CN108517354A - primer composition for multiplex PCR - Google Patents
primer composition for multiplex PCR Download PDFInfo
- Publication number
- CN108517354A CN108517354A CN201710114770.2A CN201710114770A CN108517354A CN 108517354 A CN108517354 A CN 108517354A CN 201710114770 A CN201710114770 A CN 201710114770A CN 108517354 A CN108517354 A CN 108517354A
- Authority
- CN
- China
- Prior art keywords
- primer
- sequence
- pcr
- hairpin structure
- sequencing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Abstract
The present invention relates to a kind of Primer composition for multiplex PCR, which is made of the above primer pair of a pair, wherein each primer includes the specific primer sequence of the sequence and 3 ' ends of the formation hairpin structure at 5 ' ends.The invention further relates to a kind of Multiplex PCRs, including above-mentioned Primer composition is used to carry out multiplexed PCR amplification to DNA sample, wherein using with the exo-acting archaeal dna polymerase of double-strand 5 ' 3 ' in PCR.Primer composition using the present invention for multiplex PCR is expanded, it is possible to prevente effectively from the formation of primer dimer, reduces nonspecific amplification.Therefore, it is possible to simultaneously using up to up to a hundred or even thousands of pairs of primer pair in PCR amplification, and the band of specific amplification is obtained, and coverage rate is expanded for example up to 98% or more, amplification homogeneity for example reaches 95% or more.
Description
Technical field
The present invention relates to a kind of Primer composition for multiplex PCR, the sequencings of the targeting comprising the Primer composition with drawing
Compositions and the method for using both Primer compositions to carry out multiplexed PCR amplification and targeting sequencing respectively.
Background technology
Target sequence capture sequencing is a kind of technology being sequenced for known specific gene group region.Using mesh
Mark sequence capturing sequencing, such as the capture sequencing of exon group so that research emphasis can be placed on human genome by researcher
Important component on.To, at the same time under cost, can study more samples, and sample size is hair
The key index of existing Disease-causing gene, sample size is more, and the possibility for navigating to disease related gene is bigger.
For some rare variations or the gene mutation of part body cell, targeting sequencing is a kind of relatively effective work
Tool.For example, the mutation of DMD genes is to cause the reason of Du Shi progressive muscular dystrophy disease, the discussion for the disease, very
It is suitble to using targeting sequencing.
In addition, for some genetic diseases, it is closely similar with other diseases in phenotype, it may be possible to by being currently known
Caused by one kind in genetic mutation.Research for this kind of disease, can may relevant variable region and together,
Target sequence is sequenced.
Target sequence capture sequencing can be divided into two ways.One is the captures of the PCR target sequences of target fragment.It is another
It kind is then developed by nucleic acid molecules base complementrity principle, according to the probe of target gene group sequence design complete complementary therewith,
So that the genomic DNA interrupted is hybridized with probe, to directly build library with the DNA fragmentation of capture, carries out DNA sequencing.
In above-mentioned target sequence capture sequencing mode, skill is encountered using the target sequence capture technique of multiplex PCR
Art bottleneck.Currently, the multiplex PCR in the technology is generally only capable of accomplishing to expand primer using a few to tens of, for more
Amplification to primer, is difficult to realize preferable effect, and many segments cannot be sufficiently amplified.To find out its cause, essentially consist in, when drawing
Object logarithm more to a certain degree when, interfering with each other between PCR primer and non-specific amplification steeply rises, and then can amplify
Very more non-target area band, leads to not effectively expand and analyze target fragment.
Invention content
In view of above-mentioned condition in the prior art, the invention is intended to provide one kind can effectively promote multiplexed PCR amplification
The Primer composition of effect, the targeting sequencing primer composition comprising the Primer composition and respectively use both combination
The method that object carries out multiplex PCR and targeting sequencing.
On the one hand, the present invention relates to a kind of Primer composition for multiplex PCR, the Primer composition is by more than a pair drawing
Object is to composition, wherein each primer includes the specific primer sequence of the sequence and 3 ' ends of formation hair clip (hairpin) structure at 5 ' ends
Row.
In one embodiment, the spy of the sequence of formation hair clip (hairpin) structure that each primer is held by 5 ' and 3 ' ends
Specific primer Sequence composition.
In one embodiment, each primer pair includes forward primer and reverse primer, and hair clip knot is formed in forward primer
The sequence of structure is different from forming the sequence of hairpin structure in reverse primer.
In one embodiment, in Primer composition, the sequence all same of hairpin structure is formed in each forward primer,
The sequence all same of hairpin structure is formed in each reverse primer.
In one embodiment, the hairpin structure formed in each primer includes basic complementary or complete complementary 15-25
To base-pair, and it include the inflection area formed by 1-6 nucleotide.
In one embodiment, the G/C content of the sequence of hairpin structure is formed in each primer between 40-70%.
In one embodiment, the sequence such as SEQ ID NO of hairpin structure are formed in forward primer:Shown in 1, reversely draw
The sequence such as SEQ ID NO of hairpin structure are formed in object:Shown in 2, SEQ ID NO:1 is GATCGT
CGGACTGTAGAACTCTGCAGAGTTCTACAGTCCGACGATC, SEQ ID NO:2 are
TGGAATTCTCGGGTGCCAAGGAACGTTCCT TGGCACCCGAGAATTCCA。
In another embodiment, the sequence such as SEQ ID NO of hairpin structure are formed in forward primer:Shown in 5, reversely
The sequence such as SEQ ID NO of hairpin structure are formed in primer:Shown in 6, SEQ ID NO:5 are
GcggtcgagcgtggcCAGTGCgccacgctcgaccgc, SEQ ID NO:6 are
gccgtggcacccgagTTCTCGctcgggtgccacggc。
On the other hand, the present invention provides a kind of Primer composition for target sequencing, including above-mentioned is used for multiplex PCR
Primer composition and a pair of of universal sequencing primer object pair, the universal sequencing primer object is to including that sequencing forward primer and sequencing are reversely drawn
Object.
