CN108588064B

CN108588064B - Construct the kit of aim sequence DNA library and the construction method of aim sequence DNA library

Info

Publication number: CN108588064B
Application number: CN201810369205.5A
Authority: CN
Inventors: 张素芬; 严令华
Original assignee: Shanghai Tung Tree Biotechnology Co Ltd
Current assignee: Shanghai Tung Tree Biotechnology Co Ltd
Priority date: 2018-04-23
Filing date: 2018-04-23
Publication date: 2019-07-26
Anticipated expiration: 2038-04-23
Also published as: CN108588064A

Abstract

The present invention relates to a kind of kit for constructing aim sequence DNA library and the construction methods of aim sequence DNA library.The kit includes: aim sequence amplifing reagent, obtains first sample for expanding aim sequence from sample to be tested；Digestion reagent, primer for removing in first sample obtains the second sample, and digestion reagent includes the T4 polynueleotide kinase of the UDG enzyme of 0.2U/uL~2U/uL, the Fpg enzyme of 0.2U/uL~5U/uL, the polymerase of 0.2U/uL~4U/uL and 0.2U/uL~2U/uL；And connection reagent, aim sequence DNA library is obtained for connecting connector to the second sample.The Library Quality of the building of mentioned reagent box is preferably, sequencing coverage is higher and homogeneity is preferable.

Description

Construct the kit of aim sequence DNA library and the building of aim sequence DNA library Method

Technical field

The present invention relates to field of biotechnology, more particularly to a kind of kit and mesh for constructing aim sequence DNA library Sequence DNA library construction method.

Background technique

High throughput sequencing technologies (High-throughput sequencing) can be once parallel to hundreds of thousands to several hundred Ten thousand DNA moleculars carry out sequencing.The region for the site covering gene group that high throughput sequencing technologies are related to is smaller, not only The time loss that can reduce sequencing also reduces research cost, and therefore, high throughput sequencing technologies are widely used in gene diagnosis And gene therapy etc..Wherein, amplicon database technology is from genomic DNA by capturing specific objective segment, and by target patch Duan Chunhua is simultaneously enriched with containing the gene library for obtaining completing target fragment.Compared with genome sequencing technology, amplicon builds library skill Art can both save a large amount of time and economic cost, also can satisfy research of the scientific research personnel to specific gene group.It is existing The Library Quality of amplicon database technology building is poor, and sequencing coverage is lower and homogeneity is poor.

Summary of the invention

Based on this, it is necessary to provide a kind of kit for constructing aim sequence DNA library, the library matter of kit building Amount is preferably, sequencing coverage is higher and homogeneity is preferable.

A kind of kit constructing aim sequence DNA library, the kit include:

Aim sequence amplifing reagent obtains first sample, the purpose sequence for expanding aim sequence from sample to be tested Column amplifing reagent includes aim sequence amplification reaction solution, and the aim sequence amplification reaction solution includes the DNA of 1U/mL~5U/mL KCl, 10mM~15mM MgCl of polymerase, 300mM~500mM₂And the dNTPs of 8mM~12mM；

Digestion reagent obtains the second sample for removing the primer in the first sample, and the digestion reagent includes The UDG enzyme of 0.2U/uL~2U/uL, the Fpg enzyme of 0.2U/uL~5U/uL, the polymerase of 0.2U/uL~4U/uL and 0.2U/uL~ The T4 polynueleotide kinase of 2U/uL；And

Reagent is connected, obtains aim sequence DNA library, the connection reagent packet for connecting connector to second sample Connection reaction solution is included, the connection reaction solution includes that T4DNA ligase, the volumn concentration of 100U/ μ L~500U/ μ L is Glycerol that 5%~15% PEG6000, volumn concentration are 10%~15%, 1 that volumn concentration is 2%~10%, 2- propylene glycol, KCl, 0.5mM~2mM ATP of 8mM~12mM and the dNTPs of 1nM~3nM.

Mentioned reagent box includes aim sequence amplifing reagent, digestion reagent and connection reagent, and each group of these reagents divides it Between mutually cooperate with, the aim sequence that can successfully build library for the sample of separate sources and different genes, and construct DNA library it is high-quality, sequencing coverage is higher and homogeneity is preferable, sequencing it is high-quality.Experiments verify that mentioned reagent box The clip size of the aim sequence DNA library of building is mainly 150bp~250bp；It is examined through Ion Torrent PGM microarray dataset After survey, the coverage of each sample is all larger than 97%, and homogeneity is all larger than 98%, illustrates that sequencing quality is preferable.In addition, by above-mentioned Kit is enriched with aim sequence, is operated after connector connection and PCR amplification to get to DNA library with being used for high-flux sequence Simply.

The connection reagent further includes P1 connector in one of the embodiments, the P1 connector include P1 connector just To sequence and the reverse sequence of P1 connector, the base sequence of the positive sequence of the P1 connector is described as shown in SEQ ID No.1 The reverse sequence of P1 connector is as shown in SEQ ID No.2.

The connection reagent further includes label connector in one of the embodiments, and the label connector includes that label connects The positive sequence of head and the reverse sequence of label connector, the base sequence of the positive sequence of the label connector such as SEQ ID Shown in No.3, the reverse sequence of the label connector is as shown in SEQ ID No.4.

In one of the embodiments, the aim sequence DNA library amplifing reagent include PCR forward direction amplimer and The reversed amplimer of PCR, as shown in SEQ ID No.37, the PCR reversely expands the base sequence of the PCR forward direction amplimer Increase the base sequence of primer as shown in SEQ ID No.38.

The aim sequence DNA library amplifing reagent further includes PCR reaction solution in one of the embodiments, the PCR Reaction solution includes the (NH of the thermal starting high-fidelity DNA polymerase of 1U/ μ L~5U/ μ L, 18mM~22mM₄)₂SO₄, 1mM~3mM MgSO₄And 220 μM~240 μM dNTPs mixed liquors, and the pH of the PCR reaction solution is 7.0~7.6.

The aim sequence is that lung cancer drives gene in one of the embodiments,.

A kind of construction method of aim sequence DNA library, includes the following steps:

Multiplexed PCR amplification is carried out to sample to be tested using aim sequence amplifing reagent to react to obtain first sample, the mesh Sequence amplification reagent include aim sequence amplification reaction solution, the aim sequence amplification reaction solution includes 1U/mL~5U/mL's KCl, 10mM~15mM MgCl of archaeal dna polymerase, 300mM~500mM₂And the dNTPs of 8mM~12mM；

The first sample is reacted to obtain the second sample with digestion reagent, the digestion reagent includes 0.2U/uL~2U/ The UDG enzyme of uL, the Fpg enzyme of 0.2U/uL~5U/uL, the T4 of the polymerase of 0.2U/uL~4U/uL and 0.2U/uL~2U/uL are more Polynucleotide kinase；

Second sample is reacted with reagent is connect, obtains aim sequence DNA library, the connection reagent includes connection Reaction solution, the connection reaction solution include the T4DNA ligase of 100U/ μ L~500U/ μ L, volumn concentration be 5%~ The 1,2- third that glycerol that 15% PEG6000, volumn concentration are 10%~15%, volumn concentration are 2%~10% Glycol, KCl, 0.5mM~2mM ATP of 8mM~12mM and the dNTPs of 1nM~3nM.

Second sample is reacted described with reagent is connect in one of the embodiments, obtains aim sequence DNA It further include that magnetic beads for purifying is carried out to second sample before the operation in library.

In one of the embodiments, second sample is reacted to obtain aim sequence DNA with reagent is connect described It further include that pcr amplification reaction is carried out to the aim sequence DNA library, to be enriched with the aim sequence after the operation in library DNA library.

The sample to be tested is blood sample or tissue samples in one of the embodiments,.

Detailed description of the invention

Fig. 1 is the peak figure of the DNA library fragment length of a FFPE sample in test case 2；

Fig. 2 is the peak figure of the DNA library fragment length of b FFPE sample in test case 2；

Fig. 3 is the peak figure of the DNA library fragment length of c FFPE sample in test case 2；

Fig. 4 is the peak figure of the DNA library fragment length of d FFPE sample in test case 2；

Fig. 5 is the peak figure of the DNA library fragment length of e FFPE sample in test case 2；

Fig. 6 is the peak figure of the DNA library fragment length of f FFPE sample in test case 2.

Specific embodiment

To facilitate the understanding of the present invention, a more comprehensive description of the invention is given in the following sections with reference to the relevant attached drawings.In attached drawing Give preferred embodiment of the invention.But the invention can be realized in many different forms, however it is not limited to herein Described embodiment.On the contrary, purpose of providing these embodiments is keeps the understanding to the disclosure more saturating It is thorough comprehensive.

Unless otherwise defined, all technical and scientific terms used herein and belong to technical field of the invention The normally understood meaning of technical staff is identical.Term as used herein in the specification of the present invention is intended merely to description tool The purpose of the embodiment of body, it is not intended that in the limitation present invention.

The kit of the building aim sequence DNA library of one embodiment, including aim sequence amplifing reagent, digestion examination Agent, connection reagent and aim sequence DNA library amplifing reagent.

Aim sequence amplifing reagent, which is used to expand aim sequence from sample to be tested, obtains first sample.

