2R(SEQ ID NO：34) | GGAATTCGTTGCCATAATCGGGAGAACCCAG |
| C029F(SEQ ID NO：35) | CGGGATCCCTCGAACTCCCGACCTCAGATGAT |
| COO29R(SEQ ID NO：36) | GGAATTCCTTGATCTCAGGAGTTGAAGGCTG |
| C030F(SEQ ID NO：37) | CGGGATCCTGGGACTACAGGCGCCCACCAC |
| CO30R(SEQ ID NO：38) | GGAATTCCCTGAGGTCAGGAGTTTGAGACCA |
Further, the monoclonal antibody of anti-NMP22 and polyclonal antibody are coated on porous plate.
Further, further include：People NMP22 standard items 1~6, binding antibody, ELIAS secondary antibody, cleaning solution, Sample Dilution
Liquid, color developing agent and terminate liquid.
Further, kit is applied to use double antibodies sandwich multidigit point ELISA detection method.
Further, when using double antibodies sandwich multidigit point ELISA detection method, wherein monoclonal antibody and polyclonal
For antibody as coated antibody, peridium concentration is 2 μ g/mL.
It applies the technical scheme of the present invention, multidigit point antigen sequence array passes through antigen protein structural analysis and computation and imbrication
Formula design obtain the amino acid sequence that can cover NUMA1 antigenic determinants, greatly improve Antibody preparation success rate and
The sensitivity and specificity of carcinoma of urinary bladder detection kit.
Description of the drawings
The accompanying drawings which form a part of this application are used to provide further understanding of the present invention, and of the invention shows
Meaning property embodiment and its explanation are not constituted improper limitations of the present invention for explaining the present invention.In the accompanying drawings：
Fig. 1 shows that the design of multidigit point antigen sequence array and Anti-NMP22 detection diagrams are intended in embodiment 1；
Fig. 2 shows the NMP22 protein ELISA canonical plottings of embodiment 1；
Fig. 3 shows carcinoma of urinary bladder urine NMP22 detections figure compared with other detections in embodiment 1；
Fig. 4 shows the NMP22 urinary protein concentrations detection figures of embodiment 1；And
Fig. 5 shows that the carcinoma of urinary bladder test urine sample pretreatment of embodiment 1 is front and back and NMP22 Urine proteins purity compares.
Specific implementation mode
It should be noted that in the absence of conflict, the features in the embodiments and the embodiments of the present application can phase
Mutually combination.The present invention will be described in detail below with reference to the accompanying drawings and embodiments.
According to a kind of typical embodiment of the present invention, a kind of carcinoma of urinary bladder detection kit is provided, including anti-NMP22
Monoclonal antibody and polyclonal antibody, monoclonal antibody and polyclonal antibody are to utilize mankind NUMA1 genes (Entrez Gene:
4926) pass through the design of multidigit point antigen sequence array, construction of recombinant plasmid, antigen prokaryotic expression, antigen protein purifying and animal
Immune response and antibody purification are obtained, wherein multidigit point antigen sequence array is by antigen protein structural analysis and computation
And the amino acid sequence that can cover NUMA1 antigenic determinants that stacked tile type design obtains.
Antigen protein structure is three-dimensional, is like a ball of string, and antigenic determinant is exactly a point on a ball of string, and with
Its amino acid sequence closed on by structural analysis, calculate, be not simple linear " stacked tile type design " because, two
The flanking sequence of dimensional linear structure, in active protein three-dimensional structure, possible and non-conterminous, far apart sometimes, base
In above-mentioned restriction, skilled artisans appreciate that and completing the design of multidigit point antigen sequence array.
It applies the technical scheme of the present invention, multidigit point antigen sequence array passes through antigen protein structural analysis and computation and imbrication
Formula design obtains and covers the amino acid sequence of NUMA1 antigenic determinants, greatlys improve the success rate and bladder of Antibody preparation
The sensitivity and specificity of cancer detection kit.
Preferably, multidigit point antigen sequence array has amino acid sequence shown in table 1；
Table 1
Success rate prepared by above-mentioned antigen-antibody is very high.
Preferably, the mass ratio of monoclonal antibody is 1B9：5F6：6D2=2:1:3, the monoclonal that this proportioning obtains is anti-
Detection sensitivity can be improved in body.
According to a kind of typical embodiment of the present invention, monoclonal antibody and/or polyclonal antibody are by horseradish peroxidase
Label is made, antibody concentration 1mg/mL.Preferably, animal immune reaction is immune BALB/c mouse and new zealand white rabbit.
