CN108624617A - A method of improving eggplant Gene Silencing efficiency - Google Patents
A method of improving eggplant Gene Silencing efficiency Download PDFInfo
- Publication number
- CN108624617A CN108624617A CN201810271753.4A CN201810271753A CN108624617A CN 108624617 A CN108624617 A CN 108624617A CN 201810271753 A CN201810271753 A CN 201810271753A CN 108624617 A CN108624617 A CN 108624617A
- Authority
- CN
- China
- Prior art keywords
- eggplant
- gene
- smpds
- trv2
- gene silencing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of methods improving eggplant Gene Silencing efficiency, belong to field of plant genetic.The present invention has considered many factors for influencing eggplant VIGS silence efficiencies, by building the TRV2 virus silence recombinant vectors containing target gene fragment, infects budding period seed using the method for vacuum infiltration, induces endogenous target gene that silence occurs.The silence plant phenotype of this method processing occurs that speed is fast, efficient, and the character mutation duration is long, and overcomes the problems such as injection inoculation is to plant injury and the difficult smaller injection inoculation of eggplant cotyledon, and effective method is provided for fast verification gene function.
Description
Technical field
The invention belongs to gene engineering technology fields, and in particular to a kind of to improve eggplant Gene Silencing efficiency
Method.
Background technology
Virus induced gene silencing (Virus-induced Gene Silencing, VIGS) is using plant to RNA
The technology of virus defense mechanism development is to infect plant initiation host by carrying the viral vectors of one section of target gene fragment
The silence of middle sequence homology gene, to realize the identification (Senthil-Kumar＆Mysore, 2011) to gene function.
VIGS technologies do not need plant compared with the gene functional research method such as traditionally transgenosis, gene knockout, Antisense Suppression
Genetic transformation obtains mutant, can it is simple, quickly, it is instantaneous, efficiently, specifically identify gene function, it has also become plant gene
Effective technology method in functional study.It is continued to develop with VIGS technical research, which has been widely applied to not
The research of the correlation functions gene such as same plant resistance to environment stress, growth and development and metabolic regulation is identified, in plant trait improvement and plant
Protection etc. has good development and application prospect.
Eggplant full-length genome sketch is completed at present, generates a large amount of DNA sequence dna information, a large amount of unknown genes need to be excavated with
Identification.Traditional gene functional research means need ripe genetic conversion system, but the transformation efficiency of eggplant is relatively low, and
It is stronger to the dependence of recipient genotypes, the serious development for limiting eggplant functional genome research.As VIGS is technically sent out
Exhibition, has successfully been used in the gene functional research such as the disease-resistant, fruit development of eggplant at present.Although VIGS technologies have more
Superiority, but there is also certain limitations, it is different if the technology is less able to complete silence or inhibits the expression of target gene
Insert Fragment size, inoculation method, culture environment etc. are all affected to gene silencing efficiency.Especially current eggplant VIGS
The mode of technology virus inoculation is mostly injection presses infiltration blade inoculation, and larger to the damage of eggplant seedling, silence efficiency is relatively low, inoculation
It is big to infect liquid preparation amount for required Agrobacterium when viral, seeded process the shortcomings of time-consuming, and is unfavorable for studying mesoderm growing early stage
Gene function.Therefore it is improved for the shortcoming in eggplant VIGS technologies, and different disposal silence efficiency is commented
Valence, provide it is a kind of efficiently, efficiently eggplant, promote the technology to play a greater role in eggplant gene functional research.
Invention content
Technical problem
The shortcoming that the present invention is directed in eggplant VIGS technologies improves, and provides efficient, quick, convenient eggplant virus
The method of induced gene silence.The best silence body of virus induction eggplant endogenous gene is can get using method of the present invention
System.