In a wherein embodiment, aim sequence amplifing reagent includes aim sequence amplification reaction solution, aim sequence Amplification reaction solution includes KCl, 10mM~15mM MgCl of the archaeal dna polymerase of 1U/mL~5U/mL, 300mM~500mM₂And The dNTPs of 8mM~12mM.Further, aim sequence amplification reaction solution further includes pH8.0~8.5 of 100mM~300mM Tris-HCl。

Preferably, aim sequence amplification reaction solution includes the archaeal dna polymerase of 1U/mL~3.5U/mL, 300mM~400mM KCl, 10mM~12mM MgCl₂And the Tris-HCl of pH8.0~8.5 of the dNTPs and 100mM~300mM of 8mM~10mM.

In a wherein embodiment, aim sequence amplifing reagent further includes using for aim sequence PCR amplification primer In specifically expanding aim sequence.Specifically, according to sample to be tested the characteristics of, the specific primer of purpose of design sequence.

The primer that digestion reagent is used to remove in first sample obtains the second sample.

In a wherein embodiment, digestion reagent includes UDG enzyme, the 0.2U/uL~5U/uL of 0.2U/uL~2U/uL Fpg enzyme, the polymerase of 0.2U/uL~4U/uL and the T4 polynueleotide kinase of 0.2U/uL~2U/uL.

Wherein, UDG enzyme (Uracil-DNA Glycocasylase) i.e. uracil-DNA glycosylase, enzyme can select Property hydrolytic cleavage contain the uracil glycosidic bond in the double-strand or single stranded DNA of dU, the DNA chain for having missing base of formation, missing The DNA chain of base under alkaline medium or high temperature can further hydrolytic cleavage, to be eliminated.

Fpg enzyme (formamidopyrimidine-DNA-glycosylase, formyl amic metadiazine-DNA glycosylase) is also referred to as Make 8- oxidation guanine DNA glycosylase, the existing end N- glycosylase activity also has AP- to crack enzymatic activity.The end N- glycosylase Activity can cut the purine bases being damaged on double-stranded DNA, generate an apurinic sites (i.e. AP site).AP- cracks enzyme activity Property can cut the 3 ' ends or 5 ' ends of AP site, therefore can remove AP site.The dual function nature of Fpg enzyme, so that Fpg Enzyme can be used in shearing and repair impaired DNA.

Polymerase is archaeal dna polymerase.Specifically, polymerase is selected from least one of T4DNA polymerase and Klenow segment. T4DNA polymerase has 5'-3'DNA polymerase activity and 3'-5'DNA 5 prime excision enzyme activity simultaneously, can be incorporated into primer On single-stranded DNA templates, from the direction 5'-3' catalytic dna synthetic reaction, additionally it is possible to for 5' distal process to be gone out end-filling or 3' distal process End is scabbled out.

Klenow segment (Klenow fragment, Klenow fragment or Klenow enzyme, Klenow enzyme) is E.coli archaeal dna polymerase I has C-terminal, 605 amino through what trypsase or subtilopeptidase A partial hydrolysis generated The segment of sour residue.Klenow segment remains the 5'-3'DNA polymerase and 3'-5'DNA 5 prime excision enzyme activity of DNA polymerase i.

T4 polynueleotide kinase (T4polynucleotide kinase), can catalytic phosphatase group ATP γ- It is shifted and is handed between position and oligonucleotide chain (double-strand or single stranded DNA or RNA) 5 '-C-terminals and 3 '-monophosphate nucleosides It changes.The enzyme also has 3 ' phosphatase activities, 3 ' phosphate terminals, deoxidation 3 '-monophosphate core by 3 '-phosphate groups from oligonucleotides Hydrolysis is fallen on glycosides and deoxidation 3 '-nucleoside diphosphate.

Certainly, it should be noted that the component of digestion reagent is not limited to said components, can also include needed for primer digestion Buffer or auxiliary reagent etc., such as can be Tris-HCL.

Preferably, digestion reagent includes Fpg enzyme, the 0.2U/ of the UDG enzyme of 0.2U/uL~2U/uL, 0.2U/uL~3U/uL The T4 polymerized nucleoside of the T4DNA polymerase of uL~2U/uL, the Klenow segment of 0.2U/uL~2U/uL and 0.2U/uL~2U/uL Acid kinase.The formula of above-mentioned digestion reagent is reasonable, is conducive to digest the product after multiplex amplification.

Connection reagent obtains aim sequence DNA library for connecting connector to the second sample.

In a wherein embodiment, connection reagent includes connection reaction solution, wherein connection reaction solution includes 100U/ μ PEG6000 that T4DNA ligase, the volumn concentration of L~500U/ μ L is 5%~15%, volumn concentration be 10%~ 15% glycerol, the 1,2- propylene glycol that volumn concentration is 2%~10%, 8mM~12mM KCl, 0.5mM~2mM ATP And the dNTPs of 1nM~3nM.Further, connection reagent further includes the Tris-HCl of pH8.0~8.5 of 45mM~55mM, with Make the pH 7.5~7.7 for connecting reagent.Certainly, it should be noted that buffer reagent is not limited to Tris- in connection reaction solution HCl, or other buffer reagents, such as can be PBS.

In a wherein embodiment, connection reaction solution includes the T4DNA ligase of 300U/ μ L~500U/ μ L, volume Glycerol that PEG6000 that percentage composition is 5%~15%, volumn concentration are 10%~15%, volumn concentration 2% ~10% 1,2- propylene glycol, KCl, 1mM~2mM ATP of 10mM~12mM and the dNTPs of 2nM~3nM.

In a wherein embodiment, connection reagent further includes P1 connector.Specifically, P1 connector include P1 connector just To sequence and the reverse sequence of P1 connector.

In a wherein embodiment, the base sequence of the positive sequence of P1 connector are as follows: 5'CCACTACGCCTCCGCT TTCCTCTCTATGGGCAGTCGGTGAT3'(is as shown in SEQ ID No.1), the base sequence of the reverse sequence of P1 connector are as follows: 5'ATCACCGACTGCCCATAGAGAGGAAAGCGGAGGCGTAGTGGTT3') (as shown in SEQ ID No.2).

In a wherein embodiment, connection reagent further includes label connector.Specifically, label connector (Ax Adapter) include label connector positive sequence and label connector reverse sequence.

In a wherein embodiment, the base sequence of the positive sequence of Ax Adapter are as follows: 5'CCATCTCATCCC TGCGTGTCTCCGACTCAGNNNNNNNNNNGAT3'(is as shown in SEQ ID No.3), the alkali of the reverse sequence of Ax Adapter Basic sequence are as follows: 5'ATCNNNNNNNNNNCTGAGTCGGAGACACGC3'(is as shown in SEQ ID No.4), wherein N indicates A alkali Base, T base, the merger base of G base and C base.

In a wherein embodiment, the base sequence of the positive sequence of A1Adapter are as follows: 5'CCATCTCATCCCT GCGTGTCTCCGACTCAGTCTATTCGTCGAT3'(is as shown in SEQ ID No.5), the base of the reverse sequence of A1Adapter Sequence are as follows: 5'ATCGACGAATAGACTGAGTCGGAGACACGC3'(is as shown in SEQ ID No.6).

In a wherein embodiment, the base sequence of the positive sequence of A2Adapter are as follows: 5'CCATCTCATCCCT GCGTGTCTCCGACTCAGAGGCAATTGCGAT3'(is as shown in SEQ ID No.7), the base of the reverse sequence of A2Adapter Sequence are as follows: 5'ATCGCAATTGCCTCTGAGTCGGAGACACGC3'(is as shown in SEQ ID No.8).

In a wherein embodiment, the base sequence of the positive sequence of A3Adapter are as follows: 5'CCATCTCATCCCT GCGTGTCTCCGACTCAGTTAGTCGGACGAT3'(is as shown in SEQ ID No.9), the base of the reverse sequence of A3Adapter Sequence are as follows: 5'ATCGTCCGACTAACTGAGTCGGAGACACGC3'(is as shown in SEQ ID No.10).

In a wherein embodiment, the base sequence of the positive sequence of A4Adapter are as follows: 5'CCATCTCATCCCT GCGTGTCTCCGACTCAGCAGATCCATCGAT3'(is as shown in SEQ ID No.11), the alkali of the reverse sequence of A4Adapter Basic sequence are as follows: 5'ATCGATGGATCTGCTGAGTCGGAGACACGC3'(is as shown in SEQ ID No.12).

In a wherein embodiment, the base sequence of the positive sequence of A5Adapter are as follows: 5'CCATCTCATCCCT GCGTGTCTCCGACTCAGTCGCAATTACGAT3'(is as shown in SEQ ID No.13), the alkali of the reverse sequence of A5Adapter Basic sequence are as follows: 5'ATCGTAATTGCGACTGAGTCGGAGACACGC3'(is as shown in SEQ ID No.14).

In a wherein embodiment, the base sequence of the positive sequence of A6Adapter are as follows: 5'CCATCTCATCCCT GCGTGTCTCCGACTCAGTTCGAGACGCGAT3'(is as shown in SEQ ID No.15), the alkali of the reverse sequence of A6Adapter Basic sequence are as follows: 5'ATCGCGTCTCGAACTGAGTCGGAGACACGC3'(is as shown in SEQ ID No.16).