Preferably, when construction of recombinant plasmid, used primer sequence is shown in Table 2.
Table 2
Preferably, the monoclonal antibody of anti-NMP22 and polyclonal antibody are coated on porous plate, facilitate subsequent detection
Operation.
According to a kind of typical embodiment of the present invention, kit further includes：People NMP22 standard items 1~6, in conjunction with anti-
Body, ELIAS secondary antibody, cleaning solution, Sample dilution, color developing agent and terminate liquid.
According to a kind of typical embodiment of the present invention, kit is applied to using the ELISA detections of double antibodies sandwich multidigit point
Method.Preferably, when using double antibodies sandwich multidigit point ELISA detection method, wherein monoclonal antibody and/or Anti-TNF-α
For body as coated antibody, peridium concentration is 2 μ g/mL.
In a kind of typical embodiment of the present invention, construction recombination plasmid pET30a-NMP22, pGEX-6P-1-
NMP22 carries out protein expression and purification, obtains HIS/GST prokaryotic expression proteins, then using e. coli bl21 as expressive host
Immune BALB/c mouse and new zealand white rabbit, obtain list, the polyclonal antibody of anti-NMP22.
In a kind of typical embodiment of the present invention, unique computer data automatic collection point may be used in the present invention
Analysis system, such as the present invention can be connected using BIO-RAD 680Microplate reader with computer, realize detection
Automatic collection, analysis and the automatic printing output of examining report of data, facilitate medical worker's use in hospital laboratory
And it is universal.
The advantageous effect further illustrated the present invention below in conjunction with embodiment.
Embodiment 1
The present embodiment kit includes：(1) porous plate of anti-human NMP22 monoclonal antibodies, (2) people NMP22 marks are coated with
Quasi- product 1-6, (3) binding antibody (polyclonal antibody, as detection antibody), (4) ELIAS secondary antibody, (5) cleaning solution, (6) sample
Dilution, (7) color developing agent A liquid, (8) color developing agent B liquid, (9) terminate liquid.
It is as follows using the brand and model of reagent or splitter etc. in the present embodiment：
NI columns：Health is century bio tech ltd, article No. 3013J
GST columns：Health is century bio tech ltd, article No. CW0190S
Freund's complete adjuvant/incomplete Freund's adjuvant：Sigma, article No. F5881/F5506
Protein A columns：Thermo, article No. 20333
Antibody is obtained especially by following steps in kit：
I. multidigit point antigen sequence designs：
It was verified that only using only ANTIGEN DESIGNThe software come to predict antigenic determinant (antigenic epitope) be remote
Not nearly enough.If ANTIGEN DESIGNThe is inaccurate or malfunctions, a large amount of time and money will be wasted.For ensure antibody sensitivity and
Specificity, the present invention are designed using multidigit point antigen sequence array, are prepared and are used for clinical detection or the antibody as antibody drug.
The antigen for NMP22 antibody used in carcinoma of urinary bladder detection kit, multidigit point antigen sequence implementation sequence table such as the following table 1 institute
Show.
Table 1
| Antigen sequence is numbered | Amino acid sequence |
| Seu-aa-001(SEQ ID NO：1) | MTLHATRGAALLSWV |
| Seu-aa-002(SEQ ID NO：2) | AALLSWVNSLHVADP |
| Seu-aa-003(SEQ ID NO：3) | SLHVADPVEAVLQLQ |
| Seu-aa-004(SEQ ID NO：4) | EAVLQLQDCSIFIKI |
| Seu-aa-005(SEQ ID NO：5) | CSIFIKIIDRIHGTE |
| Seu-aa-006(SEQ ID NO：6) | DRIHGTEEGQQILKQ |
| Seu-aa-007(SEQ ID NO：7) | GQQILKQPVSERLDF |
| Seu-aa-008(SEQ ID NO：8) | VSERLDFVCSFLQKN |
| Seu-aa-009(SEQ ID NO：9) | CSFLQKNRKHPSSPE |
| Seu-aa-010(SEQ ID NO：10) | KHPSSPECLVSAQKV |
| Seu-aa-011(SEQ ID NO：11) | LVSAQKVLEGSELEL |
| Seu-aa-012(SEQ ID NO：12) | EGSELELAKMTMLLL |
| Seu-aa-013(SEQ ID NO：13) | KMTMLLLYHSTMSSK |
| Seu-aa-014(SEQ ID NO：14) | HSTMSSKSPRDWEQF |
