CN108486280A - A kind of PCR primer for the short beak runting syndrome goose parvovirus of 5`-UTR genetic tests - Google Patents
A kind of PCR primer for the short beak runting syndrome goose parvovirus of 5`-UTR genetic tests Download PDFInfo
- Publication number
- CN108486280A CN108486280A CN201810183223.4A CN201810183223A CN108486280A CN 108486280 A CN108486280 A CN 108486280A CN 201810183223 A CN201810183223 A CN 201810183223A CN 108486280 A CN108486280 A CN 108486280A
- Authority
- CN
- China
- Prior art keywords
- gpv
- sbds
- primer
- pcr
- goose parvovirus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a pair of PCR primer for being directed to the short beak runting syndrome goose parvovirus of 5 ' UTR genetic tests, primer is made of upstream and downstream primer, and sense primer and its oligonucleotide sequence are SBDS GPV F1：5’‑GCACGTGACAGGATGTGCGTCA‑3’；Downstream primer and its oligonucleotide sequence are SBDS GPV R1：5’‑GCGCGCAAAATATTTTCT‑3’.The primer specificity of the present invention is high and segment is small, sensibility is high, entire PCR processes can be completed in 2 h, can specific detection go out the presence of short beak runting syndrome goose parvovirus, it is possible to prevente effectively from the appearance of short beak runting syndrome goose parvovirus PCR detection false positive results.
Description
Technical field
The present invention relates to a kind of primers for detecting short beak runting syndrome goose parvovirus, belong to animal and veterinary detection
Field.
Background technology
Short beak and runting syndrome goose parvovirus（short beak and dwarfism syndrome-goose
Parvovirus, SBDS-GPV）It is Parvoviridae dependovirus member, is general tissue tropism single-stranded DNA viruses, clinically
It is main cause Mule duck and cherry valley duck by growth disorder, short beak, tongue are exposed, the high degree in contact characterized by easy bone analysis infects
Disease, under the conditions of artificial challenge, to the equal infectious of different cultivars aquatic bird.This disease is reported in method by Villatte D. earliest
Popular in state Mule duck group, Hungary Palya V. separation in 2009 identifies cause of disease, and is named as SBDS-GPV, and 2015 old
Few warbler etc. detects that SBDS-GPV infects in South China mainland Mule duck and cherry valley duck group, from morbidity Mule duck tissue
It is separated to SBDS-GPV and has carried out system identification.With the development of aquatic bird aquaculture, short beak runting syndrome has become mesh
Preceding one of the Important Infectious Diseases for endangering duck culturing industry cause serious economic loss to duck culturing industry.
Goose parvovirus（Goose parvovirus, GPV）It is code area among genome there are two open reading frame,
It is followed successively by Rep genes and VP genes from left to right, code area both sides are the noncoding regions for including inverted terminal repetitive sequence
（Untranslated region, UTR）.VP gene codes three kinds of Structural protein VP1s, VP2, VP3.VP3, which is that GPV is main, to exempt from
Epidemic disease immunogenic peptide can induce body to generate neutralizing antibody under the conditions of natural infection, therefore VP3 is often as GPV molecular biosciences
Learn the preferred object gene of diagnosis.GPV only has One serotype, SBDS-GPV and classical Goose Parvovirus（classical
GPV, C-GPV）, genetic recombination type Goose Parvoviruses（Muscovy duck-origin GPV, MDGPV）Separation strains are close
Correlation, VP3 gene nucleotide series homology is up to 91%~96%, with Muscovy duck parvovirus（Muscovy duck
Parvovirus, MDPV）Separation strains VP3 gene homologies are 84%~85%.Currently, the polymerization established for SBDS-GPV
Enzyme chain reaction（PCR）Detection method（Standard PCR, quantitative fluorescent PCR, PCR-LAMP）With SBDS-GPV VP3 gene nucleosides
Design primer based on acid sequence, therefore PCR primer specificity is not high, easy tos produce false positive results, often by C-GPV,
MDGPV and MDPV are mistaken for SBDS-GPV；Laboratory differentiates the method or Main Basiss virus base of SBDS-GPV gene expression characteristics
Because the nucleotide sequencing of group is analyzed, however in the work of laboratories routine testing, for a large amount of clinical infection samples
Sequencing there are the shortcomings of of high cost, cumbersome, time-consuming, be not suitable for rapid differential diagnosis and the analysis work of epidemic disease.
Therefore, it is particularly significant to establish quick, special, sensitive SBDS-GPV molecular biology for detection.