Technical solution
Specifically comprise the following steps：
A method of improving eggplant Gene Silencing efficiency, which is characterized in that include the following steps：
(1) structure of eggplant viral gene recombinant expression carrier；
(2) it is prepared suitable for infecting budding period seed：After 1 ‰ gibberellin seed soaking 12h, 28 DEG C of vernalization show money or valuables one carries unintentionally until seed
2~3d afterwards, bud are grown spare when 0.5~1cm；
(3) preparation of liquid is infected
(4) liquid inoculation is infected：Inoculation budding period seed is infected using vacuum infiltration methods：Vacuum infestation system is done by vacuum
Dry device and portable vacuum pump composition, it is -25kpa, pumpdown time 2min to vacuumize osmotic pressure；
(5) it is cultivated after being inoculated with：It is first put into light culture in 20 DEG C of growth cabinets after inoculation and is transferred to normal training again to after breaking ground
It supports, illumination 16h under the conditions of culture environment is 25 DEG C, dark 8h under the conditions of 20 DEG C, relative humidity is 50%~60%；
(6) Phenotypic Observation of inducing eggplant viral gene silence and detection.
Step (1) the eggplant viral gene recombinant expression carrier is configured to, and is set according to eggplant PDS gene sequence characteristics
Count primer SmPDS-XbaI-F:SEQ ID NO.1 and SmPDS-BamHI-R:SEQ ID NO.2, using the cDNA of eggplant as template
Pcr amplification reaction is carried out, the silence segment of eggplant PDS genes is obtained, nucleotide sequence will obtain eggplant as shown in SEQIDNO.3
Sub- viral gene PDS genetic fragments are connect with TRV2 plasmids by XbaI and BamHI restriction enzyme sites, and TRV2-SmPDS weights are obtained
Group plasmid.
It is described to infect being prepared as liquid, from be added to 50mg/L gentamicins, 50mg/L cards receive mycin and 25mg/L profit good fortune
On flat YEB tablets picking contain expression vector TRV2-SmPDS, TRV2 control vector, TRV1 carriers positive Agrobacterium
GV3101 monoclonals respectively be added to 50mg/L gentamicins, 50mg/L cards receive the YEB liquid of mycin and 25mg/L rifampins
It is cultivated in culture medium, then respectively by bacterium solution according to 1:50 ratios are added to containing 10mmol/LMES, 20 μm of ol/L acetyl
Syringone, 50mg/L gentamicins, 50mg/L cards receive mycin and 25mg/L rifampins YEB fluid nutrient mediums in shake bacterium and arrive
OD600 values are then centrifuged for supernatant and collect each thalline, addition is added to 10mmol/LMgCl2,200 mmol/L in 1.0-2.0
The MMA buffer solution suspension thallines of acetosyringone, 10mmol/LMES, adjust suspension OD600 values 1.0, by TRV1 with
TRV2-SmPDS, TRV2 bacterium solution mix in equal volume, and 3 hours preparation inoculations are placed in room temperature dark place.
Gene silencing phenomenon starts to occur after step (4) Fiber differentiation 10d.Gene PDS silences show as inoculation plant and go out
Existing albinism.
In a kind of method of raising eggplant Gene Silencing efficiency, it to be used for the SmPDS genes of RT-PCR
Primer includes sense primer PDS-RT-F:SEQ ID NO.4, downstream primer PDS-RT-R:SEQ ID NO.5, reference gene
Actin primers include sense primer SmAct-F：SEQ ID NO.6 and downstream primer SmAct-R:SEQ ID NO.7 detections lure
Lead the expression of eggplant viral gene silence.
Advantageous effect：
Consider invade dye liquor concentration, time of infection, culture environment etc. influence eggplant VIGS silence efficiencies it is many-sided because
Element, the present invention utilize the method inoculation TRV viruses of vacuum infiltration, induced gene for the first time using eggplant budding period seed as receptor
Silence；Compared with prior art, this method does not carry out destructive processing to plant, does not generate any damage, overcomes inoculation disease
The shortcomings that mechanical damage is caused to eggplant seedling when malicious, and in rough leaf silence phenotype can occur for this method, be suitable for eggplant
The functional study of sub- mesoderm growing early stage gene.The silence plant that the method obtains through the invention, silence phenotype is notable, property
Shape performance is lasting, can get best silencing system, effective method is provided for the gene functional research of eggplant.