In a wherein embodiment, the base sequence of the positive sequence of A7Adapter are as follows: 5'CCATCTCATCCCT GCGTGTCTCCGACTCAGTGCCACGAACGAT3'(is as shown in SEQ ID No.17), the alkali of the reverse sequence of A7Adapter Basic sequence are as follows: 5'ATCGTTCGTGGCACTGAGTCGGAGACACGC3'(is as shown in SEQ ID No.18).

In a wherein embodiment, the base sequence of the positive sequence of A8Adapter are as follows: 5'CCATCTCATCCCT GCGTGTCTCCGACTCAGCCTGAGATACGAT3'(is as shown in SEQ ID No.19), the alkali of the reverse sequence of A8Adapter Basic sequence are as follows: 5'ATCGTATCTCAGGCTGAGTCGGAGACACGC3'(is as shown in SEQ ID No.20).

In a wherein embodiment, the base sequence of the positive sequence of A9Adapter are as follows: 5'CCATCTCATCCCT GCGTGTCTCCGACTCAGAACCTCATTCGAT3'(is as shown in SEQ ID No.21), the alkali of the reverse sequence of A9Adapter Basic sequence are as follows: 5'ATCGAATGAGGTTCTGAGTCGGAGACACGC3'(is as shown in SEQ ID No.22).

In a wherein embodiment, the base sequence of the positive sequence of A10Adapter are as follows: 5'CCATCTCATCCC TGCGTGTCTCCGACTCAGTTACAACCTCGAT3'(is as shown in SEQ ID No.23), the reverse sequence of A10Adapter Base sequence are as follows: 5'ATCGAGGTTGTAACTGAGTCGGAGACACGC3'(is as shown in SEQ ID No.24).

In a wherein embodiment, the base sequence of the positive sequence of A11Adapter are as follows: 5'CCATCTCATCCC TGCGTGTCTCCGACTCAGAACCATCCGCGAT3'(is as shown in SEQ ID No.25), the reverse sequence of A11Adapter Base sequence are as follows: 5'ATCGCGGATGGTTCTGAGTCGGAGACACGC3'(is as shown in SEQ ID No.26).

In a wherein embodiment, the base sequence of the positive sequence of A12Adapter are as follows: 5'CCATCTCATCCC TGCGTGTCTCCGACTCAGATCCGGAATCGAT3'(is as shown in SEQ ID No.27), the reverse sequence of A12Adapter Base sequence are as follows: 5'ATCGATTCCGGATCTGAGTCGGAGACACGC3'(is as shown in SEQ ID No.28).

In a wherein embodiment, the base sequence of the positive sequence of A13Adapter are as follows: 5'CCATCTCATCCC TGCGTGTCTCCGACTCAGTCGACCACTCGAT3'(is as shown in SEQ ID No.29), the reverse sequence of A13Adapter Base sequence are as follows: 5'ATCGAGTGGTCGACTGAGTCGGAGACACGC3'(is as shown in SEQ ID No.30).

In a wherein embodiment, the base sequence of the positive sequence of A14Adapter are as follows: 5'CCATCTCATCCC TGCGTGTCTCCGACTCAGCGAGGTTATCGAT3'(is as shown in SEQ ID No.31), the reverse sequence of A14Adapter Base sequence are as follows: 5'ATCGATAACCTCGCTGAGTCGGAGACACGC3'(is as shown in SEQ ID No.32).

In a wherein embodiment, the base sequence of the positive sequence of A15Adapter are as follows: 5'CCATCTCATCCC TGCGTGTCTCCGACTCAGTCCAAGCTGCGAT3'(is as shown in SEQ ID No.33), the reverse sequence of A15Adapter Base sequence are as follows: 5'ATCGCAGCTTGGACTGAGTCGGAGACACGC3'(is as shown in SEQ ID No.34).

In a wherein embodiment, the base sequence of the positive sequence of A16Adapter are as follows: 5'CCATCTCATCCC TGCGTGTCTCCGACTCAGTCTTACACACGAT3'(is as shown in SEQ ID No.35), the reverse sequence of A16Adapter Base sequence are as follows: 5'ATCGTGTGTAAGACTGAGTCGGAGACACGC3'(is as shown in SEQ ID No.36).

Aim sequence DNA library amplifing reagent is for expanding aim sequence DNA library, to improve aim sequence DNA library Concentration.Certainly, it should be noted that if the concentration of aim sequence DNA library can satisfy actual demand, aim sequence DNA library amplifing reagent also can be omitted.

In a wherein embodiment, aim sequence DNA library amplifing reagent includes PCR forward direction amplimer and PCR Reversed amplimer.

In a wherein embodiment, the base sequence of PCR forward direction amplimer are as follows: 5' CCTCTCTATGGGCAGTCGGTGAT3'(is as shown in SEQ ID No.37), the base sequence of the reversed amplimer of PCR are as follows: 5' CCATCTCATCCCTGCGTGTCTCCGAC3'(is as shown in SEQ ID No.38).

In a wherein embodiment, aim sequence DNA library amplifing reagent further includes PCR reaction solution, PCR reaction solution (the NH of thermal starting high-fidelity DNA polymerase, 18mM~22mM including 1U/ μ L~5U/ μ L₄)₂SO₄, 1mM~3mM MgSO₄ And 220 μM~240 μM of dNTPs, and the pH of aim sequence DNA library amplifing reagent is 7.0~7.6.Further, PCR is anti- Answering liquid further includes the Tris-SO of pH8.8~9.0 of 64mM~68mM₄, so that the pH of PCR reaction solution is 7.0~7.6.Certainly, It should be noted that buffer reagent is not limited to Tris-SO in PCR reaction solution₄, or other buffer reagents, such as can be with For Tris-HCl.

Preferably, PCR reaction solution includes thermal starting high-fidelity DNA polymerase, the 21mM~22mM of 3.5U/ μ L~5U/ μ L (NH₄)₂SO₄, 1mM~2.5mM MgSO₄, 230 μM~240 μM dNTPs and 65mM~68mM pH8.8~9.0 Tris-SO₄。

In a wherein embodiment, the kit of building aim sequence DNA library further includes magnetic bead, and magnetic bead is for pure Change the second sample and aim sequence DNA library.

Preferably, magnetic bead is Agencourt AMPure XP magnetic bead.

In a wherein embodiment, sample to be tested is blood sample or tissue samples.Wherein, tissue samples are fresh Tissue samples or FFPE sample (i.e. the tissue of paraffin embedding after formalin fixation).

In a wherein embodiment, aim sequence is that lung cancer drives gene.Further, lung cancer driving gene is selected from EGFR gene, KRAS gene, NRAS gene, PIK3CA gene, BRAF gene, ERBB2 gene, DDR2 gene, FGFR1 gene, At least one of ROS1 gene, MET gene, ALK gene and TP53 gene.

EGFR (epidermal growth factor receptor) is EGF-R ELISA (HER) family member One of, belong to tyrosine kinase receptor.EGFR gene is for encoding EGFR albumen.

Kras gene is a member in RAS gene family, is a kind of murine sarcoma virus oncogene, and N-ras is positioned at No. 1 On chromosome.

NRAS gene is a member in RAS gene family, and closely related with mankind's promyelocytic leukemia, length is big About 4.3kb is made of 670 adenines, 477 cytimidines, 543 guanines, 746 thymidines.

PIK3CA gene was detected in 1994 using hybridization in situ technique by Volinia, and 3q26.3 is positioned at, Long 34kb includes 21 exons, encodes 1068 kinds of amino acid.

BRAF gene is located at human chromosome 7q34, is about 190kb, is that Ras-Raf-MEK-ERK signal transduction pathway is important Transduced element, the receptor of cell surface and RAS albumen be connected by MEK and ERK with the transcription factor in core by Major Enzymes, Start a variety of factors and participates in various biological event in regulating cell, such as cell growth, differentiation and apoptosis.BRAF is thin in tumour The positive rate difference expressed in the high, medium and low differentiation of born of the same parents is obvious.

ERBB2 is the cell-membrane receptor of the 185kDa of proto-oncogene erbB-2 coding, is EGF-R ELISA One of (epidermalgrowthfactorreceptor, EGFR) family member.ERBB2 gene is for encoding ERBB2 albumen.

DDR2 gene is that one kind can promote cell migration, increase with the receptor tyrosine kinase (PTK) in conjunction with collagen It grows and survives.DDR2 mutation is present in squamous cell lung carcinoma and cell line.In DDR2 mutational cell line, DDR2 activity can be led Cause proliferation.Ectopic expression mutation DDR2 can lead to cell, and the difference of level caused by different mutation.These the result shows that DDR2 mutation may be carcinogenicity, and the cancer with these mutation may be to DDR2 erk agent.

FGFR1 is one kind of fibroblast growth factor acceptor (FGFRs), belong to immunoglobulin gene family at Member.FGFR1 is a kind of transmembrane protein, belongs to receptor tyrosine kinase.Contain highly expressed FGFR1 in lung carcinoma cell.

ROS1 gene and v ros growing sarcoma, the albumen of coding are receptor casein kinase (RTK).ROSl gene exists There is breakpoint at the exon of 32nd, 34 and 35, can be merged with several genes, and then influences tumor cells expression.

