CN108517366A - Coriolis clostridium specific probe and application thereof - Google Patents
Coriolis clostridium specific probe and application thereof Download PDFInfo
- Publication number
- CN108517366A CN108517366A CN201810288852.3A CN201810288852A CN108517366A CN 108517366 A CN108517366 A CN 108517366A CN 201810288852 A CN201810288852 A CN 201810288852A CN 108517366 A CN108517366 A CN 108517366A
- Authority
- CN
- China
- Prior art keywords
- clostridium
- coriolis
- coriolis clostridium
- probe
- specific probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6841—In situ hybridisation
Abstract
The invention belongs to microbiologies and molecular biology interleaving techniques field, and in particular to a kind of Coriolis clostridium specific probe and its purposes and method for detecting Coriolis Clostridium content in pit mud.The problem of for yet there are no the method using fluorescence in situ hybridization detection Coriolis Clostridium counts in the prior art, the present invention provides a kind of complementary nucleic acid probes for guarding terminal sequence design specificity based on Coriolis clostridium 16S rRNA, name KCLZ, sequence such as SEQ ID NO：Shown in 1.Using KCLZ probes of the invention, the Coriolis clostridium in the samples such as detection wine brewing pit mud that can be specific provides a kind of accurate, quick analysis means with the rule for storing age transition for Coriolis clostridium in accurate anatomy Chinese Luzhou-flavor.
Description
Technical field
The invention belongs to microbiologies and molecular biology interleaving techniques field, and in particular to a kind of Coriolis clostridium specificity
Probe and its purposes and method for detecting Coriolis Clostridium content in pit mud.
Background technology
Coriolis clostridium (Clostridium kluyveri) is strictly anaerobic microorganism, is mainly distributed in water and black earth.
Nineteen thirty-seven finds for the first time in Ovshinsky methagen pollutant, and is named in 1942.The bacterium cell is in rod-shaped, can be moved,
Can butyric acid, and then synthesizing hexanoic acid be generated by ethyl alcohol and acetic acid.Because caproic acid and ethyl hexanoate are important in perfume in aromatic Chinese spirit
Effect, Coriolis clostridium receive the favor of vast wine brewing researcher.
Coriolis clostridium is the production higher bacterial strain of caproic acid ability in fusobacterium, is that can accumulate caproic acid in culture solution so far
Unique kind of fusobacterium, the formation of caproic acid and ethyl hexanoate can not only be promoted in Daqu spirit of China fermentation process, and can also promote
Into the formation of the micro constitutents such as valeric acid, enanthic acid, the peculiar flavour of aromatic Chinese spirit is formed, can determine giving off a strong fragrance to a certain extent
The quality and style of type white wine.However, sensibility of the Coriolis clostridium to oxygen, causes it to be difficult to screen from pit mud by pure culture
When out, for Coriolis clostridium quantitative analysis, result is often to limit to, and cannot accurately react Coriolis clostridium in pit mud
Content, and the contribution function to liquor flavor.It is more accurate to Coriolis clostridium in aromatic Chinese spirit brewing pit in order to realize
With quick quantitative analysis, urgent need exploitation is significantly more efficient to exempt from culture quantitative analysis method for Coriolis clostridium.
The quick detection and identification that specific microorganism is carried out by molecular biology method has become Modern microbiological diagnosis
With the important means of ecological study.The Coriolis clostridium Testing and appraisal in pit mud mainly uses PCR-DGGE, qPCR, nucleic acid at present
The methods of sequencing.But the method for these based on PCR may introduce error in amplified reaction, reduce gained information
Accuracy.In actual operation, the set goal can not be fully achieved with single molecular biology method, generally requires comprehensive
Different kinds of molecules biological means are closed, could comprehensively be analyzed.
Fluorescence in situ hybridization (fluorescence in situ hybridization, FISH) is that one kind not depending on PCR
Molecular engineering, it is a species specific microorganism image detecting method.This method by the nucleic acid probe of fluorescent marker with
The similar nucleic acid sequences hybridization of extracellular microbial inner height, and emit fluorescence under exciting light irradiation, it can be used for the detection of microorganism
And positioning.
It yet there are no the method using fluorescence in situ hybridization detection Coriolis Clostridium counts in the prior art.
Invention content
The technical problem to be solved in the present invention is：It is yet there are no in the prior art using fluorescence in situ hybridization detection Coriolis shuttle
The problem of method of bacterium number amount.