Extremely notable drop is presented relative to control in the test result endogenous target gene SmPDS gene expression doses of the display present invention
Low (after being silenced), SmPDS transcriptional expression levels only have 16.7% (even lower) of adjoining tree, and this system can be effective
In the gene function of identification eggplant.
Vacuum infiltration germinating seed gene expression reduced rate 83.30% of the present invention, syringe permeate cotyledon method gene expression
Reduced rate 73.80%.
Description of the drawings
Fig. 1：Recombinant vector TRV2-SmPDS bacterium solution PCR amplifications detect electrophoresis
M:2000bp Marker；1:TRV1；2：TRV2 is unloaded；3：TRV2-SmPDS
Fig. 2：It is suitble to the budding period seed size of vacuum infiltration inoculation
1：It shows money or valuables one carries unintentionally the phase；2,3：Show money or valuables one carries unintentionally 2~3d (best) after the phase；4,5:Show money or valuables one carries unintentionally 4~5d after the phase
Fig. 3：10d albefaction phenotypes after recombinant vector TRV2-SmPDS conversion budding period seeds
Fig. 4：Albefaction phenotype photo when being the eggplant growth 50d after infecting；
Fig. 5：RT-PCR detects the expression quantity of SmPDS genes in TRV2-SmPDS transformants
Specific implementation mode
The specific embodiment of invention is described in detail below：The present embodiment is based on the technical solution of the present invention
Under implemented, give detailed embodiment and specific operating process, in the examples below, unless specifically indicated,
Involved carrier and experiment material is known in those skilled in the art.
Embodiment
1, the clone of SmPDS genetic fragments
Cultivation eggplant Suzhou ox horn (public, market purchase) blade is taken, with reference to plant total RNA extraction reagent box
(TIANGEN) total serum IgE of the operating method extraction blade of specification, according to cDNA reverse transcription reagent box (Beijing full formula gold) into
Row reverse transcription obtains cDNA, special with 5 Software for Design of primer according to the sequence information of SmPDS genes in eggplant library
Primer amplification SmPDS；Sense primer SmPDS-XbaI-F：5’-cggtctagaggcactcaactttataaacc-3’(SEQ
ID NO.1), downstream primer SmPDS-BamHI-R：5’-cggggatcccttcagttttctgtcaaacc-3’(SEQ ID
NO.2)；
Using leaf cDNA as template, PCR reactions, 50 μ L reaction systems are carried out：2 × PCR SuperMix, 25 μ L, up and down
Swim each 1 μ L of primer (20 μm of ol/L), 2 21 μ L of μ L, ddH2O of cDNA templates；Response procedures：95 DEG C of pre-degeneration 5min, then 94
DEG C unwinding 30s, 55 DEG C of annealing 45s, 72 DEG C of extension 1min react 35 cycles, 72 DEG C of extension 7min.
2, the structure of expression vector TRV2-SmPDS
PCR product uses XbaI, BamHI to carry out double enzymes after purification by PCR purification kits (TIANGEN) after amplification
It cuts, digestion products are recycled with gel reclaims kit (AXYGEN, USA), are connected to equally with T4DNA ligases (TaKaRa)
By the TRV2 carriers of XbaI, BamHI double digestion, heat shock method converts DH5 α competent cells, the inspection of picking monoclonal PCR electrophoresis
It surveys and sequence verification (Fig. 1), sequencing is SEQ ID NO.3.
PCR is verified into the Agrobacterium with the correct recombinant vector TRV2-SmPDS plasmids electrotransformation competence of sequence verification,
Agrobacterium strains used are GV3101, picking monoclonal PCR electrophoresis detections, choose PCR verify correct positive colony shake bacterium and
It preserves, for infecting.Simultaneously using TRV2 (zero load) as the negative control of this example.