In one embodiment, 3 ' terminal sequences in forward primer and the above-mentioned forward primer for multiplex PCR is sequenced
Middle 3 ' the terminal sequences for forming hairpin structure are identical or essentially identical, and 3 ' terminal sequences being sequenced in reverse primer with above-mentioned for more
3 ' the terminal sequences that hairpin structure is formed in the reverse primer of weight PCR are identical or essentially identical.In one embodiment, it is sequenced just
The part identical or essentially identical with 3 ' terminal sequences of formation hairpin structure in multiplex PCR forward primer to 3 ' terminal sequences of primer
More than 15 bases, 3 ' terminal sequences of reverse primer are sequenced and form 3 ' end sequences of hairpin structure in multiplex PCR reverse primer
It is 15 bases or more to arrange identical or essentially identical part.
In one embodiment, as the sequence such as SEQ ID NO for forming hairpin structure in forward primer:Shown in 1, reversely
The sequence such as SEQ ID NO of hairpin structure are formed in primer:When shown in 2, sequencing forward primer can be such as SEQ ID NO:3 institutes
Show, sequencing reverse primer can be such as SEQ ID NO:Shown in 4, SEQ ID NO:3 are
AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC, SEQ ID NO:4 are
CAAGCAGAAGACGGCATACGAGATGCATTGGCGTGACTGGAGTTCC TTGGCACCCGAGAATTCCA。
In one embodiment, as the sequence such as SEQ ID NO for forming hairpin structure in forward primer:Shown in 5, reversely
The sequence such as SEQ ID NO of hairpin structure are formed in primer:When shown in 6, sequencing forward primer can be such as SEQ ID NO:7 institutes
Show, sequencing reverse primer can be such as SEQ ID NO:Shown in 8, SEQ ID NO:7 are
AATGATACGGCGACCACCGAGATCTACACgccacgctcgaccgc, SEQ ID NO:8 are
CAAGCAGAAGACGGCATACGAGATGCATTGctcgggtgccacggc。
On the other hand, the present invention relates to a kind of Multiplex PCRs comprising above-mentioned multiple PCR primer composition is used, it is right
DNA sample is expanded.
In one embodiment, when carrying out multiplexed PCR amplification, using poly- with the exo-acting DNA of double-strand 5 ' -3 '
Synthase.In one embodiment, it is Taq archaeal dna polymerases with the exo-acting archaeal dna polymerase of double-strand 5 ' -3 '.
In another aspect, the present invention relates to a kind of method of targeting sequencing, include the following steps：
(1) above-mentioned multiple PCR primer composition is used, multiplexed PCR amplification is carried out to DNA sample；
(2) above-mentioned universal sequencing primer object is used, multiplex PCR amplification product is expanded；
(3) pcr amplification product obtained to step (2) is sequenced.
In one embodiment, using with the exo-acting DNA polymerizations of double-strand 5 ' -3 ' in the PCR of step (1)
Enzyme.
In one embodiment, this method further includes being carried out to the PCR product obtained after step (1) and/or (2)
Purifying.In one embodiment, DNA purifying is carried out using magnetic bead.In one embodiment, magnetic bead is AMPure XP
Beads。
In one embodiment, DNA sample can be extracted from blood, saliva or buccal swab.
In the present invention, inventor uses forms the primer of hairpin structure at 5 ' ends, and multiplex PCR expansion is carried out to DNA sample
Increase, it is possible to prevente effectively from the formation of primer dimer, reduces nonspecific amplification.Therefore, it is possible to use simultaneously up to up to a hundred
Even thousands of pairs of primer pair carries out multiplexed PCR amplification, obtains the band of specific amplification, amplification coverage rate up to 98% or more,
Homogeneity is expanded up to 95% or more.In addition, being used to form the 3 ' of hairpin structure by designing in 3 ' terminal sequences and multiple PCR primer
The identical or essentially identical universal sequencing primer object pair of terminal sequence, can directly carry out PCR on the product of multi-PRC reaction, with
PCR product is set to be adapted to be sequenced in next step.Accordingly, due to it is not necessary that multi-PRC reaction product is connected plasmid to be sequenced
Amplification, can lose in detection process to avoid low-copy amplified band, further increase amplification coverage rate.
Description of the drawings
Fig. 1 shows the structural schematic diagram of the primer pair for multiplex PCR according to embodiment of the present invention；
Fig. 2 shows the principle schematics for using the multiple PCR primer composition of the present invention to carry out multiplexed PCR amplification；
Fig. 3 shows the electrophoresis detection figure of embodiment 1；
Fig. 4 shows the electrophoresis detection figure of comparative example 1；
Fig. 5 shows the electrophoresis detection figure of embodiment 2；
Fig. 6 shows the electrophoresis detection figure of comparative example 2；And
Fig. 7 shows the electrophoresis detection figure of embodiment 3.
Specific implementation mode
In the present invention, it is made of the above primer pair of a pair for the Primer composition of multiplex PCR, wherein each primer includes
The specific primer sequence of the sequence and 3 ' ends of the formation hairpin structure at 5 ' ends.
When carrying out multiplex PCR using traditional primer pair without hairpin structure, there may be more in reaction system
Primer dimer, and generate more non-specific amplification.Especially when primer logarithm rises, conventional primer is possibly can not
Specifically amplify target stripe.These problems can be through the invention multiple PCR primer composition and solve.
