CN108546752A

CN108546752A - MiRNA marker of detection and/or prediction mankind macrosomia or combinations thereof and its application

Info

Publication number: CN108546752A
Application number: CN201810361103.9A
Authority: CN
Inventors: 吴炜; 汤秋勤; 江华; 陈丽平; 陈婷; 陈敏健; 陆春城; 夏彦恺
Original assignee: Nanjing Medical University
Current assignee: Nanjing Hanwei Public Health Research Institute Co., Ltd
Priority date: 2018-04-20
Filing date: 2018-04-20
Publication date: 2018-09-18
Anticipated expiration: 2038-04-20
Also published as: CN108546752B

Abstract

The present invention discloses a kind of and relevant miRNA marker of mankind macrosomia or combinations thereof and application, belongs to genetic engineering and clinical medicine domain.The marker is one or more in 195 5p of hsa miR, 155 5p of hsa miR, 221 3p of hsa miR.The marker has specificity and sensibility to macrosomia, can be used for preparing the kit of macrosomia's early diagnosis or monitoring, and can carry out screening and diagnosis in early stage, can be repeatedly detected and be easy to dynamic monitoring.

Description

MiRNA marker of detection and/or prediction mankind macrosomia or combinations thereof and its application

Invention field

The invention belongs to genetic engineering and clinical medicine domain, it is related to detecting and/or predicting the miRNA marks of mankind macrosomia Will object or combinations thereof and its application.

Background technology

In upgrowth and development of children index, birth weight is the important indicator of Neonatal Health state, is to influence its existence An important factor for quality.Birth weight not only can cause harmful effect to the recent health of baby extremely, but also can influence Its health status after growing up.Epidemiological survey discovery, nearly ten years, all over the world (Canada, Sweden, the U.S., China) The incidence of low birth weight infant is totally on a declining curve, and the incidence of high birth weight youngster is gradually increasing, and the whole world is faced with The health risk that newborn's high birth weight is brought.In high birth weight, birth weight is more than that 4000 grams of newborn is referred to as Macrosomia, external incidence are 15.1%, and domestic incidence is 7% or so.Largely studies have shown that macrosomia can cause to have difficult labour Increase with the incidence of maternal infuries, equally increases the incidence of such as obesity, diabetes B, hypertension long term complication, and The risk of breast cancer and other cancers increases also with the increase of birth weight.The health risk that macrosomia brings has become How the important difficult medical problem for influencing China human mortality quality, causing serious society and economy burden, propose the prevention of adult disease Before be the research of current field of public health hot spot.Therefore, seek early prediction and the judgement of macrosomia, and carry out effectively dry In advance, it is of great significance to improving baby's health level.

Macrosomia is that many factors are coefficient as a result, work(with heredity, maternal weight gain, endocrine and placenta The factors such as energy are related.Have a large amount of clinical observations in recent years to find, even if similar or almost the same in nutrition and maternal factors In the case of, larger difference may also occur in neonatal birth weight.This is because all nutrition needed for embryo growth and development Substance is all to be supplied by placenta by parent, and the expression (IGF-I, IGF-II, leptin etc.) of certain factors regulates and controls in placenta The transhipment of nutriment, and then influences the growth of fetus.Macrosomia not only increases the burden of pregnant woman, and it is strong to grow up to fetus Health has an adverse effect, thus we need it is subclinical or earlier, it is even pregnant before just take relevant intervening measure to avoid Or reduce the occurrence of this disease, slow down the course of disease, mitigate the badness come-off of female youngster.Thus we there is an urgent need to find this disease specific marker Object and therapy target, to predict onset risk as early as possible, start prevention and intervening measure as early as possible, to reducing the occurrence of this disease, changing Kind Pregnancy prognosis is extremely important！