| Seu-aa-015(SEQ ID NO：15) | PRDWEQFEYKIQAEL |
| Seu-aa-016(SEQ ID NO：16) | YKIQAELAVILKFVL |
| Seu-aa-017(SEQ ID NO：17) | VILKFVLDHEDGLNL |
| Seu-aa-018(SEQ ID NO：18) | HEDGLNLNEDLENFL |
| Seu-aa-019(SEQ ID NO：19) | EDLENFLQKAPVPST |
| Seu-aa-020(SEQ ID NO：20) | KAPVPSTCSSTFPEE |
| Seu-aa-021(SEQ ID NO：21) | SSTFPEELSPPSHQA |
| Seu-aa-022(SEQ ID NO：22) | SPPSHQAKREIRFLE |
| Seu-aa-023(SEQ ID NO：23) | REIRFLELQKVASSS |
| Seu-aa-024(SEQ ID NO：24) | QKVASSSSGNNFLSG |
| Seu-aa-025(SEQ ID NO：25) | GNNFLSGSPASPMGD |
| Seu-aa-026(SEQ ID NO：26) | PASPMGDILQTPQFQ |
| Seu-aa-027(SEQ ID NO：27) | LQTPQFQMRRLKKQL |
| Seu-aa-028(SEQ ID NO：28) | RRLKKQLADERSNRD |
| Seu-aa-029(SEQ ID NO：29) | KKQLADERSNRDELE |
| Seu-aa-030(SEQ ID NO：30) | KQLADERSNRDELEL |
Multidigit point antigen sequence designs and Anti-NMP22 detects schematic diagrams are as shown in Figure 1.
2. the preparation of antigen
Target gene is building up on plasmid pET30a and pGEX-6P-1, and is that host carries out egg with e. coli bl21
White expression, by thalline through NI columns (health is century bio tech ltd, article No. 3013J) or GST column (health after ultrasonication
For century bio tech ltd, article No. CW0190S) it is purified, the prokaryotic expression protein of HIS/GST labels is obtained, i.e.,
For antigen.
3. the preparation of antibody
A. Anti-TNF-α antibody preparation procedures
1) animal is immunized and prepares antiserum
Take antigen and isometric Freund's complete adjuvant (Sigma, article No. F5881) or incomplete Freund's adjuvant (Sigma, goods
Number F5506) it is fully emulsified after immune new zealand white rabbit, each dosage is 100ug/ml, and point 10 intracutaneous injections are immunized 3 altogether
~4 times, final immunization takes ear vein hematometry antibody titer after the 7th day.
2) antibody titer is measured
It is measured with Elisa methods, as a result shows antibody titer up to 1:100000 or more.
3) blood and separation serum are taken
Serum is collected in arteria carotis bloodletting.
B. monoclonal antibody preparation flow
1) animal is immunized and prepares antiserum
Choose 6~8 week old BALB/c mouses, antigen and adjuvant 1:1 mixing, dosage are 100ug/.It carries out every two weeks
Primary immunization is immunized 3 times altogether, and blood sampling of docking after third time is 9 days immune, separation serum carries out antibody titer analysis.
2) antibody titer is analyzed
The splenocyte for generating the highest mouse of antibody titer is taken to be combined with oncocyte, obtaining can the anti-NMP22 egg of stably excreting
White hybridoma；It collects, the monoclonal antibody of purified hybrid oncocyte secretion, the monoclonal of as anti-NMP22 albumen is anti-
Body.
Antibody is purified using Protein A columns (Thermo, article No. 20333), is as follows：
(1) lower knob on Protein A columns is backed out, adds 1 × PBS of 10 times of column volumes (30ml) with 5ml/min's
Speed washs pillar, and washing lotion is held with small beaker；
(2) it uses 5ml syringes to draw appropriate amount of sample, is filtered in clean 10ml centrifuge tubes using 0.45um filters
(being labeled as A), adds equivalent PBS and is diluted；
(3) it draws the sample in A pipes using disposable measuring pipette and crosses Protein A columns, speed 5ml/min is flowed through
It is picked up with 10ml centrifuge tubes and (is labeled as B)；
(4) it draws the sample in B pipes using disposable measuring pipette and crosses Protein A columns, speed 5ml/min is flowed through
It is picked up with A pipes；
(5) it is primary to repeat step 3；
(6) it draws 5mlPBS with 5ml syringes and washs pillar, washing lotion is held with small beaker, in triplicate；
(7) it is 1~No. 8 by 8 1.5ml centrifuge tube number consecutivelies, 500ul 1M is added into pipe using 1ml pipettors
Tris；6ml 0.1M citric acids are drawn in pillar using disposable measuring pipette, and antibody elution picks up elution with 1~No. 8 pipe
Liquid, since dripping first.Often pipe is connected to 1.25ml, and mixing is deposited in 4 DEG C.