The primer of the present invention forms hairpin structure at 5 ' ends by the base sequence of self-complementary, as shown in Figure 1.Due to the hair
The presence of clamping structure interferes with each other reduction between primer, so as to reduce the generation of primer dimer, and reduces non-specific
The generation of amplification.It is verified through inventor, it, can be simultaneously using up to a hundred or even thousands of to drawing by designing hairpin structure in primer
Object to carry out multiplexed PCR amplification, and achieve the effect that it is fairly good, such as amplification coverage rate (to covering for the target area to be expanded
Lid) 98% or more can be reached, amplification homogeneity (the distribution proportion homogeneity of i.e. each length amplified fragments) can reach 95%
More than.
Hairpin structure in primer of the present invention can change during PCR, as shown in Figure 2.Specifically, in this hair
In bright multiplex PCR, using with the exo-acting archaeal dna polymerase of double-strand 5 ' -3 ', especially Taq archaeal dna polymerases.It is annealing
Afterwards, the hairpin structure of primer is formed.Archaeal dna polymerase cuts hairpin structure, to make 5 ' in hair clip complementary strand chain is held to fall.Hair
The disappearance of clamping structure so that amplification can extend in primer 3 ' ends of the sequence for forming hairpin structure.In this way, multiplex PCR
Amplified production easily can carry out following amplification with universal sequencing primer object, to be sequenced.
As described above, the sequences that form hairpin structures and 3 ' ends of the multiple PCR primer of the present invention including 5 ' ends is special
Property primer sequence.Can include other a small amount of bases between the hairpin-forming sequences and 3 ' end-specificity primer sequences at 5 ' ends,
So that G/C content, the Tm values etc. of entire primer are more in line with design of primers requirement.In one embodiment, each primer is by 5 ' ends
Formation hairpin structure sequence and 3 ' end specific primer sequence constitute.
In the multiple PCR primer composition of the present invention, the hairpin structure formed in each primer includes basic complementary or complete
Complete complementary 15-25 includes the inflection area formed by 1-6 nucleotide to base-pair.Hair clip is formed at 5 ' ends of primer
Structure is needed in the presence of complementary base-pair.In a preferred embodiment, the base-pair complete complementary of hairpin structure is constituted.
In other embodiment, as long as hairpin structure can be formed, base-pair can be not fully complementary, you can be substantially complementary.
The hairpin structure formed to base-pair by 15-25, size is suitable, can more effectively promote the expanding effect of multiplex PCR.This
Outside, inflection area herein refers to the bending section that sequence is bent to form complementary base pair, can be made of suitable nucleotide.
For forming the sequence of hairpin structure in multiple PCR primer, G/C content is not particularly limited, as long as it is accorded with
Close general design of primers requirement.In one embodiment, the G/C content of the partial sequence is between 40-70%.
In this case, primer forms hairpin structure at 60-70 DEG C.Furthermore it is preferred that not homologous with human genome in the partial sequence
Part, so as to further avoid the generation of non-specific amplification.
In the present invention, the sequence that hairpin structure is formed in forward primer can be different from formation hair clip knot in reverse primer
The sequence of structure.In multiplex PCR, in forward primer formed hairpin structure sequence whether with hair clip is formed in reverse primer
The sequence of structure is identical, is not particularly limited.It is difference by the two sequence designs, is mainly in view of follow-up general sequencing
The design of primer.Forward primer is sequenced and is different from sequencing reverse primer, the amplification of specificity may be more conducive to.
In the multiple PCR primer composition of the present invention, the sequence all same of hairpin structure is formed in each forward primer, respectively
The sequence all same of hairpin structure is formed in reverse primer.In this way, if you need to subsequent sequencing procedures, it can only design and use one
To universal sequencing primer object, further expanded.So, it is possible to reduce workload and cost.Moreover, through so design, it can
Directly to carry out PCR on the product of multi-PRC reaction, so that PCR product is adapted to be sequenced in next step, without will be multiple
PCR reaction products connect plasmid to carry out sequencing amplification, can be lost in detection process to avoid low-copy amplified band, into one
Step improves amplification coverage rate.
The present invention also provides a kind of Primer compositions for targeting sequencing, including the above-mentioned primer sets for multiplex PCR
Object and a pair of of universal sequencing primer object pair are closed, the universal sequencing primer object is to including sequencing forward primer and sequencing reverse primer.
In one embodiment, 3 ' terminal sequences in forward primer and the above-mentioned forward primer for multiplex PCR is sequenced
Middle 3 ' the terminal sequences for forming hairpin structure are identical or essentially identical, and 3 ' terminal sequences being sequenced in reverse primer with above-mentioned for more
3 ' the terminal sequences that hairpin structure is formed in the reverse primer of weight PCR are identical or essentially identical.It is essentially identical in above-mentioned sequence
In the case of, need to ensure that 3 ' ends of universal sequencing primer object are combined with multiplex PCR amplification product after annealing.In an embodiment
In, 3 ' terminal sequences and the formation 3 ' terminal sequences of hairpin structure in multiplex PCR forward primer that forward primer is sequenced are identical or basic
Identical part is 15 bases or more, the 3 ' terminal sequences and formation hair clip knot in multiplex PCR reverse primer that reverse primer is sequenced
The part that 3 ' terminal sequences of structure are identical or essentially identical is 15 bases or more.15 or more bases longs are more advantageous to sequencing
Step is smoothed out.In addition, universal sequencing primer object is also required to meet other conventional primer design requirements, as length, G/C content,
Tm values etc..
On the other hand, the present invention relates to a kind of Multiplex PCRs comprising above-mentioned multiple PCR primer composition is used, it is right
DNA sample is expanded, wherein using with the exo-acting archaeal dna polymerase of double-strand 5 ' -3 ' in PCR.As described above, using
It is to destroy hairpin structure during PCR with this species specific archaeal dna polymerase so that amplification can extend to shape
At 3 ' ends of the sequence of hairpin structure.In one embodiment, it is Taq with the exo-acting archaeal dna polymerase of double-strand 5 ' -3 '
Archaeal dna polymerase, such as2X Master Mix (NEB, M0485L).