More and more researchs find that epigenetic variation plays an important role in disease development in recent years, micro- Important small molecule of the micro ribonucleic acid (microRNA, i.e. miRNA) as epigenetic, it is that one kind is about 19-23 nucleosides The single strand RNA molecule of acid, multidigit, can be in post-transcriptional levels to gene expression in highly conserved on Genome noncoding regions, evolution It is adjusted, and closely related with many normal physiological activities of animal, while also existing with the generation of many diseases and development Closely contact.Prediction finds that miRNA can at least regulate and control thousands of human genes, accounts for 30% or more of all genes.Dynamic In object cell, these microRNAs are to be cut to come from the precursor with hairpin like fold of 60-200nt and ripe, The transcription head product (pri-miRNA) of miRNA is processed into miRNA precursors by a kind of rnase iii Drosha quickly (pre-miRNA), then by nuclear translocation to cytoplasm, being cut into through another rnase iii Dicer identifications Ripe miRNA.MiRNA not coding proteins, but RNA is formed with single stranded form and cofactors TRBP and PACT and induces silence Compound, then combined with the 3 ' of mRNA end noncoding regions (3 ' UTR) regulates and controls the total of mRNA transcriptions and protein translation to play it On-off action.MiRNA and most specific mRNA are not complete complementaries, and a miRNA can be with the same mRNA Different loci targeting it is complementary or targeted from many different mRNAs complementary；In addition, different miRNAs can also Targeted-control Identical mRNA, and have similar biological function.I.e. a miRNA can regulate and control related mRNA in multiple signal paths, And multiple miRNA can also regulate and control same mRNA.Document report in recent years miRNAs is early in embryonic stem cell, embryonic development The expression of stage phase, Unusual pregnancy and pregnancy complication etc., from participate in regulation and control nematode sequential development lin-4 with Since let-7 is found, miRNA has been increasingly becoming the research hotspot of regulation and control mRNA stability and protein translation, respectively 2002 The annual ten big technological breakthroughs of the selected Science magazines of the two degrees of year and 2003.With going deep into for research, more and more miRNA It is found.Currently, the relationship of miRNA and tumour has become the emphasis of research, it has been found that several miRNA pass through negative regulator gene Expression is highly relevant with chronic lymphocytic leukemia, lung cancer, breast cancer, colon cancer, and blood plasma miRNA can be used as kinds of tumors The biomarker with prognosis occurs.However, result of study prompt in recent years, blood plasma miRNA are sent out possible as macrosomia Raw biological markers, the early prediction occurred for macrosomia.

Newest achievement in research finds that there are hundreds of miRNA, property stabilization, rich content to be easy to quantitative in blood plasma Detection, and there are significant disease specific, have confirmed that the express spectra of blood plasma miRNA can be used as morning in lung cancer, colon cancer The potential source biomolecule marker of phase diagnosis.This discovery is exciting, small molecule of the blood plasma miRNA as a kind of non-coding modulability RNA is possible to the biomarker for replacing traditional differential protein to be representative, has opened up the frontier of biomarker.However blood In slurry miRNA macrosomia's early prediction monitoring in application do not paid close attention to accordingly also, if can find stabilization with it is huge Relevant special blood plasma miRNA occurs for youngster as biomarker, and researches and develops the early prediction of corresponding disease, monitoring reagent box, It not only is in first place in the world in the field, the economic benefit to attract people's attention can be created, the prevention to China's hypertension of pregnancy Also will be primary strong promotion.

Bibliography：

1.Koch L.Reproductive endocrinology:macrosomia in developing countries.Nat Rev Endocrinol.2013；9(3):130.

2.Maccani MA,Padbury JF,Marsit CJ.miR-16and miR-21expression in the placenta is associated with fetal growth.PLoS One.2011；6(6):e21210.

3.Shi WW,Michael SK.Secular trends of fetal growth in Canada,1981to 1997.Paediatric and Perinatal Epidemiology,2003；17:347-354.

4.Yeh J,Shelton J.Reasons for increasing trends in large for gestational age births.Obstet Gynecol.2005；105(2):444；author reply 444-5.

5.Barchitta M,Maugeri A,Quattrocchi A,Agrifoglio O,Agodi A.The Role of miRNAs as Biomarkers for Pregnancy Outcomes:A Comprehensive Review.Int J Genomics.2017；2017:8067972.doi:10.1155/2017/8067972.

