CN108660218A - Molecular labeling for being identified between Mans needleless, tiger spot and quasi- mesh cuttlefish and application - Google Patents
Molecular labeling for being identified between Mans needleless, tiger spot and quasi- mesh cuttlefish and application Download PDFInfo
- Publication number
- CN108660218A CN108660218A CN201810271398.0A CN201810271398A CN108660218A CN 108660218 A CN108660218 A CN 108660218A CN 201810271398 A CN201810271398 A CN 201810271398A CN 108660218 A CN108660218 A CN 108660218A
- Authority
- CN
- China
- Prior art keywords
- cuttlefish
- quasi
- mesh
- tiger
- sepiella maindroni
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of molecular labeling for being identified between Mans needleless, tiger spot and quasi- mesh cuttlefish and application, belong to sibling species identification technology, the method for the nearly edge species identification of specifically a kind of cuttlefish.Specially using Sepiella maindroni, tiger spot cuttlefish and quasi- mesh cuttlefish genomic DNA as template, PCR amplification, and then differentiation cuttlefish species different using Tm value difference of the amplified production in high-resolution melting curve (HRM) are carried out according to the sequence label design primer of Sepiella maindroni, tiger spot cuttlefish and quasi- mesh cuttlefish species gene group；It is capable of the identification of quick, economy, simplicity carried out between species using the present invention, accuracy rate is 100% compared with sequence label sequencing result.
Description
Technical field
The invention belongs to cuttlefish species identification technical fields more particularly to one kind can be used for Sepiella maindroni, tiger spot crow
The molecular labeling of crafty and quasi- mesh cuttlefish species identification and application.
Background technology
Sepiella maindroni (Sepiella maindroni) belongs to Cephalopoda, Sepiida, Sepiidae, sepiella maindroni de Rochebrune category,
It is distributed widely in Russian Far East sea, Japanese Seto Island Sea, Korea's southwest seashore and China's Adjacent Sea Area, cephalopodium is blazoned for wide temperature
Veriety has certain distribution in the four big marine sites in China；Tiger spot cuttlefish (Sepia pharaonis) is subordinate to Mollusca
(Mollusca), Sepiida (Sepioidea), Sepiidae (Sepiidae), Sepia (Sepia).It is distributed in the India Pacific Ocean
Tropical Ocean Area, from offshore to being found in the waters of depth of water 100m.Quasi- mesh cuttlefish (Sepia lycidas) is subordinate to Cephalopoda
(Cephalopoda), Sepiida (Sepioidea), Sepiidae (Sepiidae), Sepia (Sepia) are shallow sea water warms compared with
Strong bottom is dwelt kind, is inhabited in the offshore waters of continental shelf area 15~100m depth of waters, is distributed in the Indian Ocean-Western Pacific.Always
For body, three kinds of cuttlefishes morphologically to have in growth traits it is many similar, and since the plasticity of cuttlefish phenotype is strong, kind water
Flat typoiogical classification identification difficulty is larger, and is also easy to produce many disagreements, depends merely on morphology and is difficult to differentiate between, and between squid larva
Difference is more small, is unfavorable for the enhancement releasing of the specific bodies of water.Therefore, effective method is selected to distinguish tiger spot cuttlefish and quasi- mesh
Cuttlefish is then of great significance；In recent years, with the development of molecular biology, identify species using molecular biology method
Receive through being increasingly becoming a kind of trend, and by most of biologist.From American scholar Lander in 1996 propose after
The third generation New molecular marker technology of RFLP, SSR --- since SNP, the detection of SNP and parting have become genetics research
Key technology, SNP refer to the polymorphism that single nucleotide acid point mutation generates in certain biological Different Individual DNA sequence dna, including
Polymorphism caused by displacement, transversion, insertion or missing.High-resolution melting curve method is based on different nucleic acid physical properties
Difference, by fluorescent dye be added PCR reaction systems, when containing fluorescent dye DNA solve supination, can collect fluorescence information formed it is molten
Solution curve.When some base changes in DNA sequence dna, melting curve will occur to change accordingly, can pass through software pair
Hereditary information is analyzed, and has many advantages, such as efficient, accurate, high-throughput, low cost.Currently, HRM technologies have been applied to
The identification of major gene type, Mutation Screening, DNA methylation analysis, the fields such as microbial molecular parting and identification and rna editing,
It is the hot technology in molecule diagnosis.