3, the acquisition of budding period seed
Take 50, Suzhou ox horn seed, first in 55 DEG C of hot water stirring seed soaking 15min after in 1 ‰ Gibberellins solution
Soak seed 12h, taking-up with clear water clean after be placed in the 9cm culture dishes for being covered with 2 layers of wet filter paper, 28 DEG C of vernalization to after showing money or valuables one carries unintentionally 2~
3d, it is spare (Fig. 2) that bud grows 0.5~1cm.
4, the preparation of liquid is infected
Contain correctly from YEB (receiving mycin, 25mg/L rifampins containing 50mg/L gentamicins, 50mg/L cards) tablet picking
Build plasmid TRV2-SmPDS, TRV2 carrier, the positive Agrobacterium monoclonal of TRV1 carriers is added to 50mg/L in 1mL respectively
Gentamicin, 50mg/L cards receive mycin and 25mg/L rifampins YEB fluid nutrient mediums in carry out, 28 DEG C, 200rpm oscillation trainings
16h is supported, then respectively by bacterium solution according to 1:50 ratios are added to containing 10mmol/LMES, 20 μm of ol/L acetosyringones, 50mg/
L gentamicins, 50mg/L cards receive mycin and 25mg/L rifampins YEB fluid nutrient mediums in 28 DEG C of shaken cultivations to OD600Value
In 1.0-2.0, then 4 DEG C, 5000rpm centrifugations abandon supernatant and collect each thalline, MMA buffer solutions (10 mmol/LMgCl are added2、
200mmol/L acetosyringones, 10mmol/LMES) thalline is resuspended, adjusting each suspension concentration using spectrophotometer is
OD600=1.0, TRV1 is mixed in equal volume with TRV2-SmPDS, TRV2 bacterium solution, 3 hours preparation inoculations are placed in room temperature dark place
5, liquid inoculation is infected
It is inoculated with using the method for vacuum infiltration budding period seed, the chitting piece obtained in step (3) is packed into
10mL centrifuge tubes, and 5mL is added into centrifuge tube and infects liquid by prepared by step (4), being put into vacuum after opening centrifuge tube lid invades
It is vacuumized after dye system, vacuum infiltration pressure is -25kpa, pumpdown time 2min.(laboratory is more normal for vacuum infestation system
The small-sized vacuum pumping pump seen).
6, the culture after being inoculated with
By treated, seed takes out from centrifuge tube, is sowed afterwards several times in 50 hole hole trays with clear water flushing, is put into 20
Light culture is transferred to normal culture to after breaking ground in DEG C growth cabinet, and culture environment is illumination 16h under the conditions of 25 DEG C, 20 DEG C of items
Dark 8h under part, relative humidity is 50%~60%.
7, the Phenotypic Observation of silence plant
The eggplant seedling infected by TRV2-SmPDS carriers, after inoculation after 10d, seedling apical point is occurred as soon as with true leaf
The typical repressed photobleaching phenomenon (Fig. 3) of PDS genes, seedling albefaction rate is 85% or more.After being inoculated with 30d, photobleaching phenomenon
It is more obvious, and sustainable 2~3 months of the phenotype, and the entire growth cycle of seed for infecting TRV2 carriers not it is observed that
This phenotype (Fig. 4).
8, qRT-PCR detects SmPDS expressions
It chooses TRV2-SmPDS and infects the 2nd~3 albefaction blade under plant strain growth point, extract blade total serum IgE, and reverse transcription
For cDNA, using empty carrier TRV2 blades as negative control, PDS gene primers (sense primer PDS- is designed using cDNA as template
RT-F:SEQ ID NO.4, downstream primer PDS-RT-R:SEQ ID NO.5), using Actin as reference gene, design primer
(sense primer SmAct-F：SEQ ID NO.6, downstream primer SmAct-R:SEQ ID NO.7), it is detected using RT-PCR technology
The expression quantity (Fig. 5) of SmPDS genes in blade.As a result show endogenous target gene SmPDS gene expression doses relative to control
Pole, which is presented, to be significantly reduced (after being silenced), and SmPDS transcriptional expression levels only have 16.7% (even lower) of adjoining tree, this
System can be effectively used for the gene function of identification eggplant.