MET albumen is a kind of protein product encoded by c-met proto-oncogene, is hepatocyte growth factor receptor.MET egg It is white that there is tyrosine kinase activity, participation cellular informatics conduction, cytoskeleton related to a variety of oncoproteins and regulatory protein An important factor for regulation of rearrangement is cell Proliferation, differentiation and movement.It is now recognized that the generation of MET albumen and a variety of cancers and turning Move it is closely related, studies have shown that many tumour patients have in the generation and transfer process of its tumour MET over-express and base Gene-amplification.

ALK gene is a kind of carcinogenic driving gene of strength, and the alk protein of coding is anaplastic lymphoma kinase.ALK base Because being located at the p23 band of No. 2 chromosomes of the mankind, can merge to form new fusion protein, such as EML4- with other genetic fragments ALK.Different EML4-ALK fusion mutant all have vicious transformation and tumorigenesis sexuality.

TP53 gene is a kind of tumor suppressor gene, is positioned on the galianconism of No. 17 chromosome of the mankind, coding and expression Tp53 Albumen.Tp53 gene is the regulatory factor in cell growth cycle, regulation, DNA reparation, cell differentiation with the cell cycle, thin The important biological function such as born of the same parents' apoptosis is associated.

Mentioned reagent box includes aim sequence amplifing reagent, digestion reagent and connection reagent, and each group of these reagents divides it Between mutually cooperate with, the aim sequence that can successfully build library for the sample of separate sources and different genes, and construct DNA library it is high-quality, sequencing coverage is higher and homogeneity is preferable, sequencing it is high-quality.Experiments verify that mentioned reagent box The clip size of the aim sequence DNA library of building is mainly 150bp~250bp, the quality in illustration purpose sequence DNA library compared with It is good；After the detection of Ion Torrent PGM microarray dataset, the coverage of each sample is all larger than 97%, and homogeneity is all larger than 98%, Illustrate that sequencing quality is preferable.In addition, by mentioned reagent box to after aim sequence enrichment, connector connection and PCR amplification to get arriving DNA library, it is easy to operate to be used for high-flux sequence.

In addition, the present invention also provides the construction methods of the aim sequence DNA library of an embodiment, including operate as follows S110~S150:

S110, the kit for constructing aim sequence DNA library of above embodiment is provided.

S120, sample to be tested progress multiplexed PCR amplification is reacted to obtain first sample, mesh using aim sequence amplifing reagent Sequence amplification reagent include aim sequence amplification reaction solution, aim sequence amplification reaction solution includes the DNA of 1U/mL~5U/mL KCl, 10mM~15mM MgCl of polymerase, 300mM~500mM₂And the dNTPs of 8mM~12mM.

In a wherein embodiment, the reaction system of multiplexed PCR amplification reaction is carried out to sample to be tested are as follows: 6 μ L's Aim sequence amplification reaction solution, the primer pond of 10 μ L, the DNA profiling of 4 μ L, increase nuclease-free water to total volume are 20 μ L.

In a wherein embodiment, the fragment length of first sample is 125bp~175bp.

S130, first sample is reacted to obtain the second sample with digestion reagent, digestion reagent includes 0.2U/uL~2U/uL UDG enzyme, the Fpg enzyme of 0.2U/uL~5U/uL, the polymerase of 0.2U/uL~4U/uL and 0.2U/uL~2U/uL T4 poly Nucleoside monophosphate kinase.

Specifically, being 2~10 mixings with digestion reagent volume ratio by first sample and being reacted 40 minutes in 50 DEG C~60 DEG C ~45 minutes, obtain the second sample.

S140, the second sample is reacted with reagent is connect, obtains aim sequence DNA library, connection reagent includes that connection is anti- Answer liquid, it is 5%~15% that connection reaction solution, which includes the T4DNA ligase of 100U/ μ L~500U/ μ L, volumn concentration, 1,2- propylene glycol that glycerol that PEG6000, volumn concentration are 10%~15%, volumn concentration are 2%~10%, The dNTPs of KCl, 0.5mM of 8mM~12mM~2mM ATP and 1nM~3nM.

Specifically, connector dilution, connection reaction solution are mixed and is reacted with the second sample, obtain aim sequence DNA text Library.Wherein, connector dilution includes the nuclease-free water of the P1 connector of 2 μ L, a kind of label connector of 2 μ L and 4 μ L.Connector is dilute Release liquid, connection reaction solution mix and react with the second sample, obtain the reaction system of aim sequence DNA library are as follows: the company of 15 μ L Connecing reaction solution, the connector dilution of 2 μ L, the second sample of 13 μ L, increase nuclease-free water to total volume is 30 μ L.

In a wherein embodiment, before the operation of S140, further includes that magnetic beads for purifying is carried out to the second sample, obtain To the second sample after purification.

S150, pcr amplification reaction is carried out to aim sequence DNA library, to be enriched with aim sequence DNA library.

Specifically, aim sequence DNA library is subjected to magnetic beads for purifying, obtains the aim sequence DNA text of purifying after purification Library, then using aim sequence DNA library after purification as template, with aim sequence amplifing reagent to aim sequence DNA after purification Library carries out PCR amplification.

In a wherein embodiment, the volume ratio of aim sequence DNA library and magnetic bead is 1.2:1~1.6:1.

It further include that magnetic is carried out to the aim sequence DNA library after enrichment after S150 in a wherein embodiment Pearl purifying, to improve the purity of the aim sequence DNA library after enrichment.

In a wherein implementation method, the clip size of aim sequence DNA library is mainly 150bp~250bp.

The construction method in above-mentioned purpose sequence DNA library can the preferable DNA library of rapid build quality, it is easy to operate, The cost for building library is reduced, the possibility due to introducing mutation in PCR amplification is reduced, so that sequencing result is more accurate.

The following are specific embodiment parts.

It in embodiment if not otherwise indicated using reagent and instrument, is this field conventional selection.It is not specified in embodiment The experimental method of actual conditions, usually according to normal condition, such as condition described in document, books or kit factory The method that family is recommended is realized.Reagent used in embodiment is commercially available.

Not specified, T4DNA polymerase and Klenow segment used in embodiment are purchased from Takara company, T4DNA ligase is purchased from New England Biolabs company, and thermal starting high-fidelity DNA polymerase is purchased from New England Biolabs company, P1 connector and label connector are purchased from life company.Sample to be tested is FFPE sample.The amplification of PCR forward direction is drawn Object and the reversed amplimer of PCR are obtained by way of gene chemical synthesis.The base sequence of the positive sequence of P1 connector such as SEQ ID Shown in No.1, the base sequence of the reverse sequence of P1 connector is as shown in SEQ ID No.2.The base sequence of PCR forward direction amplimer Column are as shown in SEQ ID No.37, and the base sequence of the reversed amplimer of PCR is as shown in SEQ ID No.38.

Embodiment 1

A kind of kit constructing aim sequence DNA library, comprising:

(1) aim sequence amplifing reagent includes aim sequence amplification reaction solution, and aim sequence amplification reaction solution includes 1U/mL Archaeal dna polymerase, 300mM KCl, 10mM MgCl₂, 8mM dNTPs, 100mM pH 8.0 Tris-HCl.

(2) digestion reagent include the UDG enzyme of 0.2U/uL, the Fpg enzyme of 0.2U/uL, 0.2U/uL T4DNA polymerase and The T4 polynueleotide kinase of 0.2U/uL.

(3) connection reagent includes connection reaction solution, P1 connector and A1Adapter, wherein connection reaction solution includes 300U/ μ Glycerol that PEG6000 that T4DNA ligase, the volumn concentration of L is 5%, volumn concentration are 15%, volume basis contain The Tris-HCl of the pH8.0 of the dNTPs and 45mM of ATP, 1nM of KCl, 0.5mM of 1,2- propylene glycol, 12mM that amount is 2%.Its In, the base sequence of the positive sequence of A1Adapter is as shown in SEQ ID No.5, the base sequence of the reverse sequence of A1Adapter Column are as shown in SEQ ID No.6.

(4) aim sequence DNA library amplifing reagent includes PCR amplification primer and PCR reaction solution, wherein PCR reaction solution packet Include the thermal starting high-fidelity DNA polymerase of 5U/ μ the L, (NH of 22mM₄)₂SO₄, 3mM MgSO₄, 240 μM of dNTPs and 68mM The Tris-SO of pH8.8₄.PCR amplification primer includes PCR forward direction amplimer (base sequence is as shown in SEQ ID No.37), The reversed amplimer of PCR (base sequence is as shown in SEQ ID No.38).

Embodiment 2

A kind of kit constructing aim sequence DNA library, comprising:

(1) aim sequence amplifing reagent includes aim sequence amplification reaction solution, and aim sequence amplification reaction solution includes 5U/mL Archaeal dna polymerase, 500mM KCl, 15mM MgCl₂, 12mM dNTPs, 200mM pH 8.0 Tris-HCl.

(2) digestion reagent include the UDG enzyme of 2.0U/uL, the Fpg enzyme of 5.0U/uL, 4U/uL T4DNA polymerase and The T4 polynueleotide kinase of 2.0U/uL.