The antibody protein of purifying carries out concentration mensuration using BCA methods, and steps are as follows：
(1) BCA standard specimens are prepared, are specifically shown in Table 2.
Table 2
(2) sample dilutes
Protein sample is diluted to 20,40,80 times respectively；
(3) working solution is prepared
The working solution that suitable volumes are prepared according to the sample size to be detected, by A liquid：B liquid：Liquid=25 C:25:1 prepares；
(4) it is loaded
125ul samples and 125ul working solutions are added per hole；
(5) readings
ELISA Plate is put into 60 DEG C of constant temperature and is incubated 15min, in OD450Nm readings；
(6) result of calculation
The concentration of sample is calculated according to standard curve (NMP22 protein ELISA standard curves are shown in Fig. 3) and extension rate.
Material：Sample is the urine of people
Using the specific detecting step of kit of the present invention
(1) kit is taken out from 4 DEG C of refrigerators, balance to room temperature.
(2) sample to be checked and the holes standard items 100ul/ is added, is diplopore, while setting blank well, is sealed with sealed membrane, 37
DEG C be incubated 60min, wash 5 times, pat dry.
(3) binding antibody, the holes 100ul/ are added in each hole, 37 DEG C of incubation 30min are washed 5 times, patted dry.
(4) anti-human IgG antibodies for being marked with horseradish peroxidase, the holes 100ul/ are added, 37 DEG C of incubation 30min are washed
It washs 5 times, pats dry.
(5) holes color developing agent A liquid 100ul/, mixing, 37 DEG C of incubation 15min. are added
(6) plus the holes terminate liquid 50ul/ terminate reaction, and the absorbance value at the 450nm in each hole is measured with microplate reader.
Result judgement：The OD values of OD values-blank well of OD ratios=specimen hole to be measured pass through people's NMP22ELISA detection marks
Directrix curve (see Fig. 2) result of calculation.
The mode of cystoscopy combination NMP22 detections will more accurately detect carcinoma of urinary bladder, and accuracy rate is respectively：
90.8/95.1/99.1 (see Fig. 3, wherein A represents BLOBS bladder observation, and B represents BLOBS bladder observation+urinalysis, C represent BLOBS bladder observation+
NMP22 is detected).
Urine NMP22 contents in transitional cell bladder carcinoma cell line are at least 25 times higher than normal cell, and in Apoptosis, NMP22 can be cracked
It is discharged into urine at the segment to differ in size or in the form of complex, bladder cancer patients, bladder benign tumour and normal person
Urine NMP22 contents see Fig. 4
The results are shown in Table 3 with other detections for carcinoma of urinary bladder urine NMP22 detections.
Table 3
| Detection | Sensitivity (%) | Specific (%) |
| Cytology detects | 50 | 96 |
| NMP22 is detected | 70 | 76 |
| BTA is detected | 51 | 83 |
| FDP is detected | 66 | 75 |
Since the content of NMP22 in urine is extremely low, even if bladder cancer patients urine NMP22 concentration levels are non-cancer control group
20~80 times, but still be difficult to be measured with conventional ELISA method.The present invention can use affine magnetic bead (Affinity
Magnetic Beads) it carcinoma of urinary bladder test urine sample is pre-processed obtains the detection albumen in test urine sample (see Fig. 5)
100~500 times of concentration, substantially increases the sensitivity of diagnosis, while having the characteristics that quick, easy.
The present invention filters out multiple antigen sites simultaneously, and conjugated protein analysis and ANTIGEN DESIGNThe software predict antigen
Determinant (sequence and design philosophy are as described above) greatly improves the success rate for having resisted body to prepare and carcinoma of urinary bladder of the present invention detection examination
The sensitivity and specificity of agent box.In fact, in the case where the current country is artificial and biomaterial is relatively cheap, time cost
Seem by being prominent.The success rate that antibody of the present invention makes is up to 98%, and the preparation time period is most short.The bladder of the present invention
Cancer urinates the NMP22 that detection kit can detect about 0.1IU/mL in sample.
The foregoing is only a preferred embodiment of the present invention, is not intended to restrict the invention, for the skill of this field
For art personnel, the invention may be variously modified and varied.All within the spirits and principles of the present invention, any made by repair
Change, equivalent replacement, improvement etc., should all be included in the protection scope of the present invention.