SEQ ID NO.4 sense primers PDS-RT-F：
GGAGAATTCAGCCGCTTTGA
SEQ ID NO.5 downstream primers PDS-RT-R：
TCATCAGTCACCCTATCCGG
SEQ ID NO.6 sense primers SmAct-F：
GCAGCTCCTCCATCGAAAAG
SEQ ID NO.7 downstream primers SmAct-R：
CCGATCAGCAATACCAGGG
Syringe permeates the control of cotyledon method：
It selects completely open and flat cotyledon as object is infected, permeates cotyledon method using syringe, be inoculated with the viral-induced eggplants of TRV
Sub- PDS gene silencings.It infects the preparation of carrier and infects the preparation of liquid with embodiment 1.
50, Suzhou ox horn seed is selected, after 28 DEG C of seed soaking for 24 hours.Seed is seeded into 50 hole hole trays.28 DEG C, illumination/
The dark 16/8h periods cultivate 10~15 days.After cotyledon is completely open and flat, cotyledon back side epidermis is gently scratched with syringe needle point,
The Agrobacterium configured hydraulic pressure is infected using 1mL syringes to penetrate into cotyledon.Seedling after infecting is artificial with being placed on 25 DEG C
In climate box, light culture 1 day.Then, it is normally cultivated infecting plant, culture environment is illumination 16h under the conditions of 25 DEG C,
Dark 8h under the conditions of 20 DEG C, 50%~60%, observation plant phenotype changes relative humidity.
Meanwhile 50, Suzhou ox horn seed is selected, using the method for the present invention, VIGS is carried out by material of budding period seed
Gene silencing experiments.(first day) is to the inoculation time of two methods, silence phenotype time of occurrence, heavy since seed-soaking
Silent efficiency etc. is compared.The results are shown in Table 1, vacuum infiltration germinating seed gene expression reduced rate 83.30% of the present invention, note
Emitter permeates cotyledon method gene expression reduced rate 73.80%.
1 two kinds of different vaccination methods of table compare
In conclusion the present invention is inoculated with TRV diseases using eggplant budding period seed as material by the method for vacuum infiltration for the first time
Poison does not carry out destructive processing to plant, does not generate any damage, mechanical damage is caused to plant when overcoming virus inoculation
The shortcomings that；It is easy to operate using this method vaccination ways, it effectively shortens inoculation time, can effectively realize the heavy of endogenous gene
It is silent.It should be understood that those skilled in the art, method can be improved or be become according to the above description
It changes, and all these modifications and variations should all belong to the attached right of the present invention and want required protection domain.