(3) connection reagent includes connection reaction solution, P1 connector and A2Adapter, wherein connection reaction solution includes 500U/ μ Glycerol that PEG6000 that T4DNA ligase, the volumn concentration of L is 15%, volumn concentration are 10%, volume basis The Tris-HCl of the pH8.0 of the dNTPs and 55mM of ATP, 3nM of KCl, 2mM of 1,2- propylene glycol, 8mM that content is 10%.Its In, the base sequence of the positive sequence of A2Adapter is as shown in SEQ ID No.7, the base sequence of the reverse sequence of A2Adapter Column are as shown in SEQ ID No.8.

(4) aim sequence DNA library amplifing reagent includes PCR amplification primer and PCR reaction solution, wherein PCR reaction solution packet Include the thermal starting high-fidelity DNA polymerase of 1U/ μ the L, (NH of 18mM₄)₂SO₄, 1mM MgSO₄, 200 μM of dNTPs and 64mM The Tris-SO of pH9.0₄.PCR amplification primer includes PCR forward direction amplimer (base sequence is as shown in SEQ ID No.37), The reversed amplimer of PCR (base sequence is as shown in SEQ ID No.38).

Embodiment 3

A kind of kit constructing aim sequence DNA library, comprising:

(1) aim sequence amplifing reagent includes aim sequence amplification reaction solution, and aim sequence amplification reaction solution includes 3.5U/ The MgCl of the archaeal dna polymerase of mL, KCl, 12mM of 400mM₂, 10mM dNTPs, 200mM pH 8.0 Tris-HCl.

(2) digestion reagent include the UDG enzyme of 1.0U/uL, the Fpg enzyme of 1.0U/uL, 1.5U/uL Klenow segment and The T4 polynueleotide kinase of 1.0U/uL.

(3) connection reagent includes connection reaction solution, P1 connector and A3Adapter, wherein connection reaction solution includes 100U/ μ Glycerol that PEG6000 that T4DNA ligase, the volumn concentration of L is 15%, volumn concentration are 10%, volume basis The Tris-HCl of the pH8.0 of the dNTPs and 50mM of ATP, 2nM of KCl, 2mM of 1,2- propylene glycol, 10mM that content is 8%.Its In, the base sequence of the positive sequence of A3Adapter is as shown in SEQ ID No.9, the base sequence of the reverse sequence of A3Adapter Column are as shown in SEQ ID No.10.

(4) aim sequence DNA library amplifing reagent includes PCR amplification primer and PCR reaction solution, wherein PCR reaction solution packet Include the thermal starting high-fidelity DNA polymerase of 3.5U/ μ the L, (NH of 21mM₄)₂SO₄, 2.5mM MgSO₄, 230 μM of dNTPs and 65mM PH8.8 Tris-SO₄.PCR amplification primer includes PCR forward direction amplimer (base sequence is as shown in SEQ ID No.37), The reversed amplimer of PCR (base sequence is as shown in SEQ ID No.38).

Embodiment 4

A kind of kit constructing aim sequence DNA library, comprising:

(1) aim sequence amplifing reagent includes aim sequence amplification reaction solution, and aim sequence amplification reaction solution includes 2U/mL Archaeal dna polymerase, 200mM KCl, 13.5mM MgCl₂, 11mM dNTPs, 100mM pH 8.0 Tris-HCl.

(2) digestion reagent include the UDG enzyme of 1.0U/uL, the Fpg enzyme of 3U/uL, 1.5U/uL T4DNA polymerase and The T4 polynueleotide kinase of 1.0U/uL.

(3) connection reagent includes connection reaction solution, P1 connector and A4Adapter, wherein connection reaction solution includes 400U/ μ Glycerol that PEG6000 that T4DNA ligase, the volumn concentration of L is 10%, volumn concentration are 12.5%, volume hundred Divide the Tris-HCl of the pH8.0 of the dNTPs and 55mM of ATP, 1nM of KCl, 2mM of the 1,2- propylene glycol, 12mM that content is 8%. Wherein, the base sequence of the positive sequence of A4Adapter is as shown in SEQ ID No.11, the alkali of the reverse sequence of A4Adapter Basic sequence is as shown in SEQ ID No.12.

(4) aim sequence DNA library amplifing reagent includes PCR amplification primer and PCR reaction solution, wherein PCR reaction solution packet Include the thermal starting high-fidelity DNA polymerase of 4U/ μ the L, (NH of 20mM₄)₂SO₄, 2mM MgSO₄, 220 μM of dNTPs and 66mM The Tris-SO of pH9.0₄.PCR amplification primer includes PCR forward direction amplimer (base sequence is as shown in SEQ ID No.37), The reversed amplimer of PCR (base sequence is as shown in SEQ ID No.38).

Embodiment 5

A kind of kit constructing aim sequence DNA library, comprising:

(2) digestion reagent include the UDG enzyme of 1.0U/uL, the Fpg enzyme of 3.0U/uL, 1.5U/uL T4DNA polymerase and The T4 polynueleotide kinase of 1.0U/uL.

(3) connection reagent includes connection reaction solution, P1 connector and A5Adapter, wherein connection reaction solution includes 300U/ μ Glycerol that PEG6000 that T4DNA ligase, the volumn concentration of L is 5%, volumn concentration are 15%, volume basis contain The Tris-HCl of the pH8.0 of the dNTPs and 45mM of ATP, 1nM of KCl, 0.5mM of 1,2- propylene glycol, 12mM that amount is 8%.Its In, the base sequence of the positive sequence of A5Adapter is as shown in SEQ ID No.13, the base of the reverse sequence of A5Adapter Sequence is as shown in SEQ ID No.14.

Embodiment 6

A kind of kit constructing aim sequence DNA library, comprising:

(2) digestion reagent includes the UDG enzyme of 1.0U/uL, the Fpg enzyme of 3.0U/uL, 1.5U/uLDNA polymerase and 1.0U/ The T4 polynueleotide kinase of uL.

(3) connection reagent includes connection reaction solution, P1 connector and A6Adapter, wherein connection reaction solution includes 500U/ μ Glycerol that PEG6000 that T4DNA ligase, the volumn concentration of L is 15%, volumn concentration are 10%, volume basis The Tris-HCl of the pH8.0 of the dNTPs and 55mM of ATP, 3nM of KCl, 2mM of 1,2- propylene glycol, 8mM that content is 8%.Its In, the base sequence of the positive sequence of A6Adapter is as shown in SEQ ID No.15, the base of the reverse sequence of A6Adapter Sequence is as shown in SEQ ID No.16.

Embodiment 7

A kind of kit constructing aim sequence DNA library, comprising:

(3) connection reagent includes connection reaction solution, P1 connector and A7Adapter, wherein connection reaction solution includes 500U/ μ Glycerol that PEG6000 that T4DNA ligase, the volumn concentration of L is 15%, volumn concentration are 10%, volume basis The Tris-HCl of the pH8.0 of the dNTPs and 50mM of ATP, 2nM of KCl, 2mM of 1,2- propylene glycol, 10mM that content is 8%.Its In, the base sequence of the positive sequence of A7Adapter is as shown in SEQ ID No.17, the base of the reverse sequence of A7Adapter Sequence is as shown in SEQ ID No.18.

Embodiment 8

A kind of kit constructing aim sequence DNA library, comprising:

(3) connection reagent includes connection reaction solution, P1 connector and A8Adapter, wherein connection reaction solution includes 400U/ μ Glycerol that PEG6000 that T4DNA ligase, the volumn concentration of L is 10%, volumn concentration are 12.5%, volume hundred Divide the Tris-HCl of the pH8.0 of the dNTPs and 55mM of ATP, 1nM of KCl, 2mM of the 1,2- propylene glycol, 12mM that content is 8%. Wherein, the base sequence of the positive sequence of A8Adapter is as shown in SEQ ID No.19, the alkali of the reverse sequence of A8Adapter Basic sequence is as shown in SEQ ID No.20.

Embodiment 9

A kind of kit constructing aim sequence DNA library, comprising:

(3) connection reagent includes connection reaction solution, P1 connector and A9Adapter, wherein connection reaction solution includes 300U/ μ Glycerol that PEG6000 that T4DNA ligase, the volumn concentration of L is 5%, volumn concentration are 15%, volume basis contain The Tris-HCl of the pH8.0 of the dNTPs and 45mM of ATP, 1nM of KCl, 0.5mM of 1,2- propylene glycol, 12mM that amount is 8%.Its In, the base sequence of the positive sequence of A9Adapter is as shown in SEQ ID No.21, the base of the reverse sequence of A9Adapter Sequence is as shown in SEQ ID No.22.

Embodiment 10

A kind of kit constructing aim sequence DNA library, comprising:

(3) connection reagent includes connection reaction solution, P1 connector and A10Adapter, wherein connection reaction solution includes 500U/ Glycerol that PEG6000 that T4DNA ligase, the volumn concentration of μ L is 15%, volumn concentration are 10%, volume basis The Tris-HCl of the pH8.0 of the dNTPs and 55mM of ATP, 3nM of KCl, 2mM of 1,2- propylene glycol, 8mM that content is 8%.Its In, the base sequence of the positive sequence of A10Adapter is as shown in SEQ ID No.23, the alkali of the reverse sequence of A10Adapter Basic sequence is as shown in SEQ ID No.24.