Sequence table
<110>Hebei member of Imperial Academy bio tech ltd
<120>Carcinoma of urinary bladder detection kit
<130> 2017-SJZSY-12
<141> 2018-01-16
<160> 38
<170> SIPOSequenceListing 1.0
<210> 1
<211> 15
<212> PRT
<213> Homo sapiens
<400> 1
Met Thr Leu His Ala Thr Arg Gly Ala Ala Leu Leu Ser Trp Val
1 5 10 15
<210> 2
<211> 15
<212> PRT
<213> Homo sapiens
<400> 2
Ala Ala Leu Leu Ser Trp Val Asn Ser Leu His Val Ala Asp Pro
1 5 10 15
<210> 3
<211> 15
<212> PRT
<213> Homo sapiens
<400> 3
Ser Leu His Val Ala Asp Pro Val Glu Ala Val Leu Gln Leu Gln
1 5 10 15
<210> 4
<211> 15
<212> PRT
<213> Homo sapiens
<400> 4
Glu Ala Val Leu Gln Leu Gln Asp Cys Ser Ile Phe Ile Lys Ile
1 5 10 15
<210> 5
<211> 15
<212> PRT
<213> Homo sapiens
<400> 5
Cys Ser Ile Phe Ile Lys Ile Ile Asp Arg Ile His Gly Thr Glu
1 5 10 15
<210> 6
<211> 15
<212> PRT
<213> Homo sapiens
<400> 6
Asp Arg Ile His Gly Thr Glu Glu Gly Gln Gln Ile Leu Lys Gln
1 5 10 15
<210> 7
<211> 15
<212> PRT
<213> Homo sapiens
<400> 7
Gly Gln Gln Ile Leu Lys Gln Pro Val Ser Glu Arg Leu Asp Phe
1 5 10 15
<210> 8
<211> 15
<212> PRT
<213> Homo sapiens
<400> 8
Val Ser Glu Arg Leu Asp Phe Val Cys Ser Phe Leu Gln Lys Asn
1 5 10 15
<210> 9
<211> 15
<212> PRT
<213> Homo sapiens
<400> 9
Cys Ser Phe Leu Gln Lys Asn Arg Lys His Pro Ser Ser Pro Glu
1 5 10 15
<210> 10
<211> 15
<212> PRT
<213> Homo sapiens
<400> 10
Lys His Pro Ser Ser Pro Glu Cys Leu Val Ser Ala Gln Lys Val
1 5 10 15
<210> 11
<211> 15
<212> PRT
<213> Homo sapiens
<400> 11
Leu Val Ser Ala Gln Lys Val Leu Glu Gly Ser Glu Leu Glu Leu
1 5 10 15
<210> 12
<211> 15
<212> PRT
<213> Homo sapiens
<400> 12
Glu Gly Ser Glu Leu Glu Leu Ala Lys Met Thr Met Leu Leu Leu
1 5 10 15
<210> 13
<211> 15
<212> PRT
<213> Homo sapiens
<400> 13
Lys Met Thr Met Leu Leu Leu Tyr His Ser Thr Met Ser Ser Lys
1 5 10 15
<210> 14
<211> 15
<212> PRT
<213> Homo sapiens
<400> 14
His Ser Thr Met Ser Ser Lys Ser Pro Arg Asp Trp Glu Gln Phe
1 5 10 15
<210> 15
<211> 15
<212> PRT
<213> Homo sapiens
<400> 15
Pro Arg Asp Trp Glu Gln Phe Glu Tyr Lys Ile Gln Ala Glu Leu
1 5 10 15
<210> 16
<211> 15
<212> PRT
<213> Homo sapiens
<400> 16
Tyr Lys Ile Gln Ala Glu Leu Ala Val Ile Leu Lys Phe Val Leu
1 5 10 15
<210> 17
<211> 15
<212> PRT
<213> Homo sapiens
<400> 17
Val Ile Leu Lys Phe Val Leu Asp His Glu Asp Gly Leu Asn Leu
1 5 10 15
<210> 18
<211> 15
<212> PRT
<213> Homo sapiens
<400> 18
His Glu Asp Gly Leu Asn Leu Asn Glu Asp Leu Glu Asn Phe Leu
1 5 10 15
<210> 19
<211> 15
<212> PRT
<213> Homo sapiens
<400> 19
Glu Asp Leu Glu Asn Phe Leu Gln Lys Ala Pro Val Pro Ser Thr
1 5 10 15
<210> 20
<211> 15
<212> PRT
<213> Homo sapiens
<400> 20
Lys Ala Pro Val Pro Ser Thr Cys Ser Ser Thr Phe Pro Glu Glu
1 5 10 15
<210> 21
<211> 15
<212> PRT
<213> Homo sapiens
<400> 21
Ser Ser Thr Phe Pro Glu Glu Leu Ser Pro Pro Ser His Gln Ala
1 5 10 15
<210> 22
<211> 15
<212> PRT
<213> Homo sapiens
<400> 22
Ser Pro Pro Ser His Gln Ala Lys Arg Glu Ile Arg Phe Leu Glu
1 5 10 15
<210> 23
<211> 15
<212> PRT
<213> Homo sapiens
<400> 23
Arg Glu Ile Arg Phe Leu Glu Leu Gln Lys Val Ala Ser Ser Ser
1 5 10 15
<210> 24
<211> 15
<212> PRT