Invention content
A technical problem to be solved by this invention be for the prior art present situation provide one kind can be used for Mans without
The molecular labeling of Sepia andreana, tiger spot cuttlefish and quasi- mesh cuttlefish species identification.
Another technical problem to be solved by this invention is a kind of above-mentioned point of utilization of present situation offer for the prior art
Son marks to distinguish the application of Sepiella maindroni, tiger spot cuttlefish and quasi- mesh cuttlefish species identification.
Another technical problem to be solved by this invention is a kind of above-mentioned point of utilization of present situation offer for the prior art
The method that son marks to distinguish Sepiella maindroni, tiger spot cuttlefish and quasi- mesh cuttlefish species identification.
Technical solution is used by the present invention solves above-mentioned technical problem：This can be used for Sepiella maindroni, tiger spot crow
The SNP marker of crafty and quasi- mesh cuttlefish species identification, it is characterised in that：The forward primer F1 of the SNP marker is 5'
CTGTTATCCCTATGGTAACTTTATT 3'；Reverse primer F2 is 5'TTAATTGGGGTGATTAAGGAATA 3'.
The present invention provides a kind of above-mentioned SNP marker of utilization molten based on high resolution to solve second technical problem
Solution curve identifies the application in Sepiella maindroni, tiger spot cuttlefish and quasi- mesh cuttlefish.
Further, the SNP in the Sepiella maindroni target amplification segment is：
TTAATTGGGGTGATTAAGGAATAATATTAAGATAAATAACTTCCTTATATAATAATAAATTGTTGAATTAAGTAACC
AATATTATTGCTTTTAATAAAGTTACCATAGGGATAACAG。
Further, the SNP in the tiger spot cuttlefish target amplified fragments is：
TTAATTGGGGTGATTAAGGAATAAAAATACATTAAATAGTAACTTCCTTAACTCGTATAATACTGTTAGGTTAAGTA
ACCAATAATATTGCTTATAATAAAGTTACCATAGGGATAACAG。
Further, the SNP in the quasi- mesh cuttlefish target amplified fragments is：
TTAATTGGGGTGATTAAGGAATAAAAATATTATATAGTAACTTCCTTAATAGTTAATACTGTTGGGTTAATTAACCA
ATAATATTGCTTATAATAAAGTTACCATAGGGATAACAG。
The present invention provides one kind based on high-resolution solubility curve identification Mans needleless crow to solve third technical problem
Crafty, tiger spot cuttlefish and quasi- mesh cuttlefish method, it is characterised in that：With Sepiella maindroni, tiger spot cuttlefish and quasi- mesh cuttlefish gene
Group DNA is template, is carried out according to Sepiella maindroni, tiger spot cuttlefish and the sequence label design primer of the genome of quasi- mesh cuttlefish
PCR amplification, and then differentiation different using Tm value difference of the amplified production in high-resolution melting curve；With cuttlefish genome to be identified
DNA is template, and PCR amplification is carried out according to the gene order design primer of cuttlefish, melts song in high-resolution using amplified production
Tm value differences in line are different and then distinguish the close species of cuttlefish.
Further, the PCR product obtained by above-mentioned amplification is added denaturation treatment after nucleic acid saturable dye, is cooled to
Room temperature carries out HRM measurement.
Compared with prior art, the invention has the advantages that：
1, method is simple and practicable；It need not be sequenced, directly by the Tm values of amplified fragments come the difference in reaction dna level
And distinguish different plant species；
2, result is clearly intuitive；Without progress sequence alignment, the difference of DNA level is with intuitive between different plant species
Peak figure form show, easily distinguish distinguish；
3, accurate and effective；Identification method of the present invention is had using high-resolution melting curve (HRM) differentiates single nucleotide acid
The ability of difference can accurately reflect the difference on DNA level so that qualification result is accurate and reliable, compared with sequencing result
Accuracy rate is 100%；
4, application is extensive；It is different from sequencing, it need not be by all individual sequencing analysis one by one to be identified, in of the invention
One group of primer can carry out species identification without redesigning primer on infinitely how similar individual；The present invention passes through offer
Differentiate Sepiella maindroni, tiger spot cuttlefish and quasi- mesh cuttlefish SNP primers, successfully three kinds of cuttlefishes are carried out by HRM technologies
Genotyping, from molecular level explore Sepiella maindroni, tiger spot cuttlefish and quasi- mesh cuttlefish gene fragment order difference, build
Stood Sepiella maindroni, tiger spot cuttlefish and quasi- mesh cuttlefish molecular identification method, secondly, the present invention be an open system,
It has wide range of applications；The identification of the nearly edge species of specific several cuttlefishes is cannot be only used for, as long as based on the difference energy on DNA level
The cuttlefish species enough distinguished can be identified using this method.