Embodiment 11

A kind of kit constructing aim sequence DNA library, comprising:

(3) connection reagent includes connection reaction solution, P1 connector and A11Adapter, wherein connection reaction solution includes 500U/ Glycerol that PEG6000 that T4DNA ligase, the volumn concentration of μ L is 15%, volumn concentration are 10%, volume basis The Tris-HCl of the pH8.0 of the dNTPs and 50mM of ATP, 2nM of KCl, 2mM of 1,2- propylene glycol, 10mM that content is 8%.Its In, the base sequence of the positive sequence of A11Adapter is as shown in SEQ ID No.25, the alkali of the reverse sequence of A11Adapter Basic sequence is as shown in SEQ ID No.26.

Embodiment 12

A kind of kit constructing aim sequence DNA library, comprising:

(3) connection reagent includes connection reaction solution, P1 connector and A12Adapter, wherein connection reaction solution includes 400U/ Glycerol that PEG6000 that T4DNA ligase, the volumn concentration of μ L is 10%, volumn concentration are 12.5%, volume hundred Divide the Tris-HCl of the pH8.0 of the dNTPs and 55mM of ATP, 1nM of KCl, 2mM of the 1,2- propylene glycol, 12mM that content is 8%. Wherein, the base sequence of the positive sequence of A12Adapter is as shown in SEQ ID No.27, the reverse sequence of A12Adapter Base sequence is as shown in SEQ ID No.28.

Embodiment 13

A kind of kit constructing aim sequence DNA library, comprising:

(3) connection reagent includes connection reaction solution, P1 connector and A13Adapter, wherein connection reaction solution includes 300U/ Glycerol that PEG6000 that T4DNA ligase, the volumn concentration of μ L is 5%, volumn concentration are 15%, volume basis The Tris-HCl of the pH8.0 of the dNTPs and 45mM of ATP, 1nM of KCl, 0.5mM of 1,2- propylene glycol, 12mM that content is 8%. Wherein, the base sequence of the positive sequence of A13Adapter is as shown in SEQ ID No.29, the reverse sequence of A13Adapter Base sequence is as shown in SEQ ID No.30.

Embodiment 14

A kind of kit constructing aim sequence DNA library, comprising:

(3) connection reagent includes connection reaction solution, P1 connector and A14Adapter, wherein connection reaction solution includes 500U/ Glycerol that PEG6000 that T4DNA ligase, the volumn concentration of μ L is 15%, volumn concentration are 10%, volume basis The Tris-HCl of the pH8.0 of the dNTPs and 55mM of ATP, 3nM of KCl, 2mM of 1,2- propylene glycol, 8mM that content is 8%.Its In, the base sequence of the positive sequence of A14Adapter is as shown in SEQ ID No.31, the alkali of the reverse sequence of A14Adapter Basic sequence is as shown in SEQ ID No.32.

Embodiment 15

A kind of kit constructing aim sequence DNA library, comprising:

(3) connection reagent includes connection reaction solution, P1 connector and A15Adapter, wherein connection reaction solution includes 500U/ Glycerol that PEG6000 that T4DNA ligase, the volumn concentration of μ L is 15%, volumn concentration are 10%, volume basis The Tris-HCl of the pH8.0 of the dNTPs and 50mM of ATP, 2nM of KCl, 2mM of 1,2- propylene glycol, 10mM that content is 8%.Its In, the base sequence of the positive sequence of A15Adapter is as shown in SEQ ID No.33, the alkali of the reverse sequence of A15Adapter Basic sequence is as shown in SEQ ID No.34.

Embodiment 16

A kind of kit constructing aim sequence DNA library, comprising:

(3) connection reagent includes connection reaction solution, P1 connector and A16Adapter, wherein connection reaction solution includes 400U/ Glycerol that PEG6000 that T4DNA ligase, the volumn concentration of μ L is 10%, volumn concentration are 12.5%, volume hundred Divide the Tris-HCl of the pH8.0 of the dNTPs and 55mM of ATP, 1nM of KCl, 2mM of the 1,2- propylene glycol, 12mM that content is 8%. Wherein, the base sequence of the positive sequence of A16Adapter is as shown in SEQ ID No.35, the reverse sequence of A16Adapter Base sequence is as shown in SEQ ID No.36.

Embodiment 17

A kind of kit constructing aim sequence DNA library, comprising:

(2) digestion reagent includes the T4DNA polymerase of 0.8U/uL.

Embodiment 18

A kind of kit constructing aim sequence DNA library, comprising:

(1) aim sequence amplifing reagent includes aim sequence amplification reaction solution, and aim sequence amplification reaction solution includes 5U/mL Archaeal dna polymerase, 12mM dNTPs, 200mM pH 8.0 Tris-HCl.

Embodiment 19

A kind of kit constructing aim sequence DNA library, comprising:

(3) connection reagent includes connection reaction solution, P1 connector and A3Adapter, wherein connection reaction solution includes 500U/ μ The Tris-HCl of the T4DNA ligase of L, the pH8.0 of the dNTPs and 50mM of ATP, 2nM of KCl, 2mM of 10mM.Wherein, The base sequence of the positive sequence of A3Adapter is as shown in SEQ ID No.9, the base sequence of the reverse sequence of A3Adapter As shown in SEQ ID No.10.

Embodiment 20

A kind of kit constructing aim sequence DNA library, comprising:

(4) aim sequence DNA library amplifing reagent includes PCR amplification primer and PCR reaction solution, wherein PCR reaction solution packet Include the Tris-SO of the thermal starting high-fidelity DNA polymerase of 4U/ μ L, the pH9.0 of 220 μM of dNTPs and 66mM₄.Pcr amplification primer Object includes PCR forward direction amplimer (base sequence is as shown in SEQ ID No.37), and (base sequence is such as the reversed amplimer of PCR Shown in SEQ ID No.38).

Embodiment 21

A kind of kit constructing aim sequence DNA library, comprising:

(2) digestion reagent includes UDG enzyme, the Fpg enzyme of 5.0U/uL, the archaeal dna polymerase of 2U/uL, the 2U/uL of 2.0U/uL The T4 polynueleotide kinase of Klenow segment and 2.0U/uL.

Comparative example

It is a kind of construct aim sequence DNA library kit be Life company, the amplicon that article No. is 1900943 build library examination Agent box.Wherein, label connector be A1Adapter, the base sequence of the positive sequence of A1Adapter as shown in SEQ ID No.5, The base sequence of the reverse sequence of A1Adapter is as shown in SEQ ID No.6.PCR in aim sequence DNA library amplification procedure Amplimer includes PCR forward direction amplimer (base sequence is as shown in SEQ ID No.37), the reversed amplimer (base of PCR Sequence is as shown in SEQ ID No.38).

Test case 1

The kit that Examples 1 to 20 and comparative example is respectively adopted carries out the structure of aim sequence DNA library to FFPE sample It builds.Wherein, FFPE sample is the FFPE sample of operation of lung cancer resection organization, and aim sequence includes 12 genes, 12 genes point It Wei not EGFR, KRAS, NRAS, PIK3CA, BRAF, ERBB2, DDR2, FGFR1, ROS1, MET, ALK and TP53.Detailed process is such as Under:

(1) DNA in FFPE sample is stripped using the FFPE extraction agent box of QIANGEN, is used DsDNAHS Assay Kit quantifies the DNA after extracting.According to the reaction condition in the reaction system and table 2 of table 1 to pumping DNA after mentioning carries out multi-PRC reaction, obtains first sample.

1 multiplexed PCR amplification reaction system of table

Component	Volume (uL)
		Aim sequence amplification reaction solution	6
Primer pond	10
		DNA profiling	≤4
Nuclease-free water	Supply 20
		Total volume	20

2 multiplexed PCR amplification reaction condition of table

(2) digestion reagent of 2 μ L is added in the first sample obtained to step (1), concussion is mixed, is centrifuged under 600rpm 5 seconds, and reacted according to the reaction condition in table 3, the primer removed in first sample obtains the second sample.By the second sample It mixes and purifies with Agencourt AMPure XP magnetic bead, obtain the second sample after purification.Wherein, the second sample with The volume ratio of Agencourt AMPure XP magnetic bead is 1.8:1.

The reaction condition of the digestion primer of table 3

(3) nuclease-free water of the P1 connector of 2 μ L, a kind of label connector of 2 μ L and 4 μ L is mixed, obtains connector dilution Liquid.Reaction is attached to the second sample after purification according still further to the reaction system of table 4, to connect to the second sample after purification Connector obtains aim sequence DNA library.Wherein, the reaction condition for connecting reaction is 25 DEG C, 15 minutes.

The reaction system of the connection reaction of table 4

Component	Volume
		Connect reaction solution	15μL
Connector dilution	2μL
		The second sample after dilution	13μL
Total volume	30μL

(4) Agencourt AMPure XP magnetic bead is added into the aim sequence DNA library of step (3) to incubate at room temperature It educates 5 minutes, then is placed on magnetic frame and places 5 minutes, until discarding supernatant liquid after liquid clarification, adding the existing preparation of 200 μ L The ethanol solution that volumn concentration is 70% is incubated for 1 minute, is discarded supernatant liquid, will be deposited in 25 DEG C of dryings 3 minutes (until magnetic Pearl air-dries), the magnetic bead containing aim sequence DNA library after purification after being air-dried.Wherein, aim sequence DNA library with The volume ratio of Agencourt AMPure XP magnetic bead is 0.55.