6.Jiang H,Wen Y,Hu L,Miao T,Zhang M,Dong J.Serum MicroRNAs as Diagnostic Biomarkers for Macrosomia.Reprod Sci.2015；22(6):664-71.

Invention content

The present invention is by the specific variations of the miRNAs in screening pregnant woman blood plasma, and filter out has macrosomia patient pregnant MiRNA significant with differential expression in the pregnant woman of normal health fetus, by detecting these miRNA, can assess whether it is pregnant have it is huge The specificity and sensibility of big youngster patient, miRNA marker provided by the invention or combinations thereof can be used for clinical especially early stage The molecular marked compound of mankind macrosomia diagnosis, monitoring, has very high specificity and sensitivity.

The object of the present invention is to provide relevant blood plasma microRNA markers occur with mankind macrosomia.

It is a further object to provide the primers of above-mentioned blood plasma microRNA markers.

It is a still further object of the present invention to provide the applications containing above-mentioned blood plasma microRNA markers or its primer.

A further object of the present invention is to provide is used for the mankind containing above-mentioned blood plasma microRNA markers or its primer Macrosomia's early prediction or the kit of monitoring.

The purpose of the present invention is what is realized by following technical proposal：

The present invention provides a kind of and relevant miRNA marker of mankind macrosomia or combinations thereof, is selected from hsa-miR-195- It is one or more in 5p, hsa-miR-155-5p or hsa-miR-221-3p.

The sequence of hsa-miR-195-5p is uagcagcacagaaauauuggc (SEQ ID No.1), hsa-miR-155- The sequence of 5p is uuaaugcuaaucgugauaggggu (SEQ ID No.2), and the sequence of hsa-miR-221-3p is agcuacauugucugcuggguuuc(SEQ ID No.3)。

MiRNA marker of the present invention or combinations thereof, preferably hsa-miR-195-5p, hsa-miR-155-5p or It is a variety of in hsa-miR-221-3p, more preferably include hsa-miR-195-5p, hsa-miR-155-5p and hsa-miR-221- 3p。

The present invention also provides the primers of the miRNA marker or combinations thereof.The present invention also provides specific primer pairs Sequence：It is SEQ ID No.4, downstream that wherein sequence, which is the sense primer of the marker hsa-miR-195-5p of SEQ ID No.1, Primer is SEQ ID No.5；The sense primer that sequence is the marker hsa-miR-155-5p of SEQ ID No.2 is SEQ ID No.6, downstream primer are SEQ ID No.7；Sequence is the sense primer of the marker hsa-miR-221-3p of SEQ ID No.3 For SEQ ID No.8, downstream primer is SEQ ID No.9.

MiRNA marker of the present invention or combinations thereof is in preparing detection and/or prediction mankind's macrosomia's reagent Using the especially application in preparing early detection and/or predicting mankind's macrosomia's reagent.The reagent is can to measure this The reagent of a little blood plasma microRNA markers expression quantity in blood plasma.

The probe or primer for detecting miRNA marker of the present invention or combinations thereof are preparing detection and/or the prediction mankind Application in macrosomia's reagent, the especially application in preparing early detection and/or predicting mankind's macrosomia's reagent.

The present invention also provides a kind of kit for detecting and/or predicting mankind macrosomia, which contains this hair The primer of the bright miRNA marker or combinations thereof.

The kit, the preferred kit contain primer pair SEQ ID No.4/SEQ ID No.5, SEQ ID It is multipair in No.6/SEQ ID No.7 or SEQ ID No.8, SEQ ID No.9.

The kit, the preferred kit contain following 3 pairs of primers：SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 and SEQ ID No.8, SEQ ID No.9.

The common agents of corresponding detection technique in the prior art can be used in other reagents in kit in addition to primer.

The present invention also provides application of the kit in detecting and/or predicting mankind macrosomia, especially in early stage Detect and/or predict the application in mankind macrosomia.

" mankind macrosomia " of the present invention refer to newborn birth after in 1 hour weight be equal to or more than 4000 grams of persons.