Sequence table
<110>Jiangsu Province Agriculture Science Institute
<120>A method of improving eggplant Gene Silencing efficiency
<141> 2018-03-29
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 29
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
cggtctagag gcactcaact ttataaacc 29
<210> 2
<211> 29
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
cggggatccc ttcagttttc tgtcaaacc 29
<210> 3
<211> 427
<212> DNA
<213>Eggplant (Solanum melongena)
<400> 3
cggtctagag gcactcaact ttataaaccc cgacgaactt tcaatgcagt gcatcttgat 60
cgcattgaac aggtttcttc aggagaaaca tggttcaaaa atggcctttt tagatggtaa 120
tcctcctgag agactttgca tgccaattgt tcaacacatt gagtcaaaag gtggccaagt 180
cagactaaac tcacgaataa aaaagattga gctgaatgag gataaaagtg tcaagtgttt 240
tatactgaat gacggtagta caattaaggg agatgcattt gtgtttgcca ctccagtgga 300
tattctcaag cttcttttgc ctgaagactg gaaagagatt ccttatttcc aaaagttgga 360
gaagttagtt ggagtacctg tgataaatgt acatatatgg tttgacagaa aactgaaggg 420
atccccg 427
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
ggagaattca gccgctttga 20
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
tcatcagtca ccctatccgg 20
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
gcagctcctc catcgaaaag 20
<210> 7
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
ccgatcagca ataccaggg 19
Claims (6)
1. a kind of method improving eggplant Gene Silencing efficiency, which is characterized in that include the following steps：
(1) structure of eggplant viral gene recombinant expression carrier；
(2) it is prepared suitable for infecting budding period seed：After 1 ‰ gibberellin seed soaking 12h, 28 DEG C of vernalization are 2 after seed shows money or valuables one carries unintentionally
~3d, bud are grown spare when 0.5~1cm；
(3) preparation of liquid is infected；
(4) liquid inoculation is infected：Inoculation eggplant budding period seed is infected using vacuum infiltration methods：Vacuum infestation system is done by vacuum
Dry device and portable vacuum pump composition, it is -25kpa, pumpdown time 2min to vacuumize osmotic pressure；
(5) it is cultivated after being inoculated with：It is first put into light culture in 20 DEG C of growth cabinets after inoculation and is transferred to normal culture again to after breaking ground, trains
It is illumination 16h under the conditions of 25 DEG C to support environment, and dark 8h under the conditions of 20 DEG C, relative humidity is 50%~60%；
(6) Phenotypic Observation of inducing eggplant viral gene silence and detection.
2. a kind of method improving eggplant Gene Silencing efficiency according to claim 1, which is characterized in that institute
Being configured to for step (1) eggplant viral gene recombinant expression carrier is stated, according to eggplant PDS gene sequence characteristic design primers
SmPDS-XbaI-F:SEQ ID NO.1 and SmPDS-BamHI-R:SEQ ID NO.2 carry out PCR by template of the cDNA of eggplant
Amplified reaction obtains eggplant PDS gene silencing segments, and nucleotide sequence will obtain eggplant PDS genes as shown in SEQIDNO.3
Segment is connect with TRV2 plasmids by XbaI and BamHI restriction enzyme sites, and TRV2-SmPDS recombinant plasmids are obtained.
3. a kind of method improving eggplant Gene Silencing efficiency according to claim 2, which is characterized in that institute
State and infect being prepared as liquid, from be added to 50mg/L gentamicins, 50mg/L cards receive the YEB tablets of mycin and 25mg/L rifampins
Upper picking contains expression vector TRV2-SmPDS, TRV2 control vector, the positive Agrobacterium GV3101 monoclonals of TRV1 carriers divide
It is not added to 50mg/L gentamicins, is being trained in the YEB fluid nutrient mediums that 50mg/L cards receive mycin and 25mg/L rifampins
It supports, then respectively by bacterium solution according to 1:50 ratios are added to containing 10mmol/LMES, 20 μm of ol/L acetosyringones, 50mg/L celebratings
Big mycin, 50mg/L cards receive mycin and 25mg/L rifampins YEB fluid nutrient mediums in shake bacterium to OD600 values in 1.0-2.0, so
Centrifugation goes supernatant to collect each thalline afterwards, and addition is added to 10mmol/LMgCl2, 200mmol/L acetosyringones, 10mmol/
The MMA buffer solution suspension thallines of LMES adjust suspension OD600 values 1.0, by TRV1 and TRV2-SmPDS, TRV2 bacterium solution etc.
3 hours preparation inoculations are placed in volume mixture, room temperature dark place.
4. a kind of method of raising eggplant Gene Silencing efficiency according to one of claim 1-3, feature
It is, gene silencing phenomenon starts to occur after step (4) Fiber differentiation 10d.
5. a kind of method improving eggplant Gene Silencing efficiency according to claim 2 or 3, feature exist
In gene silencing phenomenon starts to occur after step (4) Fiber differentiation 10d, and gene PDS silences show as inoculation plant and albefaction occur
Phenomenon.