The present invention solve above-mentioned technical problem technical solution be：Provide a kind of Coriolis clostridium specific probe and its use
In the purposes and method that detect Coriolis Clostridium content in pit mud.
The present invention provides a kind of Coriolis clostridium specific probes, are named as KCLZ, nucleotide sequence such as SEQ ID
NO：Shown in 1.
SEQ ID NO：The nucleotide sequence of 1 Coriolis clostridium specific probe
5’-3’：cctgcacaccctttacgcccagtaattccggacaa.
Particularly, in above-mentioned Coriolis clostridium specific probe, cyanine dye fluorescein is also associated at 5 ' ends of probe
CY3。
Wherein, the preparation method of above-mentioned Coriolis clostridium specific probe is：It is all micro- to download Clostridiaceae in ncbi database
Full length sequence in the 16S rRNA of biology, and 16S rRNA comparisons are carried out, find out kind of interior conservative, one section of special few core of inter-species
Nucleotide sequence SEQ ID NO：2, according to SEQ ID NO：2 are designed synthesis.
SEQ ID NO：The nucleotide sequence of 2 design probe KCLZ
5’-3’tatcgaccccccctgtgccgcagtaaacacaataagtactccgcctgggaagtacgatcgcaag。
The present invention also provides purposes of the above-mentioned Coriolis clostridium specific probe in detecting Coriolis Clostridium content.
Further, in such use, the Coriolis clostridium is the Coriolis clostridium in making wine pit mud.
Coriolis clostridium in wine brewing pit mud is detected using above-mentioned Coriolis clostridium specific probe the present invention also provides a kind of
Method includes the following steps：
A, sample treatment
It after sample to be tested is diluted with sodium pyrophosphate solution, is applied on glass slide, 35~40 DEG C of 1.5~2h of heat preservation, dehydration,
It air-dries, then lysozyme soln is taken to be applied on glass slide, be incubated 0.5~2h；
B, probe hybridizes
The glass slide that step a is obtained is dehydrated, air-dries, and Coriolis clostridium specific probe solution is added dropwise on glass slide,
40~45 DEG C are protected from light 1.5~2.5h of hybridization, and 0.5~1h is washed in 45~50 DEG C of cleaning buffer solution, dry, using anti-glimmering
Optical quenching agent mounting, -20 DEG C are protected from light storage；
C, fluorescence microscope
Using green light as exciting light, under the microscope, the content of Coriolis clostridium is calculated in fluorescence microscopy.
Wherein, in the above method, before the dilution of sample to be tested described in step a, first use paraformaldehyde solution to collected
Somatic cells are fixed, centrifugation, and after abandoning supernatant, the PBS buffer solution constant volume of pH 7.0~8.0 is added.
Paraformaldehyde can react with the amino of albumen, make protein coagulating, PBS buffer solution can also be to somatic cells
It shields, the present invention can make somatic cells dispersion evenly by aforesaid operations, convenient for counting.
Further, the centrifugation is that 10000r/min centrifuges 5~10min at 4 DEG C.
Wherein, in the above method, the cell concentration after being diluted described in step a is 106~107A cell/mL.
Wherein, in the above method, dehydration described in step a is using 50%, 80% and 96% ethanol solution gradient difference
It is dehydrated 2~3min.
Wherein, in the above method, a concentration of 8~12mg/mL of lysozyme described in step a.
Wherein, in the above method, the Coriolis clostridium specific probe solution described in step b refers to 20~30ng/ μ L
Probe and the hybridization buffer solution that 1 ︰ 9 is mixed by volume；The probe nucleotide sequence such as SEQ ID NO：1
Shown, the hybridization buffer group becomes：Contain 2.42g Tris-HCl, 1.46g EDTA in per L hybridization buffers,
0.1g SDS, 52.65g NaCl, 0.3L formamides, surplus is water.The pH value of the hybridization buffer is 7.2.
Wherein, in the above method, washing described in step b is using cleaning buffer solution, the cleaning buffer solution composition
For：Contain 2.42g Tris-HCl, 2.92g EDTA, 0.1g SDS and 18.02g NaCl, surplus in cleaning buffer solution per L
For water.The pH value of the cleaning buffer solution is 7.2.