Beneficial effects of the present invention：

The present inventor has found institute of the present invention by detaching and comparing the miRNAs in normal control and macrosomia patients blood plasma The marker or combination stated can be used for assessing whether specificity and sensibility with macrosomia patient, and be experimentally confirmed tool There is preferable sensitivity, macrosomia patient is correctly detected identification, thus proposes the blood plasma miRNA mark of macrosomia patient The application of object and combinations thereof and the blood plasma miRNA marker or its primer in preparing macrosomia's diagnosis or monitoring reagent, grinds Make the macrosomia's diagnosis that can be used for clinical application, monitoring reagent box.

The marker evaluated as macrosomia using blood plasma miRNA of the present invention is advantageous in that：

(1) blood plasma miRNA is a kind of new biomarkers, is different from traditional biological marker, not only stable, minimally invasive, It is easy to detect, and quantitative accurate, the sensibility and specificity of macrosomia's diagnosis, such microRNA biology mark will be greatly improved The successful exploitation of will object is overturning to the traditional biological marker based on albumen, and the prevention that syndrome is merged for gestation is opened Completely new situation is created, is offered reference for the development of other diseases biomarker.

(2) blood plasma miRNA marker provided by the invention can be used for macrosomia's diagnosis marker, can avoid invasive examine It is disconnected, and can be in early stage by the risk of invasive manner acquisition macrosomia, to be carried for the further testing in depth testing of clinician For foundation, quick and precisely to grasp morbid state and coincident with severity degree of condition, the prevention side for taking more personalized in time of patient Case provides support, delays and prevent progression of disease.

(3) present invention is compared by meeting the sample of macrosomia and normal healthy controls crowd, it was demonstrated that these types of marker Expression quantity is there are significant difference and has stability, illustrates that marker of the present invention or combinations thereof has specificity, can make It is used for marker.

(4) present invention uses tight, multistage verification and appraisement system, initial stage to screen a variety of blood plasma by preliminary experiment MiRNAs carries out secondary verification using the methods of Real-time PCR and independent crowd verifies, using layering points-scoring system to examining Disconnected result is standardized, and carries out blind evaluation to blood plasma miRNA marker and diagnostic kit in another group of independence crowd, Demonstrate the reliability of the blood plasma miRNA biomarker and diagnostic kit.

Description of the drawings

Fig. 1 is using hsa-miR-195-5p, hsa-miR-155-5p, hsa-miR-221-3p as marker to normal healthy controls It is distinguished with macrosomia's group.

Fig. 2 individual blood plasma miRNA s expression fluctuations are analyzed.

ROC curve between Fig. 3 Normal groups and macrosomia's group.

Specific implementation mode

With reference to embodiment, the present invention will be further described, it should be understood that specific embodiment described herein is only To explain the present invention, it is not intended to limit the present invention, all letters under the concept thereof of the present invention to preparation method of the present invention Single improve belongs within protection scope of the present invention.Following example test method without specific conditions, usually according to The known approaches of this field.

1 research object of embodiment selects and grouping foundation

The present inventor in July, 2010 between in October, 2012 from attached Huaian First People's Hospital of Nanjing Medical University etc. Hospital collects satisfactory macrosomia patient and normal healthy controls pregnant woman blood sample, by the arrangement to sample data, therefrom The experiment pair of satisfactory 80 normal healthy controls, 80 macrosomias as Real-time PCR detection miRNA expression is selected As.Specific sample group standard is as follows：

A groups：Healthy control group (n=80,20 people's cDNA microarrays, one phase of 30 people are verified, 30 people independence crowds verification)：

1. without other systemic major diseases.

B groups：Macrosomia's group (n=80,20 people's cDNA microarrays, one phase of 30 people are verified, 30 people independence crowds verification)：

1. being macrosomia through clinical diagnosis；

2. without other systemic major diseases.