6. a kind of method improving eggplant Gene Silencing efficiency according to claim 5, which is characterized in that use
In the SmPDS gene primers of qRT-PCR include sense primer PDS-RT-F:SEQ ID NO.4, downstream primer PDS-RT-R:SEQ
ID NO.5, reference gene Actin primers include sense primer SmAct-F：SEQ ID NO.6 and downstream primer SmAct-R:SEQ
The expression of ID NO.7 detection inducing eggplant viral gene silences.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810271753.4A CN108624617A (en) | 2018-03-29 | 2018-03-29 | A method of improving eggplant Gene Silencing efficiency |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810271753.4A CN108624617A (en) | 2018-03-29 | 2018-03-29 | A method of improving eggplant Gene Silencing efficiency |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108624617A true CN108624617A (en) | 2018-10-09 |
Family
ID=63696395
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810271753.4A Pending CN108624617A (en) | 2018-03-29 | 2018-03-29 | A method of improving eggplant Gene Silencing efficiency |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108624617A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109266775A (en) * | 2018-10-19 | 2019-01-25 | 中国农业科学院蔬菜花卉研究所 | Reagent and its reference gene used for eggplant gene expression analysis |
| CN109402166A (en) * | 2018-11-30 | 2019-03-01 | 福建农林大学 | China fir Gene Silencing system and its construction method |
| CN109810988A (en) * | 2019-02-18 | 2019-05-28 | 广东省农业科学院蔬菜研究所 | A kind of eggplant fruit gene silencing system and its construction method |
| CN111676238A (en) * | 2020-06-16 | 2020-09-18 | 闽江学院 | Method for identifying gene function of mangrove plant Kandelia candel |
| CN111713288A (en) * | 2020-06-29 | 2020-09-29 | 宁波大学 | Inoculation method of Chinese wheat mosaic virus CWMV |
| CN116355951A (en) * | 2022-11-21 | 2023-06-30 | 河南农业大学 | Construction method of melon VIGS silencing system based on bud vacuum infection |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030182684A1 (en) * | 2002-03-14 | 2003-09-25 | Yale University | Tobacco rattle virus vectors and related compositions and methods |
| CN106591332A (en) * | 2016-11-10 | 2017-04-26 | 华南农业大学 | Eggplant spermidine synthase gene SmSPDS and applications thereof to improvements of eggplant capability for resisting bacterial wilt |
| CN106755066A (en) * | 2016-11-30 | 2017-05-31 | 周口师范学院 | A kind of wheat strain carrier mediated Gene Silencing methods of TRV and application |
-
2018
- 2018-03-29 CN CN201810271753.4A patent/CN108624617A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030182684A1 (en) * | 2002-03-14 | 2003-09-25 | Yale University | Tobacco rattle virus vectors and related compositions and methods |
| CN106591332A (en) * | 2016-11-10 | 2017-04-26 | 华南农业大学 | Eggplant spermidine synthase gene SmSPDS and applications thereof to improvements of eggplant capability for resisting bacterial wilt |
| CN106755066A (en) * | 2016-11-30 | 2017-05-31 | 周口师范学院 | A kind of wheat strain carrier mediated Gene Silencing methods of TRV and application |
Non-Patent Citations (2)
| Title |
|---|
| HUA-XUE YAN等: "Sprout vacuum-infiltration: a simple and efficient agroinoculation method for virus-induced gene silencing in diverse solanaceous species", 《PLANT CELL REPORTS》 * |
| SHAN LI等: "Genome-wide analysis of tomato NF-Y factors and their role in fruit ripening", 《BMC GENOMICS》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109266775A (en) * | 2018-10-19 | 2019-01-25 | 中国农业科学院蔬菜花卉研究所 | Reagent and its reference gene used for eggplant gene expression analysis |
| CN109266775B (en) * | 2018-10-19 | 2021-07-13 | 中国农业科学院蔬菜花卉研究所 | Reagent for eggplant gene expression analysis and internal reference gene used by reagent |
| CN109402166A (en) * | 2018-11-30 | 2019-03-01 | 福建农林大学 | China fir Gene Silencing system and its construction method |