Description of the drawings
Fig. 1 be the nearly edge species identification high-resolution melting curve figure of Sepia cuttlefish provided in an embodiment of the present invention (wherein
Abscissa is temperature DEG C), ordinate is the logarithm of fluorescence intensity；Abscissa corresponding to the peak of every curve is should
The Tm values of the corresponding PCR product of curve)；
Fig. 2 is that the standardization that the nearly edge species identification high-resolution of Sepia cuttlefish provided in an embodiment of the present invention melts is bent
Line；
Fig. 3 is the nearly edge species of Sepia cuttlefish provided in an embodiment of the present invention in the molten of standardization and different temperatures
Solution curve peak.
Specific implementation mode
Below by way of accompanying drawings and embodiments are combined, the invention will be further described.
The present invention introduces high-resolution melting curve side during being distinguished by nucleic acid sequence and carry out species identification
Difference of the different plant species on DNA level is only converted to more intuitive melting curve by method with one couple of PCR primers.
Its step is：
A, DNA is extracted
Genomic DNA is extracted using traditional phenol chloroform-isoamyl alcohol method, agarose gel electrophoresis detects DNA sample
Quality, NANODROP 2000 (Thermo Scientific, USA) measures DNA stock solution qualities and concentration, and is diluted to 50ng/
The concentration of ul is for use.
B, acquisition and sequence alignment analysis of the species identification according to sequence
It is soft using AlignX by obtaining the mtDNA sequence overall length of tiger spot cuttlefish and quasi- mesh cuttlefish from ncbi database
Part carries out sequence alignment, finds base difference present in two kinds of cuttlefishes；From containing SNP site sequence, selection meets primer
The sequence of design carries out SNP primer design using Premier5.0；
C, design of primers and screening
Design of primers should meet the following conditions：Target amplification sequence is between 50bp-150bp, to keep melting temperature different,
There are the differences of GC base contents between sequence；Annealing temperature (Tm) should be between 50 DEG C -60 DEG C；It should be as possible between positive anti-primer
Avoid mispairing, hairpin structure and primer dimer；Primer is synthesized by Shanghai Sheng Gong engineering finites responsible company.Random selection 5
Corresponding cuttlefish DNA sample is template, using using agarose gel electrophoresis technology to carry out preliminary screening to primer, selects energy
Amplify bright, the primer progress HRM analyses of single band.
D, PCR amplification and high-resolution melting curve (HRM) analysis
Using the genomic DNA of target cuttlefishes to be identified as template, PCR amplification is carried out using above-mentioned primer；PCR system is
Using cuttlefish genomic DNA as template, DNA concentration is adjusted to 50ng/ μ l, the primer after screening is used for HRM points of target fragment
Analysis.In LightThe molten of PCR amplification and product is carried out on 480 real-time quantitative analysis instrument (Roche Diagnostics)
Solution curve is analyzed.Reaction uses Light480 HRM kits,
PCR system：20μL 1×Light480HRM Master Mix with Resodye
(Roche Diagnostics), positive each 1 μ L of anti-primer, the DNA profiling of 1 μ L 100ng/ μ L, 2.8 μ L MgCl2, moisturizing to 20 μ
L。
PCR amplification program is：95 DEG C (pre-degeneration 10min), 95 DEG C (denaturation 30sec), Tm (renaturation 30sec), 72 DEG C (are prolonged
Stretch 30sec) denaturation, renaturation, extend after three steps recycle 45 times altogether, solubility curve fluorescent collecting：95 DEG C denaturation 30seconds, 65
DEG C annealing 30seconds, 95 DEG C heating 30seconds.