2 TaqMan miRNA array screenings of embodiment

Prepare cDNA samples：A) 100 μ l blood plasma are taken；B) be added 900 μ l TRIzol, vibrate mixing, 4 DEG C, 12000rpm from The heart 15 minutes, abandons lower layer's waste liquid；C) absolute ethyl alcohol that 1.5 times of volumes of supernatant are added shakes mixing, goes to centrifugal column, 12000rpm Centrifugation 15 seconds, abandons lower layer's waste liquid；D) 700 μ l RWT buffer solutions are added on centrifugal column, 10000rpm is centrifuged 15 seconds, and it is useless to abandon lower layer Liquid；E) 500 μ l RPE buffer solutions are added on centrifugal column, 10000rpm is centrifuged 15 seconds, abandons subnatant；F) e is repeated；It g) will centrifugation The pipe of a new 2ml is added in column, and 10000rpm is centrifuged 1 minute, for removing RPE buffer solutions；H) 50 μ are added on pillar RNA is collected by centrifugation in lDEPC processing water 12000rpm；I) and then by RNA reverse transcription reactions cDNA is obtained.The reactant of reverse transcription System includes 4 μ l5 × AMV buffer solutions, 2 μ l 10mM dNTP mixed liquors (Takara companies), 0.5 μ l RNase inhibitors (Takara companies), 1 μ l AMV (Takara companies) and the corresponding reverse primers of the 1.5 single miRNA of μ l.Reaction step is 16 DEG C be incubated 15 minutes, 42 DEG C react 1 hour, 85 DEG C be incubated 5 minutes.It is (anti-using corresponding miRNA if for different miRNA It is carried out to primer by above-mentioned steps)

1 reaction system of cDNA accordings to the form below after reverse transcription, which is prepared, carries out pre-expansion increasing：

1 reaction system of table

The reaction condition expanded in advance is as shown in table 2 below：

2 reaction condition of table

After pre- amplified production brief centrifugation, 0.1 × TE (pH 8.0) 75 μ l are added, done again after reverse mixing briefly from The heart.Pre- amplified production is used directly for following real-time fluorescence quantitative PCR (qPCR).

Pre- amplified production carries out preparing reaction system shown in qPCR accordings to the form below 3：

3 reaction system of table

High-volume 12.5% in view of loss of prime.

The difference of miRNAs express spectras, has filtered out 4 times of differences in detection and healthier control, macrosomia's plasma sample Above miRNAs.Through bioinformatic analysis and results of animal, selected wherein 3 become candidate and go forward side by side one step of traveling Card, specially：hsa-miR-195-5p(SEQ ID No.1)、hsa-miR-155-5p(SEQ ID No.2)、hsa-miR- 221-3p(SEQ ID No.3)。

3 Real-time PCR methods of embodiment measure blood plasma miRNA expression quantity

Design primer (table 1) carries out determining for each miRNAs to the blood plasma of 80 normal healthy controls, 80 macrosomia patients respectively Measure Real-time PCR detections.

(1) cDNA samples are prepared：A) 100 μ l blood plasma are taken；B) 900 μ l TRIzol of addition, oscillation mixing, 4 DEG C, 12000rpm is centrifuged 15 minutes, abandons lower layer's waste liquid；C) absolute ethyl alcohol that 1.5 times of volumes of supernatant are added shakes mixing, goes to centrifugation Column, 12000rpm are centrifuged 15 seconds, abandon lower layer's waste liquid；D) 700 μ l RWT buffer solutions, 10000rpm centrifugations 15 are added on centrifugal column Second, abandon lower layer's waste liquid；E) 500 μ l RPE buffer solutions are added on centrifugal column, 10000rpm is centrifuged 15 seconds, abandons subnatant；F) weight Multiple e；G) centrifugal column is added to the pipe of a new 2ml, 10000rpm is centrifuged 1 minute, for removing RPE buffer solutions；H) exist 50 μ l DEPC processing water 12000rpm are added on pillar, RNA is collected by centrifugation；I) and then by RNA reverse transcription reactions cDNA is obtained. The reaction system of reverse transcription includes 4 μ 5 × AMV of l buffer solutions, 2 μ l 10mM dNTP mixed liquors (Takara companies), 0.5 μ l RNase inhibitor (Takara companies), 1 μ l AMV (Takara companies) and the corresponding reverse primers of the 1.5 single miRNA of μ l. Reaction step is 16 DEG C and is incubated 15 minutes that 42 DEG C are reacted 1 hour, and 85 DEG C are incubated 5 minutes；