In another aspect, the present invention relates to a kind of method of targeting sequencing, include the following steps：
(1) above-mentioned multiple PCR primer composition is used, multiplexed PCR amplification is carried out to DNA sample, wherein being adopted in PCR
With with the exo-acting archaeal dna polymerase of double-strand 5 ' -3 '；
(2) above-mentioned universal sequencing primer object is used, multiplex PCR amplification product is expanded；
(3) pcr amplification product obtained to step (2) is sequenced.
In step (1), according to actual conditions or it can need to use suitable reaction system and PCR instrument parameter setting.
In one example, multi-PRC reaction system below may be used：Thermal starting archaeal dna polymerase is (preferably2X
Master Mix (NEB, M0485L)) 15 μ l, 8 μ l of primer pair mixture (50-200nM, preferably 100nM), genomic DNA and go
7 μ l of ionized water, in total 30 μ l.In one example, the amplification program setting of PCR instrument is as follows：95℃3min；95 DEG C of 15s, 60 DEG C
4min, 15-22 cycles.
In step (2), any suitable universal sequencing primer object pair can be used, and can be according to actual conditions or needs
Using suitable reaction system and PCR instrument parameter setting.In one example, the reactant of PCR amplification is as follows：High fidelity PCR
Mixture (preferably Phusion High-Fidelity PCR mix) 15 μ l, F general (10 μM) 1 μ l, R_index (10 μM) 1 μ
L, 13 μ l of deionized water, in total 30 μ l.It is applied directly in the recovery tube of step (1).In one example, the amplification journey of PCR instrument
Sequence setting is as follows：95℃1min；95 DEG C of 15s, 60 DEG C of 15s, 72 DEG C of 15s, 6 cycles.
This method further includes being purified to the PCR product obtained behind step (1), (2).In an embodiment
In, carry out DNA purifying using magnetic bead.In one embodiment, magnetic bead is AMPure XP Beads.In one example, may be used
To carry out purification process using commercially available Nucleic acid purification kits magnetic bead.Further, Nucleic acid purification kits magnetic bead can be
Beckman AMPure XP Beads。
In one example, 0.5~0.8 times of volume (preferably 0.6 can be added in the PCR reaction solution that step (1) obtains
Times) AMPure XP Beads, mixing, with strong magnets or magnetic frame absorption magnetic bead, (what is adsorbed on magnetic bead at this time is that genome is miscellaneous
Segment), careful supernatant of drawing is managed to new EP, abandons magnetic bead, it is original anti-that 0.5~1.0 times of step (1) is added into new supernatant
The AMPureXP Beads for answering liquid to accumulate, with strong magnets or magnetic frame absorption magnetic bead, (what is adsorbed on magnetic bead at this time is step (1)
Target product), carefully draw supernatant with pipettor, abandon supernatant, stay magnetic bead；100 μ l, 70% percent by volume ethyl alcohol is added
It is evaporated after washing.
In one example, 0.9~1.2 times of volume (preferably 1.0 times) is added in the PCR reaction solution obtained to step (2)
AMPure XP Beads, mixing adsorb magnetic bead with strong magnets or magnetic frame, and careful supernatant of drawing is managed to new EP, uses liquid relief
Device carefully draws supernatant, abandons supernatant, stays magnetic bead；It is evaporated after the washing of 100 μ l, 70% percent by volume ethyl alcohol is added, finally uses
20 μ l deionized waters elute, and obtain eluent (i.e. PCR product).
Below in conjunction with the drawings and specific embodiments, the invention will be further described.
The primer with hairpin structure of 1 a small amount of logarithm of embodiment
Genomic DNA is extracted by blood from healthy volunteer, using Whole Blood Genomic DNA extracts kit, cat:
51185, Qiagen.
The genomic DNA of above-mentioned acquirement is used to the Qubit3.0 quantitative instruments (cat of ThermoFisher:Q33218 it) carries out
It is quantitative.
10 pairs of following primer pairs are mixed into PrimerMix (primer mixture) according to the amount of equal substances.
Table 1：List of primers used in embodiment 1
Experimental procedure：
Multiplexed PCR amplification
Using 0.2ml PCR pipes, reacted according to following system configurations in super-clean bench：Phusion High-Fidelity
PCR mix 15 μ l, PrimerMix (100nM) 8 μ l, 7 μ l of genomic DNA, in total 30 μ l.Genomic DNA input amount 20ng.
Amplification program is arranged：95℃3min；95 DEG C of 15s, 60 DEG C of 4min, 22 cycles.
Product purification
0.6 times of AMPure XP Beads (18 μ l) mixing is added to PCR reaction solution/enzymatic reaction solution, with strong magnets or
Magnetic frame adsorbs magnetic bead, and careful supernatant of drawing manages to new EP, abandons magnetic bead, 0.6 times of original PCR body is added into new supernatant
Long-pending AMPureXP Beads (18 μ l) adsorb magnetic bead with strong magnets or magnetic frame, carefully draw supernatant with pipettor, abandon
Supernatant stays magnetic bead；It is evaporated, is put into recovery tube after the washing of 100 μ l, 70% ethyl alcohol is added.
After operation, dispensing detection.As seen from Figure 3, the multiple PCR primer with hairpin structure can amplify mesh
Band, and without there are apparent primer dimer and other nonspecific amplifications.
The primer without hairpin structure of 1 a small amount of logarithm of comparative example
Genomic DNA is extracted by blood as described in Example 1.
Following 10 pairs of primers are mixed into PrimerMix according to the amount of equal substances.
List of primers used in 2. comparative example 1 of table
Experimental procedure and parameter are the same as embodiment 1.