After PCR amplification, product directly exists480 real-time quantitative analysis instrument (Roche
Diagnostics the operation of HRM is carried out on) automatically, 1 DEG C is often increased and acquires fluorescence 25 times.It usesOn 480 certainly
1.5 softwares of Tm Calling and Gene Scanning Software of band carry out the analysis of Tm values and Genotyping.In addition, with
It can be directed to the optimal canonical sequence of different plant species by unrestricted choice as needed in the foundation sequence of species identification, can be COI
Gene order or other meet the sequence of biomarker feature.
Embodiment 1
The identification of Sepiella maindroni, tiger spot cuttlefish and quasi- mesh cuttlefish in Sepiidae：
A, acquisition of the species identification according to sequence：It is complete by obtaining above-mentioned cuttlefish mtDNA sequence from ncbi database
It is long, carry out sequence alignment using AlignX softwares, find base difference segment present in three kinds of cuttlefishes, as species identification according to
According to sequence；
B, design of primers：Selection can obviously distinguish the sequence of target species in above-mentioned Sepia mitochondria full length sequence
PCR amplification primer is designed in region in the area using Primer Premier5 softwares, and primer extension product is in different plant species
Between should have apparent Tm value differences different, be mainly reflected in that C, T content is different.
Forward primer F1 is：5'CTGTTATCCCTATGGTAACTTTATT 3'；
Reverse primer F2 is：5'TTAATTGGGGTGATTAAGGAATA 3'.
C, PCR amplification：Using the genomic DNA of cuttlefish sample to be identified as template, PCR amplification is carried out using above-mentioned primer.
PCR amplification program according to：94 DEG C (pre-degeneration 10min), 94 DEG C (denaturation 30sec), 53 DEG C of Tm (renaturation 30sec), 72 DEG C (extend
Extend 5min after 72 DEG C after 30sec) denaturation, renaturation, three steps of extension recycle 45 times altogether, 4 DEG C (cooling) terminates.
D, high-resolution melting curve (HRM) is analyzed：Above-mentioned product directly existsIt is run on 480 platforms
HRM collects the fluorescent signal data between 55 DEG C -95 DEG C.After using the analysis software carried on platform by fluorescence signal
It is converted to melting curve peak figure；The nearly edge object of different Sepias is distinguished according to the difference of the corresponding Tm values of the peak value of different curves
Kind (referring to Fig. 1).
Experimental result is as follows：
As seen from Figure 1：Melting curve is polymerized to 3 beams respectively, and 3 kinds of different Tm values are presented respectively, wild in counter sample
Graceful formula sepiella maindroni de Rochebrune, tiger spot cuttlefish and quasi- mesh cuttlefish；Type A is Sepiella maindroni, and Tm values are 72.37 DEG C, and type B is quasi-
Mesh cuttlefish, Tm values are 73.72 DEG C, and Type C is tiger spot cuttlefish, and Tm values are 74.51 DEG C, between different types of melting curve
Clear, apparent, the clear Tm value fine differences shown between tiger spot cuttlefish and quasi- mesh cuttlefish are distinguished, with Sepiella maindroni
Relatively far apart, this with Wang Wanchao in the development of cuttlefish phyletic evolution about the research in the correlative study of three kinds of cuttlefish affiliations
As a result consistent, also embody the sensitivity and accuracy of HRM analyses.
Fig. 2 is through LightGene Scanning resume modules are analyzed on 480, obtain standardization melting curve
View can preferably reflect Sepiella maindroni, tiger spot cuttlefish and the different caused peak figure variation of quasi- mesh cuttlefish Tm value differences；
Fig. 3 is that both melting curve peak figures with quasi- mesh cuttlefish is with reference to baseline, Mans in the case of standardization and different temperatures
Sepiella maindroni de Rochebrune and tiger spot cuttlefish are distributed in quasi- mesh cuttlefish both sides, Fig. 2 Fig. 3 be for preferably reflecting Sepiella maindroni,
Peak figure variation caused by tiger spot cuttlefish and quasi- mesh cuttlefish Tm value differences are different.
E, sequence verification
For the SNP site of the apparent parting of energy, randomly chooses each corresponding PCR product of genotype curve and is sequenced,
The sequencing result of various genotype is compared, the base composition difference between observing, such as the following table 1.
1 sequence of table and comparison result：Show be present in Sepiella maindroni in three kinds of Sepias, tiger spot cuttlefish with
SNPs in quasi- mesh cuttlefish target amplified fragments, respectively SEQ1, SEQ2 and SEQ3, such as following table.