(2)Real-time PCR：Dye method：1 μ l cDNA are taken, by cDNA doubling dilutions, 0.3 μ l Taq enzymes are added (Takara companies), the corresponding forward primers of the above-mentioned single miRNA of 1 μ 20 × EVA of l GREEN, 0.25 10 μM of μ l, 0.25 μ l 10 μM of general reverse primers (URP), 1.2 μ l 25mM MgCl₂, 1.6 μ l 2.5mM dNTP mixed liquors (Takara companies), 2 μ l 10 × PCR buffer solutions, 12.4 μ l pure water, 20 μ l systems carry out quantitative fluorescent PCR.10μl TaqMan universal PCR Master Mix, 6.6 μ l H₂O, 20 μ l systems carry out q-PCR.What instrument used is all 7900 fluorescent quantitations of ABI Prism The reaction condition of PCR instrument, PCR is all：It carries out 1 for 95 DEG C, 5 minutes and recycles → 95 DEG C, 15 seconds, 60 DEG C, 1 minute carry out 40 and follow Ring.Detection and healthier control group, macrosomia organize the variation of miRNA expression quantity in plasma sample, each group sample blood plasma miRNA Expression quantity ratio can use equation 2^–△GIt indicates, wherein △ G=C_{T miRNA}–C_{T U6}.For ensure each time test between comparativity, I On every plate all be provided with U6, using its expression quantity as internal reference adjustment calculation expression amount.

It is obtained from interpretation of result, hsa-miR-195-5p, hsa-miR-155-5p, hsa-miR-221-3p this three MiRNA has marked difference (Fig. 1) between each group.Non-parametric Trend analysis also shows identical difference.

The primer sequence of 4 miRNAs of table

Primer	Corresponding miRNA primer sequences
		hsa-miR-195-5p-F	ACACTCCAGCTGGGTAGCAGCACAGAAAT
hsa-miR-195-5p-R	CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCCAATAT
		hsa-miR-155-5p-F	ACACTCCAGCTGGGTTAATGCTAATCGTGAT
hsa-miR-155-5p-R	CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACCCCTAT
		hsa-miR-221-3p-F	ACACTCCAGCTGGGAGCTACATTGTCTGCTG
hsa-miR-221-3p-R	CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGAAACCCA
		U6-F	CTCGCTTCGGCAGCACA(SEQ ID No.10)
U6-R	AACGCTTCACGAATTTGCGT(SEQ ID No.11)
		URP	TGGTGTCGTGGAGTCG(SEQ ID No.12)

The stability analysis of the individual blood plasma miRNA expression quantity of embodiment 4

It is evaluated using the stability of the blood plasma miRNA level of 8 pregnant woman of method pair of embodiment 3.It is same with embodiment 1 Continuous blood plasma three times of the acquisition method acquisition research object of sample (interval time is 1 week, and interval is interior without disease).The results show that These three miRNA expressions of hsa-miR-195-5p, hsa-miR-155-5p, hsa-miR-221-3p are relatively stablized in blood plasma (Fig. 2).These have all prompted the expression quantity of individual blood plasma miRNA relatively stable, have the spy as diagnosis/monitoring marker Property.

Judgement of 5 miRNA combination of embodiment to HSCR

According to above-mentioned Real-time PCR methods, the present inventor passes through the miRNAs to case and control group plasma sample The analysis of expression, using the quintile of healthy control group miRNAs expression quantity as threshold value, to hsa-miR-195-5p, hsa- MiR-155-5p, hsa-miR-221-3p score, and further acquire total score, draw ROC curve with this and carry out assessment prediction Sensitivity and specificity, and then assess the evaluation capacity of these three miRNAs low expressions or high expression to macrosomia.ROC is analyzed The results show that hsa-miR-195-5p, hsa-miR-155-5p, hsa-miR-221-3p are with 91.2% AUC (under ROC curve Area) Normal group and macrosomia are organized separately (Fig. 3).