Wherein, in the above method, the computational methods in step c are：Each sample is chosen 15 visuals field and is counted, thalline
Content Counting Formula is：
In formula, N:Cell concentration, cells/g or cells/mL；n:Average thalline quantity, cells in each visual field；S1：
Point sample area, μm2；S2：Field area, μm2；V1：Population of samples accumulates, μ L；V2：Point sample volume, μ L；D：Extension rate；m：Sample
Amount, g or mL.
Particularly, the concrete operation step of the above method is：
(1) sample pre-treatments：4% paraformaldehyde bacteria suspension is made in sample to be tested, 4 DEG C is placed in and fixes overnight, 4 DEG C
10000r/min centrifuges 10min, abandons supernatant, by resuspended bacterium solution and 10ml is settled to the PBS buffer solution of pH 7.2, uses
It is 10 that 0.1% sodium pyrophosphate solution, which is diluted to cell concentration,6~107A cell/mL takes 100 μ L bacteria suspensions to be uniformly applied to hole onboard
On slide, 37 DEG C of heat preservation 2h, serial dehydration 3min in 50%, 80% and 96% ethanol solution air-dry, draw the molten of 10mg/mL
100 μ L of bacterium enzyme are applied on orifice plate glass slide, are incubated 1h；
(2) probe hybridizes：The orifice plate glass slide for being coated with lysozyme is sequentially placed into 50%, 80% and 96% ethanol solution
Serial dehydration 3min, natural air drying take 100 μ L probe solutions to be added dropwise on orifice plate glass slide under the conditions of being protected from light；It is wet in 42 DEG C
Box is protected from light hybridization 2h, cleans 30min using 48 DEG C of cleaning buffer solutions, sterile water washing 3 times is protected from light air-dried, and anti-fluorescence is quenched
Go out agent mounting, and -20 DEG C are protected from light storage；
(3) fluorescence microscope
Orifice plate glass slide after mounting is inverted in fluorescence microscope objective table, adjustment green light 534nm~558nm is as sharp
It shines, 100 times of object lens observe slide, and the content of Coriolis clostridium is calculated.
Beneficial effects of the present invention are：The present invention provides a kind of Coriolis clostridium specific probe, which is to be based on 16S
The special probe binding site of the Coriolis clostridium that is found in rRNA sequences and design synthesis.The probe specificity is high, Zhi Nenghe
Coriolis clostridium effectively hybridizes, and measurement result is accurate；The present invention also utilizes fluorescence in situ hybridization technique, provides a kind of utilization spy
The method that needle detects Coriolis clostridium in pit mud.The detection method is simple and quick, as a result easily analysis, and detection range is wide, can be extensive
Applied to soil-like, the detection of Coriolis clostridium, has great importance in water sample and Chinese Luzhou-flavor sample.
Description of the drawings
(Coriolis clostridium (CICC 8022) is aobvious using the specificity of fluorescent in situ hybridization detecting method verification probe KCLZ by Fig. 1
Form under micro mirror)；
Fig. 2 using fluorescent in situ hybridization detecting method verification probe KCLZ specificity (clostridium butyricum (CICC10350),
Form under C.perfringens (CICC22949) microscope)；
Fig. 3 uses the Coriolis clostridium in fluorescent in situ hybridization detecting method detection pit mud sample；
The 16S rRNA gene copy numbers of C.kluyveri and total bacterium in Fig. 4 qPCR standard curves and sample.
Specific implementation mode
In order to accurately detect the content of Coriolis clostridium, the method that the present invention uses fluorescence in situ hybridization designs and synthesizes
A kind of Coriolis clostridium specific probe, the design principle of the probe are：
(1) probe is too long may cause internal error pairing hybridization, so sequence is shorter, specificity is stronger, therefore can
Divide family gene in hybridization time zone.Therefore, in order to ensure specificity, the DNA of probe is avoided to fold and generate stable two level knot
Structure, the probe length that the present invention selects are 15bp~45bp, preferably 20~30bp；
(2) in order to ensure probe is preferentially combined with target fragment in hybridization, make its hybridization under single hybridization conditions
Signal can reflect results of hybridization, and the Tm values of probe of the present invention are 65~70 DEG C；
(3) in order to reduce non-specific hybridization and ensure the specificity of hybridization, the G/C content of probe of the present invention should 40~
The content of 70%, the base C of whole probe will be apparently higher than the content of G, in order to avoid reduce reaction efficiency；
(4) fluorescence is distributed in order under excitation light, hybridize successful somatic cells, enhances hybridization signal, probe 5 ' is held
It is marked by fluorescent dye Cy3.