After operation, dispensing detection.When as seen from Figure 4, using custom primer, it is amplifiable go out purpose band, but
There are apparent primer dimer and other nonspecific amplifications, and these non-destination regions can influence final sequencing analysis.
The primer with hairpin structure of 2 a large amount of logarithms of embodiment
According to described in embodiment 1 sample is extracted from saliva.
The primer pairs (not specifically illustrated) that 300 pairs carry hairpin structure are mixed into PrimerMix according to the amount of equal substances,
Wherein, the sequence such as SEQ ID NO of the formation hairpin structure at 5 ' ends of each forward primer:Shown in 5,5 ' ends of each reverse primer
Form the sequence such as SEQ ID NO of hairpin structure：Shown in 6.
Experimental procedure and parameter are substantially with embodiment 1, except the program setting of multiplexed PCR amplification is as follows：95℃3min；95℃
15s, 60 DEG C of 4min, 18 cycles.
After operation, dispensing detection.As seen from Figure 5, the clamp primers of the present embodiment can amplify very good
Target stripe, and primer dimer region is less.
The primer without hairpin structure of 2 a large amount of logarithms of comparative example
Sample is extracted by saliva according to described in embodiment 1.
300 pairs of custom primers without hairpin structure are mixed into PrimerMix to (not shown) according to the amount of equal substances.
Experimental procedure and parameter are the same as embodiment 2.
After operation, dispensing detection.As seen from Figure 6, when primer pair rises to 300, custom primer cannot
Purpose band is amplified, there is apparent primer dimer.
The primer with hairpin structure of 3 a greater amount of logarithms of embodiment
Sample is extracted by buccal swab according to described in embodiment 1.
738 pairs of primer (not shown) with hairpin structure are mixed into PrimerMix according to the amount of equal substances, wherein it is each just
To the sequence such as SEQ ID NO of the formation hairpin structure at 5 ' ends of primer:Shown in 1, the formation hair clip at 5 ' ends of each reverse primer
The sequence of structure such as SEQ ID NO：Shown in 2.
Such as SEQ ID NO of universal primer used in this example：3 and SEQ ID NO：Shown in 4.
Experimental procedure：
Multiplexed PCR amplification
Using 0.2ml PCR pipes, reacted according to following system configurations in super-clean bench：Phusion High-Fidelity
PCR mix 15 μ l, PrimerMix (100nM) 8 μ l, 7 μ l of genomic DNA, in total 30 μ l.Genomic DNA input amount 20ng.
Amplification program is arranged：95℃3min；95 DEG C of 15s, 60 DEG C of 4min, 15 cycles；
Product purification
0.8 times of AMPure XP Beads (24 μ l) mixing is added to PCR reaction solution/enzymatic reaction solution, with strong magnets or
Magnetic frame adsorbs magnetic bead, and careful supernatant of drawing manages to new EP, abandons magnetic bead, 0.8 times of original PCR body is added into new supernatant
Long-pending AMPureXP Beads (24 μ l) strong magnets or magnetic frame adsorb magnetic bead, carefully draw supernatant with pipettor, abandon
Supernatant stays magnetic bead；It is evaporated, is put into recovery tube after the washing of 100 μ l, 70% ethyl alcohol is added.
Second wheel PCR reactions
Using 0.2ml PCR pipes, reacted according to following system configurations in super-clean bench：Phusion High-Fidelity
General (the SEQ ID NO of 15 μ l, F_ of PCR mix：3) (10uM) 1 μ l, R_index (SEQ ID NO：4) (10uM) 1 μ l, go from
13 μ l of sub- water, 30 μ l, are applied directly in the recovery tube of step in total.
Amplification program:95℃1min；Recycle 95 DEG C of 15s, 60 DEG C of 15s, 72 DEG C of 15s, 6 cycles；
Product purification
0.8 times of AMPure XP Beads (24 μ l) mixing is added in PCR after reaction, is inhaled with strong magnets or magnetic frame
Attached magnetic bead carefully draws supernatant with pipettor, abandons supernatant, stays magnetic bead；It is evaporated after the washing of 100 μ l, 70% ethyl alcohol is added, with 20
μ l deionized water dissolving DNA take 5 μ l dispensings to detect.
As seen from Figure 7, when primer pair rises to 738, the clamp primers of the present embodiment still can very well expand
Increase and purpose band.
The PCR product is sequenced using illumina microarray datasets.Sequencing data passes through bioinformatics software bwa
(BWA, 2009, PMID19451168), sample sequence obtain each target compared with 738 target region standard gene groups of capture
The sequencing depth in region calculates coverage rate and amplification homogeneity.
Table 3：The sequencing statistics of the targeting amplified production of embodiment 3
It can be seen from Table 3 that the product expanded by the method for the invention, coverage rate and homogeneity are all very high, cover
Lid rate is more than 98%, and homogeneity is more than 95%.
Although being illustrated to the present invention above in association with drawings and examples, it will be appreciated that above description
The invention is not limited in any way.Those skilled in the art without departing from the true spirit and scope of the present invention may be used
To deform and change to the present invention as needed, these deformations and variation are within the scope of the present invention.