A series of above-mentioned results of study on the basis of, inventors demonstrated that using hsa-miR-195-5p, hsa- MiR-155-5p, hsa-miR-221-3p can well separate macrosomia patient and normal healthy controls.

Embodiment 6 miRNA layerings scoring and the verification of independent crowd's blind

When to the expression water of these three markers of hsa-miR-195-5p, hsa-miR-155-5p, hsa-miR-221-3p It is flat (to add up after quintile layering) when carrying out layering scoring, it can be expressed as integrating to whether assessing with macrosomia Higher, the risk for being confirmed as macrosomia is higher.

5 three miRNAs quintiles scores of table are simultaneously summed

Note：Each miRNA is divided into five 0,1,2,3,4, minimum 0 point of grades by the quintile of expression quantity, and highest 4 Point, 3 miRNA synthesis can be scored at 0~12 point, and macrosomia organizes most scores very low (expression quantity is low, and integral is by anti- To calculating), and Normal group overwhelming majority score is very high.For example, as being 12 points (highest point there are one sample scoring Value group), then it can not possibly be macrosomia's case, and should be normal control.

(its grouping is judged according to specific score, what is secured satisfactory grades is included into control group, obtains low point for the point value of evaluation obtained Be included into macrosomia's group；Comparatively, >=9 calculate high score ,≤3 calculate low point), it is first that blind is carried out to the crowd of another group of independent acquisition It examines, that is, uses double-blind trial, routine diagnostic analysis and blood are carried out at the same time to independent crowd (40 pregnant woman of another hospital's acquisition) The miRNA of slurry samples is detected, and as a result display, can be by macrosomia and the good area of control pregnant woman by 3 miRNA detection scorings Separate (have that 8 scorings are relatively low (≤3 points) in 40 random selection samples, wherein reach 0 point (best result) has 4, this 4 It is macrosomia after diagnosing, remaining scoring higher (>=9 points) is non-macrosomia), prompt these types miRNA to can be used as assessment The marker of macrosomia.

The making for the miRNA diagnostic kits that embodiment 7 is diagnosed and monitored for macrosomia

The manufacture craft and operating process of the miRNA kits are based primarily upon RT-PCR, Real-time round pcr.

Determine in normal person and macrosomia patients blood plasma there is one by the method for sequencing and Real-time PCR methods first A above miRNA copied.Then by the relevant a kind of blood plasma miRNA of the technology screenings such as quantitative PCR and macrosomia, as pre- The index that macrosomia and diagnosis whether occurs surveyed.The quantity for finally filtering out corresponding blood plasma miRNA is controlled at several, this is The optimization made on the basis of preliminary experiment is simplified.This kit includes a collection of blood plasma miRNA primer, wherein miRNA's Primer includes forward and reverse primer (being shown in Table 4) of hsa-miR-195-5p, hsa-miR-155-5p, hsa-miR-221-3p, U6.Also There can be the related common reagent of round pcr, such as Taq enzyme, PCR buffer solutions, MgCl₂, triphosphoric acid base deoxynucleotide mixing Corresponding commercial product can also be used in the reagents such as liquid, dyestuff, these reagents.The value of this kit is only to need primary extraction (2ml) blood on a small quantity, you can the variation tendency of detection blood plasma miRNA marker, then sent out by trend macrosomia Raw possibility or diagnosis macrosomia, and be easy to carry out dynamic monitoring and observe therapeutic effect.

Specific kit forms are as follows：

Primer can also be two couples or three couples in following three pairs of primers：SEQ ID NO.4 and SEQ ID NO.5, SEQ ID NO.6 and SE Q ID NO.7, SEQ ID NO.8 and SEQ ID NO.9, each 10 μM of 0.25 μ l.

0.3 μ l Taq enzymes, 1 μ 20 × EVA of l GREEN, 1.2 μ l 25mM MgCl can also be contained in kit₂, 1.6 μ L2.5mM dNTP mixed liquors, 2 μ l 10 × PCR buffer solutions, 12.4 μ l pure water.

Forward and reverse primer that can also be containing internal reference U6 in kit is a pair of (table 1).