According to above-mentioned probe design principle, carries out Coriolis clostridium (C.kluyveri) using Primer Premier 6.0 and visit
The design and assessment of needle KCLZ.Microorganism 16S rRNA sequences for probe design derive from ncbi database, pass through MEGA
Sequence is compared in 5.2 softwares, and special and target belongs to interior conservative sequence SEQ ID NO between choosing target category：2 carry out probe
Design transfers to Shanghai Sheng Gong biotech companies to synthesize, the nucleotide sequence such as SEQ ID NO of the probe of synthesis：Shown in 1.
Explanation will be further explained to the specific implementation mode of the present invention by embodiment below, but not indicated that this
The protection domain of invention is limited in range described in embodiment.
1 oligonucleotide probe of embodiment synthesizes
Probe is designed according to the specific sequence of Coriolis clostridium in NCBI, transfers to the synthesis of Shanghai Sheng Gong biotech companies simultaneously
Label.The nucleotides sequence of probe is classified as SEQ ID NO：Shown in 1, and in 5 ' connection cyanine dye fluorescein CY3.
It is dissolved with sterile TE buffer solutions, is configured to concentration 25ng/ μ L, -20 DEG C of storages.The TE buffer solutions are
12.11g/L Tris-HCl(pH 7.5),1.46g/L EDTA。
Embodiment 2 is using the Coriolis clostridium in probe in detecting standard sample of the present invention
1, solution is prepared：
Hybridization buffer：Including：2.42g/L Tris-HCl (pH 7.2), 1.46g/L EDTA, 0.01 (w/v) %
SDS, 52.65g/L NaCl, 30 (v/v) % formamides.
Clean buffer solution：Including：2.42g/L Tris-HCl (pH 7.2), 2.92g/L EDTA, 0.01 (w/v) %
SDS, 18.02g/L NaCl.
Positive reference substance：Coriolis clostridium type strain (CICC 8022), 5mL 1 × 106Cfu/mL culture solutions.
Negative controls：Clostridium butyricum type strain (CICC10350), C.perfringens (CICC22949), difference 5mL
1×106Cfu/mL culture solutions.
2, sample treatment
5mL reference culture culture solutions to be measured are drawn in 50mL centrifuge tubes with pipettor, and addition 20mL PBS buffer solutions are mixed
Even, thalline were collected by centrifugation by 4 DEG C of 12000r/min.4% paraformaldehyde bacteria suspension is made, is placed in 4 DEG C of fixed overnight, 4 DEG C of 10000r/
Min centrifuges 10min, abandons supernatant, PBS buffer solution (pH 7.2) constant volume resuspended bacterium solution to 10ml, with 0.1% sodium pyrophosphate solution
Gradient dilution is to appropriate cell concentration (106~107Cells/mL), 100 μ L bacteria suspensions is taken uniformly to be applied on orifice plate glass slide, 37
DEG C heat preservation 2h.50%, serial dehydration 3min in 80% and 96% ethanol solution is air-dried.Draw 100 μ L (10mg/mL) lysozymes
It is applied on orifice plate glass slide, is incubated 1h.
3, probe hybridizes
The orifice plate slide for being coated with lysozyme is sequentially placed into serial dehydration 3min in 50%, 80% and 96% ethanol solution,
Natural air drying.Under the conditions of being protected from light, taking the probe solution of 100 μ L, (probe and hybridization buffer prepared by embodiment 1 is by volume
Than being formulated for 1 ︰ 9) it is added dropwise on orifice plate glass slide.It is placed in 42 DEG C of wet box and is protected from light hybridization 2h, be placed on the clear of preheating later
It washes 48 DEG C of cleaning 30min of buffer solution and washes away non-hybridized probe, sterile water washing 3 times is protected from light air-dried, anti-fluorescence quenching envelope
Piece, -20 DEG C are protected from light storage；
4, fluorescence microscope
Orifice plate glass slide after mounting is inverted in fluorescence microscope objective table, adjusts green light (534nm~558nm) conduct
Exciting light, 100 times of object lens observe slide.(the result is shown in Figure 1, Fig. 2)
From experimental result：Probe KCLZ shows that probe KCLZ and Coriolis clostridium are miscellaneous with each quasi-microorganism results of hybridization
Thalline brightness is big in intersection graph piece, and cell shape is apparent, and cell distribution is uniform, and background fluorescence is weak, the unspecific staining with impurity
It is smaller.Probe KCLZ is shown with the picture that hybridizes of clostridium butyricum, C.perfringens, almost without this several quasi-microorganism is detected
Fluorescence signal, only detect the lower background fluorescence of brightness, and clearly microbial cell is detected basic amorphism.