| CN109402166B (en) * | 2018-11-30 | 2022-07-15 | 福建农林大学 | Cunninghamia lanceolata virus induced gene silencing system and construction method thereof |
| CN109810988A (en) * | 2019-02-18 | 2019-05-28 | 广东省农业科学院蔬菜研究所 | A kind of eggplant fruit gene silencing system and its construction method |
| CN111676238A (en) * | 2020-06-16 | 2020-09-18 | 闽江学院 | Method for identifying gene function of mangrove plant Kandelia candel |
| CN111713288A (en) * | 2020-06-29 | 2020-09-29 | 宁波大学 | Inoculation method of Chinese wheat mosaic virus CWMV |
| CN116355951A (en) * | 2022-11-21 | 2023-06-30 | 河南农业大学 | Construction method of melon VIGS silencing system based on bud vacuum infection |
| CN116355951B (en) * | 2022-11-21 | 2023-12-15 | 河南农业大学 | Construction method of melon VIGS silencing system based on bud vacuum infection |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108624617A (en) | A method of improving eggplant Gene Silencing efficiency | |
| Yan et al. | Sprout vacuum-infiltration: a simple and efficient agroinoculation method for virus-induced gene silencing in diverse solanaceous species | |
| CN110117320A (en) | Cotton GhCAL-D07 gene is promoting the application in flowering of plant | |
| CN103103194A (en) | Gene promoter of ginseng PgPDR3 responded by methyl jasmonate and application thereof | |
| CN102485897A (en) | Method for changing petal colors by using cotton gene GbF3H | |
| CN109576303A (en) | The gene silencing vector and its construction method of a kind of induction of cucumber green mottle mosaic virus and application | |
| CN106381302A (en) | Method for quickly identifying chrysanthemum nankingense gene function based on TRV-VIGS technology | |
| CN107338266A (en) | A kind of VIGS silencing systems for identifying mulberry tree MmPDS genes and its construction method and application | |
| CN109735562A (en) | A kind of construction method of the effective root system transgenic system of economic plants | |
| CN104561085B (en) | OsAGO18 genes are improving paddy rice to the application in stripe disease resistance | |
| CN104450779A (en) | Fast and efficient agrobacterium-mediated rice stem tip genetic transformation method | |
| CN107338264A (en) | The VIGS carriers of virus-mediated gene silencing | |
| CN102492721A (en) | Sesame genetic transformation method mediated by agrobacterium | |
| CN103026966B (en) | Method for identifying tomato yellow leaf curl virus resistance by utilizing detached leaf | |
| CN110373417A (en) | Cotton GhMADS41-A04 gene is promoting the application in flowering of plant | |
| CN110499325A (en) | The method of the primula gene silencing of TRV-based virus induction | |
| CN103275201B (en) | Protein ZmSkp1 related to sugarcane mosaic virus infected maize as well as encoding gene and application of protein ZmSkp1 | |
| CN109576290A (en) | A kind of VIGS silencing system that identifying Hibiscus hamabo HhCLA1 gene and its construction method and application | |
| CN115896160A (en) | Method for efficiently and quickly obtaining stable transgenic plants of apples by utilizing agrobacterium rhizogenes | |
| CN110157731B (en) | Geminivirus satellite DNA1 vector and breeding method thereof | |
| CN108342392A (en) | One chloroplaset gene location ToxABP1-V and its application | |
| CN108998454B (en) | Chrysanthemum nankingense aphid resistance-related miRNA160a and application thereof | |
| CN104004072B (en) | The application in regulating growth of plants of DUF994 albumen and encoding gene thereof | |
| CN106939317A (en) | It is a kind of to improve the method that plant resists the ability of RNA virus | |
| CN105505988A (en) | Double T-DNA vector capable of achieving agrobacterium co-transformation and establishment method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181009 |