Between each separation strains of various disease type GPV there is extensive variation in genome nucleotide sequence, especially with 5 ' ends
Noncoding region（5 '-untranslated region, 5 '-UTR）Sequence variations are maximum, and with tolerance base mutation, insertion
Or the ability of missing.It is found with C-GPV, MDGPV and MDPV type strain full-length gene Multiple Sequence Alignment in GenBank, SBDS-
5 '-UTR genes of GPV representative strains the 250th~400 nucleotides sequence column memory in unique missing of continuous 15 bases and
The continuous base mutation in many places, therefore SBDS-GPV DNA can be detected according to this section of sequence design Specific PCR primers.
It yet there are no the research report that SBDS-GPV is detected for 5 '-UTR design specific primers both at home and abroad at present.We are largely dividing
It analyses in GPV with MDPV difference separation strain gene group sequence basis, is at home and abroad directed to 5 '-UTR sequences for the first time designed for detection
The Specific PCR primers of SBDS-GPV can effectively avoid the appearance of false positive results during SBDS-GPV detection of nucleic acids.This
The foundation of invention can fill up the blank of domestic and international related field.
Invention content
The object of the present invention is to provide a kind of PCR for the short beak runting syndrome goose parvovirus of 5'-UTR genetic tests
Primer, the Specific PCR primers for 5 '-UTR sequences designed for detection SBDS-GPV, can effectively avoid SBDS-GPV cores
The appearance of false positive results in sour detection process.
In order to achieve the above objectives, the present invention uses following technical scheme：
Primer for detecting short beak runting syndrome goose parvovirus includes：
A kind of PCR primer for the short beak runting syndrome goose parvovirus of 5'-UTR genetic tests, the primer sequence are as follows：
PCR sense primers SBDS-GPV-F1：5’- GCACGTGACAGGATGTGCGTCA -3’；
PCR downstream primers SBDS-GPV-R1：5’- GCGCGCAAAATATTTTCT -3’.
The corresponding gene that can be used for short beak runting syndrome goose parvovirus using the primer of the present invention is detected, especially
Detection suitable for base's R＆D units.By the various optimizations to reaction system and reaction condition, a set of can be used for is established
Detect the conventional PCR method of short beak runting syndrome goose parvovirus.
Concrete operation method is as follows：
1, design of primers：With reference to the short 5 '-UTR nucleotides sequences of beak runting syndrome goose parvovirus genome in GenBank
Row carry out homology analysis comparison using Lasergene v7.1 DNAStar softwares, utilize Oligo6.0 softwares, design
Short beak runting syndrome goose parvovirus Specific PCR primers, are retrieved using BLAST tools, it is special for preliminary identification
Property.
2, the optimization of reaction system：25 μ L optimal reaction systems of optimization are：Q5 High-Fidelity 2×
12.5 μ L of Master Mix, upstream and downstream primer（20 μmol/L）Each 0.5 μ L, 2 μ L of template add sterilizing distilled water to supply
To 25 μ L.Optimum reaction condition is：98 ℃ 10s；98 DEG C of 10 s, 53 DEG C of 20 s, 72 DEG C of 30 s, totally 33 are followed
Ring, 72 DEG C of 5 min of extension.
3, PCR products electrophoresis detection：PCR after reaction, takes 3 μ L amplified productions to carry out 1.5 % Ago-Gel electricity
Swimming, observes result on gel imaging system：The sample for not occurring specific gene band at 130 bp, indicates the sample
Without containing short beak runting syndrome goose parvovirus；It is short to indicate that the sample contains for the sample for occurring gene band at 130 bp
Beak runting syndrome goose parvovirus.
The advantages of the present invention：It is that specificity and sensitivity to primer of the present invention are analyzed as a result, in
For in the short beak runting syndrome goose parvovirus positive of examination, special purpose band is amplified at 130 bp, and it is good for
Health aquatic bird tissue sample and C-GPV, MDGPV and MDPV do not amplify specific band at 130 bp；By cloning and sequencing,
Extension increasing sequence is homologous from the different separation strain gene corresponding sequences of the GenBank short beak runting syndrome goose parvovirus announced
Property highest（95%-100%）, it was demonstrated that there is the primer good specificity, testing result to have reliability.The primer of the present invention is special
Anisotropic high and segment is small, and sensibility is high, and entire PCR processes can be completed in 1.5 h, can specific detection to go out short beak short
The presence of small syndrome goose parvovirus, it is possible to prevente effectively from short beak runting syndrome goose parvovirus PCR detects false positive knot
The appearance of fruit.
By to primer sensitivity analysis, the high sensitivity of the special primer, therefore it is less in sample size or organizing
In the case that viral level is very low in sample, the primer detection can be also used.It is tiny that short beak runting syndrome goose is detected by PCR
Virus has important application value in aquatic bird parvovirus molecular epidemiology detection process, is short beak runting syndrome
Technical foundation is established in early prevention control.