<213> Homo sapiens
<400> 24
Gln Lys Val Ala Ser Ser Ser Ser Gly Asn Asn Phe Leu Ser Gly
1 5 10 15
<210> 25
<211> 15
<212> PRT
<213> Homo sapiens
<400> 25
Gly Asn Asn Phe Leu Ser Gly Ser Pro Ala Ser Pro Met Gly Asp
1 5 10 15
<210> 26
<211> 15
<212> PRT
<213> Homo sapiens
<400> 26
Pro Ala Ser Pro Met Gly Asp Ile Leu Gln Thr Pro Gln Phe Gln
1 5 10 15
<210> 27
<211> 15
<212> PRT
<213> Homo sapiens
<400> 27
Leu Gln Thr Pro Gln Phe Gln Met Arg Arg Leu Lys Lys Gln Leu
1 5 10 15
<210> 28
<211> 15
<212> PRT
<213> Homo sapiens
<400> 28
Arg Arg Leu Lys Lys Gln Leu Ala Asp Glu Arg Ser Asn Arg Asp
1 5 10 15
<210> 29
<211> 15
<212> PRT
<213> Homo sapiens
<400> 29
Lys Lys Gln Leu Ala Asp Glu Arg Ser Asn Arg Asp Glu Leu Glu
1 5 10 15
<210> 30
<211> 15
<212> PRT
<213> Homo sapiens
<400> 30
Lys Gln Leu Ala Asp Glu Arg Ser Asn Arg Asp Glu Leu Glu Leu
1 5 10 15
<210> 31
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<221> primer_bind
<222> (1)..(30)
<223>Construction of recombinant plasmid primer
<400> 31
cgggatccat gtctccagct tctcccatgg 30
<210> 32
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<221> primer_bind
<222> (1)..(30)
<223>Construction of recombinant plasmid primer
<400> 32
ggaattcctt ctctgtcttc aggtcctggc 30
<210> 33
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<221> protein_bind
<222> (1)..(32)
<223>Construction of recombinant plasmid primer
<400> 33
cgggatccat ggggacccca ctcagtatca cc 32
<210> 34
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<221> primer_bind
<222> (1)..(31)
<223>Construction of recombinant plasmid primer
<400> 34
ggaattcgtt gccataatcg ggagaaccca g 31
<210> 35
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<221> primer_bind
<222> (1)..(32)
<223>Construction of recombinant plasmid primer
<400> 35
cgggatccct cgaactcccg acctcagatg at 32
<210> 36
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<221> primer_bind
<222> (1)..(31)
<223>Construction of recombinant plasmid primer
<400> 36
ggaattcctt gatctcagga gttgaaggct g 31
<210> 37
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<221> primer_bind
<222> (1)..(30)
<223>Construction of recombinant plasmid primer
<400> 37
cgggatcctg ggactacagg cgcccaccac 30
<210> 38
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<221> primer_bind
<222> (1)..(31)
<223>Construction of recombinant plasmid primer
<400> 38
ggaattccct gaggtcagga gtttgagacc a 31
Claims (9)
1. a kind of carcinoma of urinary bladder detection kit, which is characterized in that the monoclonal antibody including anti-NMP22 and polyclonal antibody, institute
It is to pass through the design of multidigit point antigen sequence array, recombination matter using mankind NUMA1 genes to state monoclonal antibody and polyclonal antibody
Grain structure, the purifying of antigen prokaryotic expression, antigen protein and animal immune reaction and antibody purification are obtained, wherein described more
Site antigen sequence array is can to cover NUMA1 antigens by what antigen protein structural analysis and computation and stacked tile type design obtained
The amino acid sequence of determinant.