SEQUENCE LISTING
<110>Shanghai Mao Jin Bioisystech Co., Ltd
<120>Primer composition for multiplex PCR
<130> SE170001-01CN
<160> 48
<170> PatentIn version 3.3
<210> 1
<211> 46
<212> DNA
<213>Artificial sequence
<400> 1
gatcgtcgga ctgtagaact ctgcagagtt ctacagtccg acgatc 46
<210> 2
<211> 48
<212> DNA
<213>Artificial sequence
<400> 2
tggaattctc gggtgccaag gaacgttcct tggcacccga gaattcca 48
<210> 3
<211> 55
<212> DNA
<213>Artificial sequence
<400> 3
aatgatacgg cgaccaccga gatctacacg ttcagagttc tacagtccga cgatc 55
<210> 4
<211> 65
<212> DNA
<213>Artificial sequence
<400> 4
caagcagaag acggcatacg agatgcattg gcgtgactgg agttccttgg cacccgagaa 60
ttcca 65
<210> 5
<211> 36
<212> DNA
<213>Artificial sequence
<400> 5
gcggtcgagc gtggccagtg cgccacgctc gaccgc 36
<210> 6
<211> 36
<212> DNA
<213>Artificial sequence
<400> 6
gccgtggcac ccgagttctc gctcgggtgc cacggc 36
<210> 7
<211> 44
<212> DNA
<213>Artificial sequence
<400> 7
aatgatacgg cgaccaccga gatctacacg ccacgctcga ccgc 44
<210> 8
<211> 45
<212> DNA
<213>Artificial sequence
<400> 8
caagcagaag acggcatacg agatgcattg ctcgggtgcc acggc 45
<210> 9
<211> 76
<212> DNA
<213>Artificial sequence
<400> 9
gatcgtcgga ctgtagaact ctgcagagtt ctacagtccg acgatccaaa aggaaagcat 60
tttctcaaaa tttcct 76
<210> 10
<211> 70
<212> DNA
<213>Artificial sequence
<400> 10
tggaattctc gggtgccaag gaacgttcct tggcacccga gaattccact caaacccaga 60
tccctccaat 70
<210> 11
<211> 68
<212> DNA
<213>Artificial sequence
<400> 11
gatcgtcgga ctgtagaact ctgcagagtt ctacagtccg acgatctgga ggatccagca 60
cttcagta 68
<210> 12
<211> 71
<212> DNA
<213>Artificial sequence
<400> 12
tggaattctc gggtgccaag gaacgttcct tggcacccga gaattccact ccaagggctc 60
cttgtaactt c 71
<210> 13
<211> 75
<212> DNA
<213>Artificial sequence
<400> 13
gatcgtcgga ctgtagaact ctgcagagtt ctacagtccg acgatcacac acacgcacac 60
acattaattt taatt 75
<210> 14
<211> 76
<212> DNA
<213>Artificial sequence
<400> 14
tggaattctc gggtgccaag gaacgttcct tggcacccga gaattccaca caatacaaaa 60
acactgtaac tgtgga 76
<210> 15
<211> 73
<212> DNA
<213>Artificial sequence
<400> 15
gatcgtcgga ctgtagaact ctgcagagtt ctacagtccg acgatccagc ctcttactgc 60
acttcataaa gaa 73
<210> 16
<211> 72
<212> DNA
<213>Artificial sequence
<400> 16
tggaattctc gggtgccaag gaacgttcct tggcacccga gaattccagg gaaacactgt 60
catgtacaca tg 72
<210> 17
<211> 76
<212> DNA
<213>Artificial sequence
<400> 17
gatcgtcgga ctgtagaact ctgcagagtt ctacagtccg acgatcaaat tgtatttctt 60
agtgtgacag gaagga 76
<210> 18
<211> 72
<212> DNA
<213>Artificial sequence
<400> 18
tggaattctc gggtgccaag gaacgttcct tggcacccga gaattccact gactgacatc 60
ttcttggacc aa 72
<210> 19
<211> 72
<212> DNA
<213>Artificial sequence
<400> 19
gatcgtcgga ctgtagaact ctgcagagtt ctacagtccg acgatctata agttcaagcc 60
tgtgttgctc aa 72
<210> 20
<211> 70
<212> DNA
<213>Artificial sequence
<400> 20
tggaattctc gggtgccaag gaacgttcct tggcacccga gaattccacg cagcacaaaa 60
ctcgtttagc 70
<210> 21
<211> 76
<212> DNA
<213>Artificial sequence
<400> 21
gatcgtcgga ctgtagaact ctgcagagtt ctacagtccg acgatcttgg agttttatgt 60
gttgctacat ttgttt 76
<210> 22
<211> 78
<212> DNA
<213>Artificial sequence
<400> 22
tggaattctc gggtgccaag gaacgttcct tggcacccga gaattccata taatttcaag 60
aagcaccagg cccaagtt 78
<210> 23
<211> 70
<212> DNA
<213>Artificial sequence
<400> 23
gatcgtcgga ctgtagaact ctgcagagtt ctacagtccg acgatccatt gatccttcca 60
aaccctctgt 70
<210> 24
<211> 73
<212> DNA
<213>Artificial sequence
<400> 24
tggaattctc gggtgccaag gaacgttcct tggcacccga gaattccacc actgaaagtg 60
atggcaaatt act 73
<210> 25
<211> 72
<212> DNA
<213>Artificial sequence
<400> 25
gatcgtcgga ctgtagaact ctgcagagtt ctacagtccg acgatcggga tgtcccgtct 60
tattaatgaa cc 72
<210> 26
<211> 73
<212> DNA
<213>Artificial sequence
<400> 26
tggaattctc gggtgccaag gaacgttcct tggcacccga gaattccaaa ccttcacatg 60
tacaatgtga gct 73
<210> 27
<211> 76
<212> DNA
<213>Artificial sequence
<400> 27
gatcgtcgga ctgtagaact ctgcagagtt ctacagtccg acgatcttcc cttgtcttgt 60
tattaaagga acaact 76
<210> 28
<211> 75
<212> DNA
<213>Artificial sequence
<400> 28
tggaattctc gggtgccaag gaacgttcct tggcacccga gaattccaca agcttagtac 60
ttaactcact gcctt 75
<210> 29
<211> 53
<212> DNA
<213>Artificial sequence
<400> 29
cagagttcta cagtccgacg atccaaaagg aaagcatttt ctcaaaattt cct 53
<210> 30
<211> 46
<212> DNA
<213>Artificial sequence
<400> 30
gttccttggc acccgagaat tccactcaaa cccagatccc tccaat 46
<210> 31
<211> 45
<212> DNA
<213>Artificial sequence
<400> 31
cagagttcta cagtccgacg atctggagga tccagcactt cagta 45
<210> 32
<211> 47
<212> DNA
<213>Artificial sequence
<400> 32
gttccttggc acccgagaat tccactccaa gggctccttg taacttc 47
<210> 33
<211> 52
<212> DNA
<213>Artificial sequence