The result shows that probe KCLZ can well hybridize with Coriolis clostridium (C.kluyveri) 16S rRNA, without with
Common several classes other microbial cells hybridization in white wine pit.Visual probe KCLZ has good hybridization specificity.
Embodiment 3 is using the Coriolis clostridium in probe in detecting of the present invention wine brewing pit mud
1, solution is prepared with embodiment 2.
2, sample treatment
1g pit muds are weighed, the sterile PBS buffer solutions of 25mL are added, vortex mixing mixes well rear 800r/min centrifugations, receives
Collect supernatant.It is repeated 3 times washing and precipitates and merge supernatant, 4 DEG C of 12000r/min abandon supernatant, collect thalline.It is made 4%
Paraformaldehyde bacteria suspension is placed in 4 DEG C and fixes overnight, and 4 DEG C of 10000r/min centrifuge 10min, abandon supernatant, PBS buffer solution (pH
7.2) constant volume resuspended bacterium solution, with 0.1% sodium pyrophosphate solution gradient dilution to appropriate cell concentration (106~107cells/mL),
100 μ L bacteria suspensions are taken uniformly to be applied on orifice plate glass slide, 37 DEG C of heat preservation 2h.50%, gradient is de- in 80% and 96% ethanol solution
Water 3min is air-dried.It draws 100 μ L (10mg/mL) lysozymes to be applied on orifice plate glass slide, is incubated 1h.
3, probe hybridizes
The orifice plate slide for being coated with lysozyme is sequentially placed into serial dehydration 3min in 50%, 80% and 96% ethanol solution,
Natural air drying.Under the conditions of being protected from light, take 100 μ L KCLZ probe solutions (embodiment 1 prepare probe pressed with hybridization buffer
Volume ratio is that 1 ︰ 9 is formulated) it is added dropwise on orifice plate glass slide, in addition take 100 μ L EUB338 probe solution (nucleotide sequences
For SEQ ID NO：3 probe and the hybridization buffer solution that 1 ︰ 9 is configured to by volume) it is added dropwise to the onboard glass in other hole
On piece.It is respectively placed in 42 DEG C of wet box and is protected from light hybridization 2h, the 48 DEG C of cleaning 30min of cleaning buffer solution for being placed on preheating later are washed away
Non-hybridized probe, sterile water washing 3 times is protected from light air-dried, and anti-fluorescence quenching mounting, -20 DEG C are protected from light storage.
SEQ ID NO：The nucleotide sequence of 3 probe EUB338
5’-3’：gctgcctcccgtaggagt.
4, fluorescence microscope
Orifice plate glass slide after mounting is inverted in fluorescence microscope objective table, adjusts green light (534nm~558nm) conduct
Exciting light, 100 times of object lens observe slide.(result is shown in Fig. 3)
5, it is detected to going out the poor unstrained spirits in cellar for storing things and entering the poor unstrained spirits sample in cellar for storing things, repeats step 1~4, obtained out cellar for storing things grain unstrained spirits and enter cellar for storing things grain
Total bacterium in unstrained spirits and Coriolis Clostridium content, as a result as shown in table 1 below.
Table 1 detects total bacterium and Coriolis Clostridium content table using present invention side's KCLZ methods
| Probe | Pit mud (× 107cells/g) | Go out cellar for storing things grain unstrained spirits (× 107cells/g) | Enter cellar for storing things grain unstrained spirits (× 107cells/g) |
| KCLZ | 87±10 | 0.19±0.02 | 0.10±0.02 |
| EUB338 | 181±41 | 0.53±0.03 | 0.74±0.07 |
Comparative example 4 detects total bacterium and Coriolis Clostridium content using Q-PCR methods
Using specific primer CloKly1F (the SEQ ID NO based on C.kluyveri 16S rRNA genetic fragments：4)、
CloKly1R(SEQ ID NO：And bacterial universal primers 357F (SEQ ID NO 5)：6)、517R(SEQ ID NO：7) to pit
C.kluyveri and the 16S rRNA gene copy numbers of total bacterium carry out quantitative analysis in pit mud and poor unstrained spirits sample.