Description of the drawings
Fig. 1 is PCR primer specificity schematic diagram.Wherein, M indicates DL2000 DNA Marker；1 indicates SBDS-
M15 plants of DNA samples of GPV；2 indicate that healthy duck organizes total DNA sample；3 indicate FJ plants of DNA samples of C-GPV, are free of
SBDS-GPV nucleic acid；4 indicate PT plants of DNA samples of MDGPV, are free of SBDS-GPV nucleic acid；5 indicate P plants of DNA samples of MDPV, no
Nucleic acid containing SBDS-GPV.
Fig. 2 is PCR primer sensitivity analysis schematic diagrames.M indicates DL2000 DNA Marker；1 indicates DNA phases
To a concentration of 30 ng；2 indicate that DNA relative concentrations are 3 ng；3 indicate that DNA relative concentrations are 300 pg；4 indicate that DNA is opposite
A concentration of 30 pg；5 indicate that DNA relative concentrations are 3 pg；6 indicate negative control.
Specific implementation mode
In order to which the present invention is further explained rather than the limitation present invention, it is illustrated with reference to embodiments.Following implementations
Experimental method is unless otherwise specified conventional method described in example.The reagent and biomaterial are unless otherwise specified
It obtains from commercial channels.
Embodiment 1 detects the PCR detection methods of short beak runting syndrome goose parvovirus
One, material：
M15 plants of short beak and runting syndrome goose parvovirus（SBDS-GPV M15）, genetic recombination type Goose Parvoviruses PT
Strain（MDGPV PT）, P plants of Muscovy duck parvovirus（MDPV P）With classical goose parvovirus FJ plants（C-GPV FJ）By Fujian Province
The separation of Academy of Agricultural Sciences's animal and veterinary research institute animal virus room is identified and is preserved.
Two, step
1, instrument and reagent：T100 type grads PCR instrument is purchased from Bio-Rad Bole company；PMD18-T carriers, DL2000
Marker is purchased from precious bioengineering（Dalian）Co., Ltd；Super 2 × Master of the fidelity Mix of Q5 are purchased from NEB companies；DNA
Purification kit E.Z.N.A.TM Gel Extraction Kit and plasmid rapid extraction kit E.Z.N.A.TM Plasmid
Mini Kit are purchased from Omega companies.
2. design of primers and synthesis
Using 6.0 softwares of Oligo according to the 5 '-UTR conservative regions sequence designs 1 of SBDS-GPV to Oligonucleolide primers, upstream
Primer SBDS-GPV-F1 and downstream primer SBDS-GPV-R1.
Sense primer and its sequence are：
SBDS-GPV-F1（SEQ ID NO：1）：5’- GCACGTGACAGGATGTGCGTCA -3’；
Downstream primer and its sequence are：
SBDS-GPV-R1（SEQ ID NO：2）：5’- GCGCGCAAAATATTTTCT -3’.
3. for the foundation of the short beak runting syndrome goose parvovirus PCR detection methods of 5'-UTR genes
Short beak runting syndrome goose parvovirus genomic DNA is extracted in conventional manner.PCR reaction systems are 25 μ L, including
9.5 μ L aqua sterilisas, 12.5 μ L of Q5 2 × Master of High-Fidelity Mix, upstream and downstream primer（20 μmol/L）Respectively
0.5 μ L, 2 μ L of template are expanded on T100 type grads PCR instrument after mixing；Reaction condition is：98 ℃ 10s；98 ℃
10 s, 53 DEG C of 20 s, 72 DEG C of 30 s, totally 33 recycle, 72 DEG C of 5 min of extension.
PCR after reaction, takes 3 μ L amplified productions to carry out 1.5 % agarose gel electrophoresis, is seen on gel imaging system
It examines, take pictures.Whether to generate 130 bp specific bands come in judgement sample whether to contain the short tiny disease of beak runting syndrome goose
Poison.
The specific detection of 2 short beak runting syndrome goose parvovirus PCR of embodiment
Take artificial challenge SBDS-GPV, C-GPV, MDGPV and MDPV morbidities duck tissue positive respectively and healthy duck tissue
Negative sample is extracted total DNA by embodiment 1, carries out PCR amplifications, detected through gel electrophoresis result in conventional manner.As a result SBDS-
The specific band of 130 bp is generated in GPV infection pathological material of diseases, and C-GPV, MDGPV and MDPV infection pathological material of disease and healthy duck are organized
Sample does not generate the specific band of 130 bp, and testing result is as shown in Fig. 1.Extremely by PCR product recovery purifyings rear clone
PMD18-T carriers are simultaneously sequenced.The result shows that the difference of the target fragment sequence of amplification and the GenBank SBDS-GPV announced
The homology highest of virus isolated strain 5'-UTR corresponding sequences（95%-100%）.Therefore the primer is for the short beak of 5'-UTR genes
Runting syndrome goose parvovirus specific primer can be used for the quick detection of short beak runting syndrome goose parvovirus.