<400> 33
cagagttcta cagtccgacg atcacacaca cgcacacaca ttaattttaa tt 52
<210> 34
<211> 52
<212> DNA
<213>Artificial sequence
<400> 34
gttccttggc acccgagaat tccacacaat acaaaaacac tgtaactgtg ga 52
<210> 35
<211> 50
<212> DNA
<213>Artificial sequence
<400> 35
cagagttcta cagtccgacg atccagcctc ttactgcact tcataaagaa 50
<210> 36
<211> 48
<212> DNA
<213>Artificial sequence
<400> 36
gttccttggc acccgagaat tccagggaaa cactgtcatg tacacatg 48
<210> 37
<211> 53
<212> DNA
<213>Artificial sequence
<400> 37
cagagttcta cagtccgacg atcaaattgt atttcttagt gtgacaggaa gga 53
<210> 38
<211> 48
<212> DNA
<213>Artificial sequence
<400> 38
gttccttggc acccgagaat tccactgact gacatcttct tggaccaa 48
<210> 39
<211> 49
<212> DNA
<213>Artificial sequence
<400> 39
cagagttcta cagtccgacg atctataagt tcaagcctgt gttgctcaa 49
<210> 40
<211> 46
<212> DNA
<213>Artificial sequence
<400> 40
gttccttggc acccgagaat tccacgcagc acaaaactcg tttagc 46
<210> 41
<211> 53
<212> DNA
<213>Artificial sequence
<400> 41
cagagttcta cagtccgacg atcttggagt tttatgtgtt gctacatttg ttt 53
<210> 42
<211> 54
<212> DNA
<213>Artificial sequence
<400> 42
gttccttggc acccgagaat tccatataat ttcaagaagc accaggccca agtt 54
<210> 43
<211> 47
<212> DNA
<213>Artificial sequence
<400> 43
cagagttcta cagtccgacg atccattgat ccttccaaac cctctgt 47
<210> 44
<211> 49
<212> DNA
<213>Artificial sequence
<400> 44
gttccttggc acccgagaat tccaccactg aaagtgatgg caaattact 49
<210> 45
<211> 49
<212> DNA
<213>Artificial sequence
<400> 45
cagagttcta cagtccgacg atcgggatgt cccgtcttat taatgaacc 49
<210> 46
<211> 49
<212> DNA
<213>Artificial sequence
<400> 46
gttccttggc acccgagaat tccaaacctt cacatgtaca atgtgagct 49
<210> 47
<211> 53
<212> DNA
<213>Artificial sequence
<400> 47
cagagttcta cagtccgacg atcttccctt gtcttgttat taaaggaaca act 53
<210> 48
<211> 51
<212> DNA
<213>Artificial sequence
<400> 48
gttccttggc acccgagaat tccacaagct tagtacttaa ctcactgcct t 51
Claims (13)
1. a kind of Primer composition for multiplex PCR, the Primer composition is made of the above primer pair of a pair, each primer pair
Including forward primer and reverse primer, draw wherein each primer includes the sequence of the formation hairpin structure at 5 ' ends and the specificity at 3 ' ends
Object sequence.
2. Primer composition as described in claim 1, wherein
The sequence that hairpin structure is formed in forward primer is different from forming the sequence of hairpin structure in reverse primer.
3. Primer composition as described in claim 1, wherein
The sequence all same of hairpin structure is formed in each forward primer, the sequence that hairpin structure is formed in each reverse primer is homogeneous
Together.
4. Primer composition as described in claim 1, wherein
The hairpin structure formed in each primer includes complementary 15-25 to base-pair, and includes time formed by 1-6 nucleotide
Folding area.
5. Primer composition as described in claim 1, wherein
The G/C content that the sequence of hairpin structure is formed in each primer is 40-70%.
6. Primer composition as described in claim 1, wherein
The sequence such as SEQ ID NO of hairpin structure are formed in forward primer:Shown in 1, the sequence of hairpin structure is formed in reverse primer
Row such as SEQ ID NO:Shown in 2.
7. Primer composition as described in claim 1, wherein
The sequence such as SEQ ID NO of hairpin structure are formed in forward primer:Shown in 5, the sequence of hairpin structure is formed in reverse primer
Row such as SEQ ID NO:Shown in 6.
8. being used for multiplex PCR described in a kind of any one of Primer composition, including claim 1-6 for target sequencing
Primer composition and a pair of of universal sequencing primer object pair, wherein the universal sequencing primer object is to including sequencing forward primer and sequencing
Reverse primer.
9. Primer composition as claimed in claim 8, wherein
3 ' terminal sequences in forward primer and 3 ' the terminal sequence phases for forming hairpin structure in the forward primer of multiplex PCR are sequenced
Together, 3 ' terminal sequences in reverse primer and 3 ' the terminal sequence phases for forming hairpin structure in the reverse primer of multiplex PCR are sequenced
Together.
10. a kind of primer for multiplex PCR Multiplex PCR, including described in any one of using claim 1-7 combines
Object expands DNA sample, wherein using with the exo-acting archaeal dna polymerase of double-strand 5 ' -3 ' in PCR.
11. Multiplex PCR as claimed in claim 10, wherein
It is Taq archaeal dna polymerases with the exo-acting archaeal dna polymerase of double-strand 5 ' -3 '.