SEQ ID NO：The nucleotide sequence of 4 primer CloKly1F
5’-gaggagcaaatctcaaaaactgc-3’。
SEQ ID NO：The nucleotide sequence of 5 primer CloKly1R
5’-cctccttggttagactacggactt-3’。
SEQ ID NO：The nucleotide sequence of 6 bacterial universal primers 357F
5’-ctacgggaggcagcag-3’。
SEQ ID NO：The nucleotide sequence of 7 bacterial universal primers 517R
5’-attaccgcggctgctgg-3’。
Concrete operations are as follows：
DNA in pit mud and poor unstrained spirits sample is extracted, primer pair 27F (SEQ ID NO are used：8)/1492R(SEQ
ID NO：9) bacterium overall length 16S rRNA in sample are expanded；PCR product after amplification is connected to carrier pMD18-T
On vevtor, then it is cloned into E.coli competent cells and cultivates；It is extracted in a small amount using SK8191 SanPrep pillars Plasmid DNA
Kit extracts Plasmid DNA；The plasmid built measures OD after sequencing is errorless with ultraviolet specrophotometer260Value, pass through public affairs
Formula is converted into copy number (copies/ μ L)；Each plasmid (+10 μ L plasmids of 90 μ L dilutions) that 10 times of gradient dilutions are built, one
As do 4~6 points, suitable standard items are chosen for manufacturing standard curve by preliminary experiment；Using primer pair 357F/517R and
CloKly1F/CloKly1R respectively expands the 16S rRNA of total bacterium and C.kluyveri；Choose suitable luminescence threshold
Value, the recurring number (Ct) to reach fluorescence threshold do standard curve, each for ordinate by abscissa of the logarithm of template concentrations
Concentration do three it is parallel；Under identical amplification condition, to dilute the sample DNA after 10 times as template, primer pair 357F/ is used
517R and CloKly1F/CloKly1R respectively expands the 16S rRNA of total bacterium and C.kluyveri, measures and reaches glimmering
Ct values when photo threshold, the copy number of target gene in each sample is calculated by standard curve.
SEQ ID NO：The nucleotide sequence of 8 27F
5’-agagtttgatcctggctcag-3’。
SEQ ID NO：The nucleotide sequence of 9 1492R
5’-ggctaccttgttacgactt-3’。
The results are shown in Figure 4.
Q-PCR experiments accuracy depends primarily on the linear and amplification efficiency of standard curve, C.kluyveri and all thin
Bacterium 16S rRNA gene magnification efficiency is respectively 93.975% and 96.553%, and the R of its standard curve2Respectively 0.998 He
0.997, illustrate that Q-PCR results have good accuracy in this research.Q-PCR quantitative results show bacterium total in pit mud
16S rRNA gene copy numbers (2.87 × 108Copies/g) it is higher than poor unstrained spirits sample, and enters the poor unstrained spirits bacterial 16 S rRNA genes in cellar for storing things
Copy number (1.37 × 108Copies/g) it is higher than cellar for storing things grain unstrained spirits (6.31 × 107Copies/g), similarly, in pit mud
C.kluyveri 16S rRNA gene copy numbers (8.16 × 106Copies/g) it is higher than cellar for storing things grain unstrained spirits (7.88 × 104copies/
G) it is higher than into cellar for storing things grain unstrained spirits (1.52 × 104copies/g).These results have proved the correct of the testing result based on FISH technology
Property.
Sequence table
<110>Sichuan University
<120>Coriolis clostridium specific probe and application thereof
<130>A180201K (sequence)
<141> 2018-04-03
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 35
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
cctgcacacc ctttacgccc agtaattccg gacaa 35
<210> 2
<211> 64
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
tatcgacccc ccctgtgccg cagtaaacac aataagtact ccgcctggga agtacgatcg 60
caag 64
<210> 3
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
gctgcctccc gtaggagt 18
<210> 4
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
gaggagcaaa tctcaaaaac tgc 23
<210> 5
<211> 24
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
cctccttggt tagactacgg actt 24
<210> 6
<211> 16
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
ctacgggagg cagcag 16
<210> 7
<211> 17
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
attaccgcgg ctgctgg 17
<210> 8
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
agagtttgat cctggctcag 20
<210> 9
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
ggctaccttg ttacgactt 19
Claims (10)
1. Coriolis clostridium specific probe, which is characterized in that nucleotide sequence such as SEQ ID NO：Shown in 1.
2. Coriolis clostridium specific probe according to claim 1, it is characterised in that：It is also associated with flower at 5 ' ends of probe
Green dye fluorescence element CY3.