Table 1
Meanwhile the base composition difference between observing, such as the following table 2, it shows and is present in tiger spot cuttlefish and quasi- mesh crow
SNPs in crafty target amplification segment intends mesh cuttlefish compared with tiger spot cuttlefish, wherein there is 3 in the differential fragment of this 120bp
Transversion site, 1 conversion site, 4 base deletion sites.
Table 2：
Meanwhile the base composition difference between observing, such as the following table 3, Sepiella maindroni have compared with tiger spot cuttlefish
8 conversion sites, 10 transversion sites, 3 base deletion sites.
Table 3：
Sequence table
<110>University Of Ningbo
<120>Molecular labeling for being identified between Mans needleless, tiger spot and quasi- mesh cuttlefish and application
<130> Not published yet
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 117
<212> DNA
<213> Sepiella maindroni
<400> 1
ttaattgggg tgattaagga ataatattaa gataaataac ttccttatat aataataaat 60
tgttgaatta agtaaccaat attattgctt ttaataaagt taccataggg ataacag 117
<210> 2
<211> 120
<212> DNA
<213> Sepia pharaonis
<400> 2
ttaattgggg tgattaagga ataaaaatac attaaatagt aacttcctta actcgtataa 60
tactgttagg ttaagtaacc aataatattg cttataataa agttaccata gggataacag 120
<210> 3
<211> 116
<212> DNA
<213> Sepia lycidas
<400> 3
ttaattgggg tgattaagga ataaaaatat tatatagtaa cttccttaat agttaatact 60
gttgggttaa ttaaccaata atattgctta taataaagtt accataggga taacag 118
Claims (6)
1. a kind of SNP marker for being identified between Mans needleless, tiger spot and quasi- mesh cuttlefish, it is characterised in that：The SNP points
The forward primer F1 of son label is 5'CTGTTATCCCTATGGTAACTTTATT 3'；Reverse primer F2 is 5'
TTAATTGGGGTGATTAAGGAATA 3'。
2. a kind of SNP marker according to claim 1 is based on high resolution solubility curve identification Mans needleless crow
Application in thief, tiger spot cuttlefish and quasi- mesh cuttlefish.
3. SNP marker according to claim 2 is based on high resolution solubility curve identification Sepiella maindroni, tiger
Application in spot cuttlefish and quasi- mesh cuttlefish, it is characterised in that：SNP in the Sepiella maindroni target amplification segment is：
TTAATTGGGGTGATTAAGGAATAATATTAAGATAAATAACTTCCTTATATAATAATAAATTGTTGAATTAAGT
AACCAATATTATTGCTTTTAATAAAGTTACCATAGGGATAACAG。
4. SNP marker according to claim 2 is based on high resolution solubility curve identification Sepiella maindroni, tiger
Application in spot cuttlefish and quasi- mesh cuttlefish, it is characterised in that：SNP in the tiger spot cuttlefish target amplified fragments is：
TTAATTGGGGTGATTAAGGAATAAAAATACATTAAATAGTAACTTCCTTAACTCGTATAATACTGTTAGGTTAAGTA
ACCAATAATATTGCTTATAATAAAGTTACCATAGGGATAACAG。
5. SNP marker according to claim 2 is based on high resolution solubility curve identification Sepiella maindroni, tiger
Application in spot cuttlefish and quasi- mesh cuttlefish, it is characterised in that：SNP in the quasi- mesh cuttlefish target amplified fragments is：
TTAATTGGGGTGATTAAGGAATAAAAATATTATATAGTAACTTCCTTAATAGTTAATACTGTTGGGTTAATTA
ACCAATAATATTGCTTATAATAAAGTTACCATAGGGATAACAG。
6. a kind of method based on high-resolution solubility curve identification Sepiella maindroni, tiger spot cuttlefish and quasi- mesh cuttlefish, special
Sign is：Using Sepiella maindroni, tiger spot cuttlefish and quasi- mesh cuttlefish genomic DNA as template, according to Sepiella maindroni, tiger spot
Cuttlefish and the sequence label design primer of the genome of quasi- mesh cuttlefish carry out PCR amplification, molten in high-resolution using amplified production
Tm value differences in solution curve are different and then distinguish；Using cuttlefish genomic DNA to be identified as template, designed according to the gene order of cuttlefish
Primer carries out PCR amplification, and then differentiation cuttlefish close object different using Tm value difference of the amplified production in high-resolution melting curve