12. a kind of targeting PCR sequencing PCR, includes the following steps：
(1) Primer composition for multiplex PCR described in any one of claim 1-7 is used, DNA sample is carried out multiple
PCR amplification, wherein using with the exo-acting archaeal dna polymerase of double-strand 5 ' -3 ' in PCR；
(2) using a pair of of universal sequencing primer object, multiplex PCR amplification product is expanded；
(3) pcr amplification product obtained to step (2) is sequenced.
13. targeting PCR sequencing PCR as claimed in claim 12, wherein
3 ' terminal sequences in forward primer are sequenced to including sequencing forward primer and sequencing reverse primer in the universal sequencing primer object
It is identical as 3 ' terminal sequences of hairpin structure are formed in the forward primer for multiplex PCR, 3 ' terminal sequences in reverse primer are sequenced
It is identical as 3 ' terminal sequences of hairpin structure are formed in the reverse primer for multiplex PCR.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710114770.2A CN108517354A (en) | 2017-02-28 | 2017-02-28 | primer composition for multiplex PCR |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710114770.2A CN108517354A (en) | 2017-02-28 | 2017-02-28 | primer composition for multiplex PCR |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108517354A true CN108517354A (en) | 2018-09-11 |
Family
ID=63432684
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710114770.2A Pending CN108517354A (en) | 2017-02-28 | 2017-02-28 | primer composition for multiplex PCR |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108517354A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113811620A (en) * | 2019-06-26 | 2021-12-17 | 深圳华大智造科技股份有限公司 | Preparation method and kit of nested multiplex PCR high-throughput sequencing library |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000071562A1 (en) * | 1999-05-24 | 2000-11-30 | The Public Health Research Institute Of The City Of New York, Inc. | High specificity primers, amplification methods and kits |
| CN105219766A (en) * | 2015-11-10 | 2016-01-06 | 东华大学 | A kind of multiple PCR method of three-wheel amplification |
| CN106282353A (en) * | 2016-08-26 | 2017-01-04 | 上海翼和应用生物技术有限公司 | A kind of method utilizing clamp primers to carry out multiplex PCR |
-
2017
- 2017-02-28 CN CN201710114770.2A patent/CN108517354A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000071562A1 (en) * | 1999-05-24 | 2000-11-30 | The Public Health Research Institute Of The City Of New York, Inc. | High specificity primers, amplification methods and kits |
| CN105219766A (en) * | 2015-11-10 | 2016-01-06 | 东华大学 | A kind of multiple PCR method of three-wheel amplification |
| CN106282353A (en) * | 2016-08-26 | 2017-01-04 | 上海翼和应用生物技术有限公司 | A kind of method utilizing clamp primers to carry out multiplex PCR |
Non-Patent Citations (2)
| Title |
|---|
| ANDERS STAHLBERG等: "Simple, multiplexed, PCR-based barcoding of DNA enables sensitive mutation detection in liquid biopsies using sequencing", 《NUCLEIC ACIDS RESEARCH》 * |
| NAZARENKO I等: "Multiplex quantitative PCR using self-quenched primers labeled with a single fluorophore", 《NUCLEIC ACID RESEARCH》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113811620A (en) * | 2019-06-26 | 2021-12-17 | 深圳华大智造科技股份有限公司 | Preparation method and kit of nested multiplex PCR high-throughput sequencing library |
| CN113811620B (en) * | 2019-06-26 | 2024-04-09 | 深圳华大智造科技股份有限公司 | Preparation method and kit of nested multiple PCR high-throughput sequencing library |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6571895B1 (en) | Nucleic acid probe and genomic fragment detection method | |
| JP5140425B2 (en) | Method for simultaneously amplifying specific nucleic acids | |
| Lee et al. | Analyzing the cancer methylome through targeted bisulfite sequencing | |
| Lee et al. | Improved reduced representation bisulfite sequencing for epigenomic profiling of clinical samples | |
| CN108192956A (en) | It is a kind of based on the DNA determination methods of Cas9 nucleases and its application | |
| JP7202556B2 (en) | Methods and kits for enriching gene target areas | |
| JP5382802B2 (en) | Detection and quantification of biomolecules using mass spectrometry | |
| US20140235464A1 (en) | Detection and quantification of biomolecules using mass spectrometry | |
| CN109536579B (en) | Construction method and application of single-chain sequencing library | |
| US20090325183A1 (en) | Sequencing methods | |
| WO2013064066A1 (en) | Method for constructing methylated high-throughput sequencing library for whole genome and use thereof | |
| CN109576346B (en) | Construction method and application of high-throughput sequencing library | |
| WO2009073251A1 (en) | Detection and quantification of biomolecules using mass spectrometry | |
| CN110760936B (en) | Method for constructing DNA methylation library and application thereof | |
| CN109593757B (en) | Probe and method for enriching target region by using same and applicable to high-throughput sequencing | |
| CN105647907A (en) | Preparation method of modified DNA (deoxyribonucleic acid) hybridization probe for targeted hybrid capture | |
| CN102534004B (en) | Preparation method for probe used for multiplex ligation-dependent probe amplification (MLPA) | |
| CN113088562A (en) | Novel low-initial-quantity DNA methylation library building method | |
| WO2017143866A1 (en) | Kit and method for quantitative detection of dna methylation in rprm genes | |
| WO2018113799A1 (en) | Method and test kit for constructing simplified genomic library | |
| KR101525495B1 (en) | Dumbbell structure oligonucleotide, primer for amplificating nucleic acid having the same and method for amplificating nucleic acid using the same | |
| TW201321520A (en) | Method and system for virus detection | |
| CN112941147A (en) | High-fidelity target gene library building method and kit thereof | |
| CN112662771A (en) | Targeting capture probe of tumor fusion gene and application thereof | |
| CN108517354A (en) | primer composition for multiplex PCR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180911 |