(5) be added into the magnetic bead after the air-drying of step (4) 22 μ L without enzyme water, magnetic bead is resuspended and simultaneously mixes, at room temperature It is incubated for 5min, 5min is then placed on magnetic frame, takes the supernatant of 20 μ L into PCR pipe, then is added 5 μ L's into PCR pipe The polymerase solution of amplimer and 25 μ L is vortexed and mixes, and carries out PCR reaction according to the PCR reaction condition in table 5, obtains richness Aim sequence DNA library after collection.

The PCR reaction condition of 5 aim sequence DNA library of table

(6) the aim sequence DNA library of enrichment is mixed with Agencourt AMPure XP magnetic bead according to volume ratio, Product after PCR is reacted is added in 25ul Agencourt AMPure XP magnetic bead, after of short duration mixing, is stored at room temperature 5 minutes, After liquid clarification, supernatant is shifted into the 1.5ml PCR pipe containing 60ul magnetic bead, is stored at room temperature about 5 minutes, it is clear in liquid After clear, supernatant is abandoned；It takes 70% ethyl alcohol of 200ul Fresh to be cleaned, is stored at room temperature 1 minute, abandon supernatant, take again 70% ethyl alcohol of 200ul Fresh is cleaned, and is stored at room temperature 1 minute, and supernatant is abandoned；Magnetic bead after the cleaning of 70% ethyl alcohol is put It sets and is air-dried at room temperature, take 50ul nuclease-free water to be eluted after air-drying, be stored at room temperature 3 minutes, then turn 1.5ml PCR pipe It moves on on magnetic frame, after liquid clarification, takes out supernatant, obtain final aim sequence library.

(7) high-flux sequence and interpretation of result: being sequenced with the PGM of Ion Torrent platform, every chip detection 16 samples, until detection finishes.Analyzing result, see Table 6 for details.What table 6 indicated is the DNA library of each embodiment and comparative example Coverage and homogeneity.

Table 6

As can be seen from Table 6, the coverage for the DNA library that the kit of embodiment 1~16 and embodiment 21 constructs is big In or be equal to 97%, homogeneity be all larger than or be equal to 98%, the data volume of each sample than more uniform, meanwhile, the structure of embodiment 1 The coverage and homogeneity of the DNA library built are better than the coverage and homogeneity of the DNA library of the building of comparative example, explanation respectively The kit coverage of above-mentioned building aim sequence DNA library is higher and homogeneity is higher, the most areas of aim sequence It can be obtained by sequencing.

Test case 2

(1) use Examples 1 to 6 and comparative example according to the operation of (1) the step of test case 1~(6) respectively to 7 FFPE The building of sample progress aim sequence DNA library.Wherein, it is a~g that 7 FFPE samples are numbered respectively, and 7 FFPE samples are The FFPE sample of operation of lung cancer resection organization, aim sequence be 12 genes, 12 genes be respectively EGFR, KRAS, NRAS, PIK3CA, BRAF, ERBB2, DDR2, FGFR1, ROS1, MET, ALK and TP53.

(2) quantitative detection is carried out to the aim sequence DNA library of above-mentioned 7 FFPE samples.WithdsDNAHS Assay Kit quantifies aim sequence DNA library.With 2100 testing goal sequence DNA of Agilent Bioanalyzer Library fragments size.Fragment size distribution in each library is measured with slice parsing method, and measures the piece segment length in maker simultaneously Degree is with the accuracy of illustration purpose sequence DNA library fragments size measurement, wherein maker includes the gene piece that length is 15bp The genetic fragment that section and length are 1500bp.See Table 7 for details and Fig. 1~6 for measurement result.Wherein, what table 7 indicated is above-mentioned 7 The quantitative analysis results of the final aim sequence DNA library of FFPE sample, and the fragment length in table 7 is corresponding sample purpose The corresponding fragment length of the summit in sequence DNA library.What Fig. 1~6 respectively indicated is that Agilent Bioanalyzer 2100 is surveyed The peak figure of the DNA library fragment length for 6 FFPE samples that fixed number is a~f, wherein fragment length is in Fig. 1~6 The peak of 15bp and the peak of 1500bp are the peak of maker, and the peak of the aim sequence DNA library of the corresponding a sample of Fig. 1 is by arrow Shown in the dotted line frame of (1-1) meaning, the peak of the aim sequence DNA library of the corresponding b sample of Fig. 2 is by arrow (2-1) meaning Dotted line frame shown in, in dotted line frame of the peak of the aim sequence DNA library of the corresponding c sample of Fig. 3 by arrow (3-1) meaning Shown, the peak of the aim sequence DNA library of the corresponding d sample of Fig. 4 is as shown in the dotted line frame of arrow (4-1) meaning, and Fig. 5 pairs The peak of the aim sequence DNA library for the e sample answered is as shown in the dotted line frame of arrow (5-1) meaning, the corresponding f sample of Fig. 6 The peak of this aim sequence DNA library is as shown in the dotted line frame of arrow (6-1) meaning.

Table 7

From table 7 and Fig. 1~6 as can be seen that the concentration of the DNA library for 6 samples that number is a~f is at least 9.06ng/ μ L, pM are at least 96970, and the length of segment is 215bp~225bp, illustrate the aim sequence for 6 samples that number is a~f The quality of DNA library is preferable, and the length difference of the concentration of the DNA library of the DNA library for the sample that number is g, pM and segment is low In the length of the concentration of the DNA library for the DNA library for numbering the sample for being a, pM and segment, illustrate above-mentioned building aim sequence The kit of DNA library can construct the preferable aim sequence DNA library of quality.

(3) according to the operation of 1 step of test case (7), pass through the sequencing reaction result of Ion Torrent PGM microarray dataset High-flux sequence analysis is carried out to above-mentioned 7 FFPE samples, see Table 8 for details for analysis result.What table 8 indicated is above-mentioned 7 FFPE samples This coverage and homogeneity.

Table 8

Number	Coverage	Homogeneity
			a	98.77%	98.85%
b	97.65%	98.48%
			c	98.30%	99.20%
d	95.44%	100.0%
			e	96.80%	98.53%
f	97.22%	98.54%
			g	95.11%	94.31%

As can be seen from Table 8, the coverage of the DNA library for 6 FFPE samples that number is a~f is at least 95.44%, Homogeneity is all larger than 98%, and the data volume of each sample illustrates that sequencing quality is preferable, the sample that number is g than more uniform The coverage of DNA library and homogeneity are respectively lower than the coverage and homogeneity for numbering the DNA library for the sample for being a, in explanation The sequencing coverage for stating the library of the kit building of building aim sequence DNA library is higher and homogeneity is preferable.

Test case 3

(1) experiment sample is divided into two groups, respectively implementation group and control group, and every group has 80 FFPE samples, and 80 FFPE sample is the FFPE sample organized after the operation of lung cancer carcinoma disease is cut off, and aim sequence includes 12 genes, 12 genes point It Wei not EGFR, KRAS, NRAS, PIK3CA, BRAF, ERBB2, DDR2, FGFR1, ROS1, MET, ALK and TP53.Reality is respectively adopted The kit of example 1 and comparative example is applied respectively to the FFPE sample of implementation group and control group according to (1) the step of test case 1~(6) Operation respectively two groups of experiment samples are carried out with the building of DNA library.

(3) according to the operation of 1 step of test case (8), pass through the sequencing reaction result of Ion Torrent PGM microarray dataset High-flux sequence analysis is carried out to the DNA library of two groups of experiment samples, see Table 9 for details for analysis result.Each parameter in table 9 is 80 The average value of sample.

Table 9

	Coverage	Homogeneity
			Experimental group	97.55%	98.22%
Control group	96.98%	97.69%

As can be seen from Table 9, the average value of the coverage of the DNA library of experimental group is 97.55%, the average value of homogeneity It is 98.22%, the average value of data volume is 0.5M reads；The average value of the coverage of the DNA library of control group is 96.98%, the average value of homogeneity is 97.69%, and the average value of data volume is 0.5M reads, illustrates the sequencing matter of experimental group Preferably, the kit for further relating to above-mentioned building aim sequence DNA library can successfully build a variety of different genes amount Library, and it is higher to build Kucheng's power.

In conclusion mentioned reagent box can be applied to flesh tissue, the amplicon of DNA in the source FFPE builds library, for Different genes can also build Kucheng's function, meanwhile, library is built down to also achievable under 1ng in original samples input amount, is substantially reduced Build the cost in library；The quality of the aim sequence DNA library of building is preferable；After the detection of Ion Torrent PGM microarray dataset, Sequencing quality is preferable.By mentioned reagent box to aim sequence enrichment, connector connection and PCR amplification after to get arrive DNA library, It is easy to operate to be used for high-flux sequence.Mentioned reagent box can be widely applied in the building of aim sequence DNA library.

Each technical characteristic of embodiment described above can be combined arbitrarily, for simplicity of description, not to above-mentioned reality It applies all possible combination of each technical characteristic in example to be all described, as long as however, the combination of these technical characteristics is not deposited In contradiction, all should be considered as described in this specification.