Or also contain 1 μ l, 10 μM of general reverse primers, 10 μ l TaqMan universal PCs R in kit in addition to forward primer Mixed liquor, 6.6 μ l H₂O。

Reagent of the component in addition to primer in kit may be used is used for the corresponding of miRNA content detections in the prior art Reagent.

Sequence table

<110>Nanjing Medical University

<120>MiRNA marker of detection and/or prediction mankind macrosomia or combinations thereof and its application

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> RNA

<213>Human plasma (human)

<400> 1

uagcagcaca gaaauauugg c 21

<210> 2

<211> 23

<212> RNA

<213>Human plasma (human)

<400> 2

uuaaugcuaa ucgugauagg ggu 23

<210> 3

<211> 23

<212> RNA

<213>Human plasma (human)

<400> 3

agcuacauug ucugcugggu uuc 23

<210> 4

<211> 29

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

acactccagc tgggtagcag cacagaaat 29

<210> 5

<211> 44

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

ctcaactggt gtcgtggagt cggcaattca gttgaggcca atat 44

<210> 6

<211> 31

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

acactccagc tgggttaatg ctaatcgtga t 31

<210> 7

<211> 44

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 7

ctcaactggt gtcgtggagt cggcaattca gttgagaccc ctat 44

<210> 8

<211> 31

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 8

acactccagc tgggatctac attgtctgct g 31

<210> 9

<211> 44

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 9

ctcaactggt gtcgtggagt cggcaattca gttgaggaaa ccca 44

<210> 10

<211> 17

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 10

ctcgcttcgg cagcaca 17

<210> 11

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 11

aacgcttcac gaatttgcgt 20

<210> 12

<211> 16

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 12

tggtgtcgtg gagtcg 16

Claims

1. a kind of with the relevant miRNA marker of mankind macrosomia or combinations thereof, it is characterised in that selected from hsa-miR-195-5p, It is one or more in hsa-miR-155-5p or hsa-miR-221-3p.

2. miRNA marker according to claim 1 or combinations thereof, it is characterised in that selected from hsa-miR-195-5p, It is a variety of in hsa-miR-155-5p or hsa-miR-221-3p.

3. miRNA marker according to claim 2 or combinations thereof, it is characterised in that including hsa-miR-195-5p, Hsa-miR-155-5p and hsa-miR-221-3p.

4. claims 1 to 3 any one of them miRNA marker or combinations thereof is preparing detection and/or is predicting that the mankind are huge Application in youngster's reagent, the especially application in preparing early detection and/or predicting mankind's macrosomia's reagent.

5. test right requires the probe or primer of 1~3 any one of them miRNA marker or combinations thereof.

6. probe according to claim 6 or primer, it is characterised in that selected from any pair of following (1)-(3) or multipair draw Object：

(1) upstream primer sequence of hsa-miR-195-5p is SEQ ID No.4, and downstream primer sequence is SEQ ID No.5；

(2) upstream primer sequence of hsa-miR-155-5p is SEQ ID No.6, and downstream primer sequence is SEQ ID No.7；

(3) upstream primer sequence of hsa-miR-221-3p is SEQ ID No.8, and downstream primer sequence is SEQ ID No.9.

7. the application of probe described in claim 5 or 6 or primer in preparing detection and/or prediction mankind's macrosomia's reagent, Application especially in preparing early detection and/or predicting mankind's macrosomia's reagent.

8. a kind of kit for detecting and/or predicting mankind macrosomia, it is characterised in that the kit contains claim 5 Or the probe described in 6 or primer.

9. kit according to claim 8, it is characterised in that the kit contains primer pair SEQ ID No.4/SEQ It is multipair in ID No.5, SEQ ID No.6/SEQ ID No.7 or SEQ ID No.8, SEQ ID No.9, it preferably comprises following 3 pairs of primers：SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 and SEQ ID No.8, SEQ ID No.9。

10. application of the kit in detecting and/or predicting mankind macrosomia described in claim 8 or 9, especially in early stage Detect and/or predict the application in mankind macrosomia.