2. kit according to claim 1, which is characterized in that the multidigit point antigen sequence array has institute in table 1
The amino acid sequence shown；
Table 1
3. kit according to claim 1, which is characterized in that the monoclonal antibody and polyclonal antibody are by horseradish mistake
Oxidase label is made, antibody concentration 1mg/mL.
4. kit according to claim 1, which is characterized in that animal immune reaction be immune BALB/c mouse and
New zealand white rabbit.
5. kit according to claim 1, which is characterized in that when construction of recombinant plasmid, used primer sequence is shown in
Table 2：
Table 2
6. kit according to claim 1, which is characterized in that the monoclonal antibody and Anti-TNF-α of the anti-NMP22
Body is coated on porous plate.
7. kit according to claim 1, which is characterized in that further include：People NMP22 standard items 1~6, in conjunction with anti-
Body, ELIAS secondary antibody, cleaning solution, Sample dilution, color developing agent and terminate liquid.
8. kit according to claim 1, which is characterized in that the kit is applied to use double antibodies sandwich multidigit point
ELISA detection method.
9. kit according to claim 8, which is characterized in that when using double antibodies sandwich multidigit point ELISA detection method
When, wherein as coated antibody, peridium concentration is 2 μ g/mL for the monoclonal antibody and polyclonal antibody.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810541544.7A CN108663522B (en) | 2018-05-30 | 2018-05-30 | Bladder cancer detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810541544.7A CN108663522B (en) | 2018-05-30 | 2018-05-30 | Bladder cancer detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108663522A true CN108663522A (en) | 2018-10-16 |
| CN108663522B CN108663522B (en) | 2021-05-11 |
Family
ID=63774595
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810541544.7A Active CN108663522B (en) | 2018-05-30 | 2018-05-30 | Bladder cancer detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108663522B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112946272A (en) * | 2021-01-28 | 2021-06-11 | 陈卫国 | Rapid detection kit for nuclear matrix protein 22 and application thereof |
| CN113249445A (en) * | 2021-05-28 | 2021-08-13 | 北京保图生物技术有限公司 | Nucleic acid-antibody dual cancer detection kit |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1880447A (en) * | 2005-06-17 | 2006-12-20 | 上海生物芯片有限公司 | Process for preparing high-flux monoclonal antibody |
| CN103245788A (en) * | 2013-03-22 | 2013-08-14 | 赵树民 | Peptide array synthesis technology for B cell antigen epitope screening |
| US20140072987A1 (en) * | 2012-09-12 | 2014-03-13 | Randox Laboratories Ltd. | Methods of detecing bladder cancer |
| CN104267197A (en) * | 2014-10-24 | 2015-01-07 | 浙江东方基因生物制品有限公司 | Nuclear matrix protein 22 chemiluminescent immunodetection reagent kit and preparing method thereof |
| CN105017419A (en) * | 2015-07-06 | 2015-11-04 | 北京普恩光德生物科技开发有限公司 | Anti-human NMP-22 monoclonal antibody and detection kit thereof |
| CN105218669A (en) * | 2014-06-10 | 2016-01-06 | 河北翰林生物科技有限公司 | Prepare the method for the human monoclonal antibodies of anti-human R47H-TREM2 mutant |
| CN106153933A (en) * | 2015-03-26 | 2016-11-23 | 广州瑞博奥生物科技有限公司 | A kind of immunological reagent box of efficient quantitative detection c reactive protein |
-
2018
- 2018-05-30 CN CN201810541544.7A patent/CN108663522B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1880447A (en) * | 2005-06-17 | 2006-12-20 | 上海生物芯片有限公司 | Process for preparing high-flux monoclonal antibody |
| US20140072987A1 (en) * | 2012-09-12 | 2014-03-13 | Randox Laboratories Ltd. | Methods of detecing bladder cancer |
| CN103245788A (en) * | 2013-03-22 | 2013-08-14 | 赵树民 | Peptide array synthesis technology for B cell antigen epitope screening |
| CN105218669A (en) * | 2014-06-10 | 2016-01-06 | 河北翰林生物科技有限公司 | Prepare the method for the human monoclonal antibodies of anti-human R47H-TREM2 mutant |
| CN104267197A (en) * | 2014-10-24 | 2015-01-07 | 浙江东方基因生物制品有限公司 | Nuclear matrix protein 22 chemiluminescent immunodetection reagent kit and preparing method thereof |