The embodiments described above only express several embodiments of the present invention, and the description thereof is more specific and detailed, but simultaneously It cannot therefore be construed as limiting the scope of the patent.It should be pointed out that coming for those of ordinary skill in the art It says, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to protection of the invention Range.Therefore, the scope of protection of the patent of the invention shall be subject to the appended claims.

Sequence table

<110>Shanghai tung oil tree Biotechnology Co., Ltd

<120>kit of aim sequence DNA library and the construction method of aim sequence DNA library are constructed

<160> 38

<170> SIPOSequenceListing 1.0

<210> 1

<211> 41

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

ccactacgcc tccgctttcc tctctatggg cagtcggtga t 41

<210> 2

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

atcaccgact gcccatagag aggaaagcgg aggcgtagtg gtt 43

<210> 3

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

ccatctcatc cctgcgtgtc tccgactcag nnnnnnnnnn gat 43

<210> 4

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

atcnnnnnnn nnnctgagtc ggagacacgc 30

<210> 5

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

ccatctcatc cctgcgtgtc tccgactcag tctattcgtc gat 43

<210> 6

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

atcgacgaat agactgagtc ggagacacgc 30

<210> 7

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

ccatctcatc cctgcgtgtc tccgactcag aggcaattgc gat 43

<210> 8

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

atcgcaattg cctctgagtc ggagacacgc 30

<210> 9

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

ccatctcatc cctgcgtgtc tccgactcag ttagtcggac gat 43

<210> 10

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

atcgtccgac taactgagtc ggagacacgc 30

<210> 11

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 11

ccatctcatc cctgcgtgtc tccgactcag cagatccatc gat 43

<210> 12

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 12

atcgatggat ctgctgagtc ggagacacgc 30

<210> 13

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 13

ccatctcatc cctgcgtgtc tccgactcag tcgcaattac gat 43

<210> 14

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 14

atcgtaattg cgactgagtc ggagacacgc 30

<210> 15

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 15

ccatctcatc cctgcgtgtc tccgactcag ttcgagacgc gat 43

<210> 16

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 16

atcgcgtctc gaactgagtc ggagacacgc 30

<210> 17

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 17

ccatctcatc cctgcgtgtc tccgactcag tgccacgaac gat 43

<210> 18

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 18

atcgttcgtg gcactgagtc ggagacacgc 30

<210> 19

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 19

ccatctcatc cctgcgtgtc tccgactcag cctgagatac gat 43

<210> 20

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 20

atcgtatctc aggctgagtc ggagacacgc 30

<210> 21

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 21

ccatctcatc cctgcgtgtc tccgactcag aacctcattc gat 43

<210> 22

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 22

atcgaatgag gttctgagtc ggagacacgc 30

<210> 23

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 23

ccatctcatc cctgcgtgtc tccgactcag ttacaacctc gat 43

<210> 24

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 24

atcgaggttg taactgagtc ggagacacgc 30

<210> 25

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 25

ccatctcatc cctgcgtgtc tccgactcag aaccatccgc gat 43

<210> 26

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 26

atcgcggatg gttctgagtc ggagacacgc 30

<210> 27

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 27

ccatctcatc cctgcgtgtc tccgactcag atccggaatc gat 43

<210> 28

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 28

atcgattccg gatctgagtc ggagacacgc 30

<210> 29

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 29

ccatctcatc cctgcgtgtc tccgactcag tcgaccactc gat 43

<210> 30

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 30

atcgagtggt cgactgagtc ggagacacgc 30

<210> 31

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 31

ccatctcatc cctgcgtgtc tccgactcag cgaggttatc gat 43

<210> 32

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 32

atcgataacc tcgctgagtc ggagacacgc 30

<210> 33

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 33

ccatctcatc cctgcgtgtc tccgactcag tccaagctgc gat 43

<210> 34

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 34

atcgcagctt ggactgagtc ggagacacgc 30

<210> 35

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 35

ccatctcatc cctgcgtgtc tccgactcag tcttacacac gat 43

<210> 36

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 36

atcgtgtgta agactgagtc ggagacacgc 30

<210> 37

<211> 23

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 37

cctctctatg ggcagtcggt gat 23

<210> 38

<211> 26

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 38

ccatctcatc cctgcgtgtc tccgac 26

Claims

1. a kind of kit for constructing aim sequence DNA library, which is characterized in that the kit includes:

Aim sequence amplifing reagent obtains first sample for expanding aim sequence from sample to be tested, and the aim sequence expands Increasing reagent includes aim sequence amplification reaction solution, and the aim sequence amplification reaction solution includes the DNA polymerization of 1U/mL~5U/mL KCl, 10mM~15mM MgCl of enzyme, 300mM~500mM₂And the dNTPs of 8mM~12mM, the sample to be tested are FFPE sample This；

Digestion reagent obtains the second sample for removing the primer in the first sample, and the digestion reagent is by following component Constitute: the UDG enzyme of 0.2U/uL~2U/uL, the Fpg enzyme of 0.2U/uL~5U/uL, 0.2U/uL~4U/uL polymerase and The T4 polynueleotide kinase of 0.2U/uL~2U/uL, the polymerase in T4 archaeal dna polymerase and Klenow segment at least It is a kind of；And

Reagent is connected, obtains aim sequence DNA library for connecting connector to second sample, the connection reagent includes connecting Connect reaction solution, the connection reaction solution include the T4 DNA ligase of 100U/ μ L~500U/ μ L, volumn concentration be 5%~ The 1,2- third that glycerol that 15% PEG6000, volumn concentration are 10%~15%, volumn concentration are 2%~10% Glycol, KCl, 0.5mM~2mM ATP of 8mM~12mM and the dNTPs of 1nM~3nM.

2. kit according to claim 1, which is characterized in that the connection reagent further includes P1 connector, and the P1 connects Head includes the positive sequence of P1 connector and the reverse sequence of P1 connector, the base sequence such as SEQ of the positive sequence of the P1 connector Shown in ID No.1, the reverse sequence of the P1 connector is as shown in SEQ ID No.2.

3. kit according to claim 1, which is characterized in that the connection reagent further includes label connector, the mark Signing connector includes the positive sequence of label connector and the reverse sequence of label connector, the base of the positive sequence of the label connector Sequence is as shown in SEQ ID No.3, and the reverse sequence of the label connector is as shown in SEQ ID No.4.

4. kit according to claim 1, which is characterized in that the aim sequence DNA library amplifing reagent includes PCR Positive amplimer and the reversed amplimer of PCR, the base sequence of the PCR forward direction amplimer such as SEQ ID No.37 institute Show, the base sequence of the reversed amplimer of PCR is as shown in SEQ ID No.38.

5. kit according to claim 4, which is characterized in that the aim sequence DNA library amplifing reagent further includes PCR reaction solution, the PCR reaction solution include thermal starting high-fidelity DNA polymerase, the 18mM~22mM of 1U/ μ L~5U/ μ L (NH₄)₂SO₄, 1mM~3mM MgSO₄And 220 μM~240 μM dNTPs mixed liquors, and the pH of the PCR reaction solution be 7.0~ 7.6。

6. kit according to claim 4, which is characterized in that the aim sequence is that tumour drives gene.

7. a kind of construction method of aim sequence DNA library, which comprises the steps of:

Multiplexed PCR amplification is carried out to sample to be tested using aim sequence amplifing reagent to react to obtain first sample, the purpose sequence Column amplifing reagent includes aim sequence amplification reaction solution, and the aim sequence amplification reaction solution includes the DNA of 1U/mL~5U/mL KCl, 10mM~15mM MgCl of polymerase, 300mM~500mM₂And the dNTPs of 8mM~12mM, the sample to be tested are FFPE sample；

The first sample is reacted to obtain the second sample with digestion reagent, the digestion reagent is made of following component: 0.2U/ The UDG enzyme of uL~2U/uL, the Fpg enzyme of 0.2U/uL~5U/uL, 0.2U/uL~4U/uL polymerase and 0.2U/uL~2U/uL T4 polynueleotide kinase, the polymerase be selected from least one of T4 archaeal dna polymerase and Klenow segment；And

Second sample is reacted with reagent is connect, obtains aim sequence DNA library, the connection reagent includes connection reaction Liquid, the connection reaction solution include the T4 DNA ligase of 100U/ μ L~500U/ μ L, volumn concentration be 5%~15% 1,2- propylene glycol that glycerol that PEG6000, volumn concentration are 10%~15%, volumn concentration are 2%~10%, The dNTPs of KCl, 0.5mM of 8mM~12mM~2mM ATP and 1nM~3nM.

8. construction method according to claim 7, which is characterized in that it is described by second sample with to connect reagent anti- It answers, further includes that magnetic beads for purifying is carried out to second sample before obtaining the operation of aim sequence DNA library.

9. construction method according to claim 7, which is characterized in that it is described by second sample with to connect reagent anti- It further include that pcr amplification reaction is carried out to the aim sequence DNA library after the operation that should obtain aim sequence DNA library, with It is enriched with the aim sequence DNA library.

10. construction method according to claim 7, which is characterized in that the sample to be tested is blood sample or tissue sample This.