3. the preparation method of Coriolis clostridium specific probe as claimed in claim 1 or 2, which is characterized in that include the following steps：
The full length sequence in the 16S rRNA of all microorganisms of Clostridiaceae in ncbi database is downloaded, and carries out 16S rRNA comparisons, is looked for
Go out kind of interior conservative, the special segment oligonucleotide sequence SEQ ID NO of inter-species：2, according to SEQ ID NO：2 are designed synthesis.
4. purposes of the Coriolis clostridium specific probe as claimed in claim 1 or 2 in detecting Coriolis Clostridium content.
5. purposes according to claim 4, it is characterised in that：The Coriolis clostridium is the Coriolis clostridium in making wine pit mud.
6. using the method for Coriolis clostridium in Coriolis clostridium specific probe as claimed in claim 1 or 2 detection wine brewing pit mud, packet
Include following steps：
A, sample treatment
It after sample to be tested is diluted with sodium pyrophosphate solution, is applied on glass slide, 35~40 DEG C of 1.5~2h of heat preservation, dehydration, wind
It is dry, then lysozyme soln is taken to be applied on glass slide, it is incubated 0.5~2h；
B, probe hybridizes
The glass slide that step a is obtained is dehydrated, air-dries, and Coriolis clostridium specific probe solution is added dropwise on glass slide, 40~
45 DEG C are protected from light 1.5~2.5h of hybridization, and 0.5~1h is washed in the cleaning buffer solution for being preheated to 45~50 DEG C in advance, dry, adopt
With anti-fluorescence quenching mounting, -20 DEG C are protected from light storage；
C, fluorescence microscope
Using green light as exciting light, under the microscope, the content of Coriolis clostridium is calculated in fluorescence microscopy.
7. according to the method described in claim 6, it is characterized in that：Before the dilution of sample to be tested described in step a, poly is first used
Collected somatic cells are fixed in formalin, centrifugation, and after abandoning supernatant, the PBS buffer solution that pH 7.0~8.0 is added is fixed
Hold.
8. according to the method described in claim 6, it is characterized in that：Cell concentration after being diluted described in step a is 106~107
A cell/mL.
9. according to the method described in claim 6, it is characterized in that：Coriolis clostridium specific probe solution described in step b
Refer to the probe and the hybridization buffer solution that 1 ︰ 9 is mixed by volume of 20~30ng/ μ L；The hybridization buffer
Group becomes：Contain 2.42g Tris-HCl, 1.46g EDTA, 0.1g SDS, 52.65g NaCl in per L hybridization buffers,
0.3L formamides, surplus are water.
10. according to the method described in claim 6, it is characterized in that：Washing described in step b is using cleaning buffer solution, institute
Stating cleaning buffer solution group becomes：Contain 2.42g Tris-HCl, 2.92g EDTA, 0.1g SDS in cleaning buffer solution per L
With 18.02g NaCl, surplus is water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810288852.3A CN108517366A (en) | 2018-04-03 | 2018-04-03 | Coriolis clostridium specific probe and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810288852.3A CN108517366A (en) | 2018-04-03 | 2018-04-03 | Coriolis clostridium specific probe and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108517366A true CN108517366A (en) | 2018-09-11 |
Family
ID=63431735
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810288852.3A Pending CN108517366A (en) | 2018-04-03 | 2018-04-03 | Coriolis clostridium specific probe and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108517366A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102517392A (en) * | 2011-12-26 | 2012-06-27 | 深圳华大基因研究院 | Metagenome 16S hypervariable region V3 based classification method and device thereof |
| CN103382499A (en) * | 2012-05-04 | 2013-11-06 | 长庚医疗财团法人林口长庚纪念医院 | Specimen pretreatment method for reducing autofluorescence interference in fluorescence in situ hybridization method and reagent kit thereof |
| CN104404130A (en) * | 2014-05-13 | 2015-03-11 | 广州金域医学检验中心有限公司 | Fluorescence in situ hybridization detection method of Legionella longbeachae |