| CN106153933A (en) * | 2015-03-26 | 2016-11-23 | 广州瑞博奥生物科技有限公司 | A kind of immunological reagent box of efficient quantitative detection c reactive protein |
| CN105017419A (en) * | 2015-07-06 | 2015-11-04 | 北京普恩光德生物科技开发有限公司 | Anti-human NMP-22 monoclonal antibody and detection kit thereof |
Non-Patent Citations (2)
| Title |
|---|
| ATLAS ANTIBODIES: "Anti-NUMA1 Antibody (HPA019841)", 《HTTPS://WWW.ATLASANTIBODIES.COM/PRODUCTS/ANTIBODIES/PRIMARY-ANTIBODIES/TRIPLE-A-POLYCLONALS/NUMA1-ANTIBODY-HPA019841/》 * |
| ATLAS ANTIBODIES: "Anti-NUMA1 Antibody (HPA019859)", 《HTTPS://WWW.ATLASANTIBODIES.COM/PRODUCTS/ANTIBODIES/PRIMARY-ANTIBODIES/TRIPLE-A-POLYCLONALS/NUMA1-ANTIBODY-HPA019859/》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112946272A (en) * | 2021-01-28 | 2021-06-11 | 陈卫国 | Rapid detection kit for nuclear matrix protein 22 and application thereof |
| CN113249445A (en) * | 2021-05-28 | 2021-08-13 | 北京保图生物技术有限公司 | Nucleic acid-antibody dual cancer detection kit |
| CN113249445B (en) * | 2021-05-28 | 2022-01-04 | 杭州康佰裕医学检验实验室有限公司 | Nucleic acid-antibody dual cancer detection kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108663522B (en) | 2021-05-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101048659B (en) | Monoclonal antibodies to progastrin | |
| JP5730200B2 (en) | Anti-hepcidin-25 selective antibody and use thereof | |
| WO2013132347A2 (en) | Improved elisa immunoassay for calprotectin | |
| CN107383192A (en) | Galectin-3 detection kit | |
| US11009506B2 (en) | Kit for rapid diagnosis of asthma or allergy disease | |
| CN101566633A (en) | Method for diagnosing, evaluating or testing cancer and foreseeing cancer severity | |
| CN110361547A (en) | The reagent and its detection method of a kind of chemiluminescence quantitative detection fecal occult blood and its detection lower digestive tract health purposes | |
| CN106164672A (en) | Diagnostic cell-surface prostate cancer antigen | |
| CN103713139A (en) | Test paper for human heat shock protein (Hsp 90alpha) and preparation method thereof | |
| CN113109563B (en) | Marker for screening early esophageal squamous carcinoma of high risk group and application thereof | |
| KR20120078192A (en) | Serum amyloid a specific monoclonal antibody and hybridoma cell producing the same | |
| US20160245804A1 (en) | Methods, Systems and Kits of Fecal NGal Rapid Immunochromatographic Test | |
| CN108663522A (en) | Carcinoma of urinary bladder detection kit | |
| JP2020515876A (en) | Compositions and methods for detecting lung cancer | |
| CN101539574B (en) | Application of Survivin antibody and esophageal cancer immunochromatography detecting test strip prepared therewith | |
| JP6900515B2 (en) | Target marker GP73 and detection method used for detection of steatohepatitis | |
| JP2009085685A (en) | MEASURING REAGENT OF INSULIN RECEPTOR alpha-SUBUNIT | |
| CN106814192A (en) | For the mark combination of liver cancer detection and detection kit | |
| CN116284382A (en) | Procalcitonin-resistant antibodies and uses thereof | |
| CN116023489A (en) | Antibodies that specifically bind to NT-proBNP and uses thereof | |
| CN109085355A (en) | Serum protein markers combine the application in screening lung cancer and diagnosis and treatment | |
| CN110275014B (en) | Method for rapidly identifying metastasis of papillary thyroid carcinoma cervical lymph nodes in operation | |
| CN105842461A (en) | Rapid diagnostic kit for uterine sarcoma in early and middle stages and preparation method of kit | |
| EP3779438A1 (en) | Heart failure detection method, instrument for heart failure detection, sandwich immunoassay method, and antibody combination | |
| CN112334487A (en) | Compositions and methods for diagnosing and treating cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP02 | Change in the address of a patent holder | ||
| CP02 | Change in the address of a patent holder |
Address after: No. 369 Lijiang Road, High tech Industrial Development Zone, Shijiazhuang City, Hebei Province, 050000 Patentee after: HANLIN BIOTECHNOLOGY Co.,Ltd. Address before: 050035 No. 288 Pearl River Avenue, Shijiazhuang Hi-tech Industrial Development Zone, Hebei Province Patentee before: HANLIN BIOTECHNOLOGY Co.,Ltd. |