Kind.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810271398.0A CN108660218A (en) | 2018-03-29 | 2018-03-29 | Molecular labeling for being identified between Mans needleless, tiger spot and quasi- mesh cuttlefish and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810271398.0A CN108660218A (en) | 2018-03-29 | 2018-03-29 | Molecular labeling for being identified between Mans needleless, tiger spot and quasi- mesh cuttlefish and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108660218A true CN108660218A (en) | 2018-10-16 |
Family
ID=63782809
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810271398.0A Pending CN108660218A (en) | 2018-03-29 | 2018-03-29 | Molecular labeling for being identified between Mans needleless, tiger spot and quasi- mesh cuttlefish and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108660218A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102758009A (en) * | 2012-06-08 | 2012-10-31 | 中国科学院海洋研究所 | Method for identifying related species of oyster |
| CN104046683B (en) * | 2013-03-13 | 2015-06-10 | 中国科学院海洋研究所 | Method for discriminating two closely-related species of shellfish or identifying their hybrid generation |
-
2018
- 2018-03-29 CN CN201810271398.0A patent/CN108660218A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102758009A (en) * | 2012-06-08 | 2012-10-31 | 中国科学院海洋研究所 | Method for identifying related species of oyster |
| CN104046683B (en) * | 2013-03-13 | 2015-06-10 | 中国科学院海洋研究所 | Method for discriminating two closely-related species of shellfish or identifying their hybrid generation |
Non-Patent Citations (2)
| Title |
|---|
| 代丽娜: ""中国沿海头足类 DNA 条形码与分子系统发育研究"", 《中国优秀硕士学位论文数据库》 * |
| 温旺荣: "《临床分子诊断学》", 31 May 2015 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11352659B2 (en) | Methods of detecting analytes | |
| EP3511423B2 (en) | Methods and product for optimising localised or spatial detection of gene expression in a tissue sample | |
| US6238866B1 (en) | Detector for nucleic acid typing and methods of using the same | |
| Edel | Polymerase chain reaction in mycology: an overview | |
| US20100113296A1 (en) | Methods And Kits For Nucleic Acid Analysis | |
| WO2005111237A1 (en) | Detection of chromosomal disorders | |
| JP2001521754A (en) | Probe array for DNA identification and method of using probe array | |
| Calo-Mata et al. | Identification of gadoid fish species using DNA-based techniques | |
| Snijders et al. | Current status and future prospects of array-based comparative genomic hybridisation | |
| CN108660218A (en) | Molecular labeling for being identified between Mans needleless, tiger spot and quasi- mesh cuttlefish and application | |
| WO2004001016A2 (en) | Methods for detection of genetic alterations associated with cancer | |
| CN108642185A (en) | A kind of molecular labeling and application for tiger spot cuttlefish with quasi- mesh cuttlefish species identification | |
| CA2518904A1 (en) | Molecular haplotyping of genomic dna | |
| CN108642186A (en) | Molecular labeling for being identified between Mans needleless, tiger spot and swordtip squid and application | |
| CN108384862A (en) | Molecular labeling and application for Mans needleless and swordtip squid species identification | |
| CN107988380B (en) | Method for inter-species molecular identification of Mytilus edulis, Mytilus coruscus and perna viridis | |
| CN108611422A (en) | The molecular labeling with swordtip squid species identification and application for tiger spot, quasi- mesh | |
| Zhussupova | PCR–diagnostics | |
| CN115896329A (en) | SSR molecular marker primer group developed based on whole genome of osmanthus fragrans and application thereof | |
| WO2018085584A1 (en) | A method of detecting nucleotide polymorphism associated with risk of developing psychosis and determining individual genotype | |
| CN107904314A (en) | A kind of molecular labeling and application available for Sepiella maindroni and golden cuttlefish species identification | |
| Blumberg | Identification of Nuclear Hormone Receptor Homologs by Screening Libraries with Highly Degenerate Oligonucleotide Probes | |
| Amplification et al. | 46 SECTION II TECHNIQUES AND INSTRUMENTATION |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181016 |