-
2018
- 2018-04-03 CN CN201810288852.3A patent/CN108517366A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102517392A (en) * | 2011-12-26 | 2012-06-27 | 深圳华大基因研究院 | Metagenome 16S hypervariable region V3 based classification method and device thereof |
| CN103382499A (en) * | 2012-05-04 | 2013-11-06 | 长庚医疗财团法人林口长庚纪念医院 | Specimen pretreatment method for reducing autofluorescence interference in fluorescence in situ hybridization method and reagent kit thereof |
| CN104404130A (en) * | 2014-05-13 | 2015-03-11 | 广州金域医学检验中心有限公司 | Fluorescence in situ hybridization detection method of Legionella longbeachae |
Non-Patent Citations (3)
| Title |
|---|
| HU, XIAO-LONG ET AL.: "Identification and quantification of the caproic acid-producing bacterium Clostridium kluyveri in the fermentation of pit mud used for Chinese strong-aroma type liquor production", 《INTERNATIONAL JOURNAL OF FOOD MICROBIOLOGY》 * |
| 易境: "猪场废弃物堆肥中芽孢杆菌属和梭菌属细菌的分子生态学研究", 《中国博士学位论文全文数据库 农业科技辑》 * |
| 胡晓龙: "浓香型白酒窖泥中梭菌群落多样性与窖泥质量关联性研究", 《中国博士学位论文全文数据库 工程科技Ⅰ辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5407797A (en) | Oligonucleotide probes and methods for detecting by hybridization the nucleic acids of bacteria and other living organisms | |
| JP2008118912A (en) | Probe, probe set, probe-immobilized carrier and method for testing gene | |
| JP2008118911A (en) | Probe, probe set, probe-immobilized carrier, and genetic testing method | |
| JP2008118906A (en) | Probe, probe set, probe-immobilized carrier and method for testing gene | |
| Amann et al. | Identification and in situ detection of individual bacterial cells | |
| CN105385691B (en) | For detecting the aptamer and detection kit of people's height transfer colon cancer cell line LoVo | |
| CN110643611B (en) | Aptamer, construction method thereof and application thereof in detection of grouper iridovirus | |
| CN111073891B (en) | Aptamer for detecting grouper iridovirus as well as construction method and application thereof | |
| CN108753789B (en) | Screening method of aptamer and aptamer specifically binding to pseudomonas aeruginosa | |
| CN104059975A (en) | Providencia O3, O4, O8, O12, O13 and O20 specific nucleotides and application thereof | |
| CN108504755A (en) | Clostridium microorganism belonging to genus specific probe and application thereof | |
| WO2005078086A1 (en) | Method of detecting and identifying lactic acid bacterium | |
| CN112210614A (en) | Real-time fluorescent quantitative LAMP (Loop-mediated isothermal amplification) primer group for detecting purple sisal leaf roll disease phytoplasma and application thereof | |
| CN108517366A (en) | Coriolis clostridium specific probe and application thereof | |
| CN103993090A (en) | Specific nucleotides for providencia O31, O41, O42, O43 and O50 and application of specific nucleotides | |
| CN114134239B (en) | Kit for rapidly evaluating quality of mammalian cells by PCR method and detection method thereof | |
| CN113249506B (en) | Gene chip probe group for detecting Edwardsiella tarda | |
| CN108004334B (en) | Quadruple fluorescent PCR primer group, probe group, kit and method for detecting four pathogenic bacteria in drinking water | |
| CN111118014B (en) | Anti-iridovirus aptamer and construction method and application thereof | |
| CN1814788A (en) | Waters frequent food born pathogenic hacteria multiple PCR rapid detecting kit and its detecting method | |
| JP2004097133A (en) | Oligonucleotide, primer and probe specific to bacterium of genus bacillus and method for quantifying bacterium of genus bacillus | |
| CN108949901A (en) | The enzymatic cleavage methods of methane capsule bacterium in a kind of Rapid identification pit mud | |
| CN113444826B (en) | Primer, probe and kit for identifying micrococcus based on isothermal amplification technology and application of primer, probe and kit | |
| Ohshima et al. | Detection method of food-borne pathogens in seafood | |
| US20020086313A1 (en) | Application of bioinformatics for direct study of unculturable microorganisms |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180911 |