The above results show that the PCR methods established have good specificity, and it is tiny to can be used for short beak runting syndrome goose
The detection of virus.
The sensitivity of 3 short beak runting syndrome goose parvovirus PCR of embodiment detects
SBDS-GPV viral DNAs are extracted in conventional manner by embodiment 1, the DNA of extraction, which is carried out 10 times, to be serially diluted,
PCR amplifications are carried out, to detect the relative sensitivity of this method.PCR testing results are as shown in Fig. 2.The special primer
SBDS-GPV-F1 （SEQ ID NO ：1）And SBDS-GPV-R1（SEQ ID NO ：2）The minimum opposite DNA that can be detected
The sensitivity of concentration is 3 pg, and primer sensitivity is good.
The foregoing is merely presently preferred embodiments of the present invention, all equivalent changes done according to scope of the present invention patent with
Modification should all belong to the covering scope of the present invention.
SEQUENCE LISTING
110 Fujian Province Academy Of Agricultural Sciences Animal Husbandry And Veterinary Medicine Institute
A kind of 120 PCR primers for the short beak runting syndrome goose parvovirus of 5'-UTR genetic tests
130 SBDS-GPV
150 1
151 2018-02-07
160 2
170 PatentIn version 3.5
210 1
211 22
212 DNA
213 Parvo-like virus
400 1
gcacgtgaca ggatgtgcgt ca 22
210 2
211 18
212 DNA
213 Parvo-like virus
400 2
gcgcgcaaaa tattttct 18
Claims (1)
1. one kind being directed to the PCR primer of the short beak runting syndrome goose parvovirus of 5 '-UTR genetic tests, it is characterised in that：By one
Oligonucleolide primers SBDS-GPV-F1 and SBDS-GPV-R1 are formed, the primer sequence is as follows：
SBDS-GPV-F1：5’- GCACGTGACAGGATGTGCGTCA -3’；
SBDS-GPV-R1：5’- GCGCGCAAAATATTTTCT -3’.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810183223.4A CN108486280B (en) | 2018-03-06 | 2018-03-06 | PCR primer for detecting short beak dwarf syndrome goose parvovirus by aiming at 5' -UTR gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810183223.4A CN108486280B (en) | 2018-03-06 | 2018-03-06 | PCR primer for detecting short beak dwarf syndrome goose parvovirus by aiming at 5' -UTR gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108486280A true CN108486280A (en) | 2018-09-04 |
| CN108486280B CN108486280B (en) | 2021-09-17 |
Family
ID=63341551
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810183223.4A Active CN108486280B (en) | 2018-03-06 | 2018-03-06 | PCR primer for detecting short beak dwarf syndrome goose parvovirus by aiming at 5' -UTR gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108486280B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103773899A (en) * | 2014-01-26 | 2014-05-07 | 广西壮族自治区兽医研究所 | GeXP (Gene Expression Profiler) detection kit for differentiating 11 kinds of duck viral diseases |
| CN104789700A (en) * | 2015-04-03 | 2015-07-22 | 中国农业科学院上海兽医研究所 | DHAV (duck hepatitis A virus) typing detection method based on fluorescent quantitative PCR (polymerase chain reaction) melting curve method |
| CN106011315A (en) * | 2016-08-12 | 2016-10-12 | 福建省农业科学院畜牧兽医研究所 | RT-PCR discriminating diagnosis primers for type 1 and new serotype duck hepatitis virus |
-
2018
- 2018-03-06 CN CN201810183223.4A patent/CN108486280B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103773899A (en) * | 2014-01-26 | 2014-05-07 | 广西壮族自治区兽医研究所 | GeXP (Gene Expression Profiler) detection kit for differentiating 11 kinds of duck viral diseases |
| CN104789700A (en) * | 2015-04-03 | 2015-07-22 | 中国农业科学院上海兽医研究所 | DHAV (duck hepatitis A virus) typing detection method based on fluorescent quantitative PCR (polymerase chain reaction) melting curve method |
| CN106011315A (en) * | 2016-08-12 | 2016-10-12 | 福建省农业科学院畜牧兽医研究所 | RT-PCR discriminating diagnosis primers for type 1 and new serotype duck hepatitis virus |
Non-Patent Citations (2)
| Title |
|---|
| YU FU等: "Molecular detection and typing of duck hepatitis A virus directly from clinical specimens", 《VETERINARY MICROBIOLOGY》 * |
| 王劭: "应用PCR-RFLP技术检测短喙矮小综合征鹅细小病毒", 《中国预防兽医学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108486280B (en) | 2021-09-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108531663B (en) | Duck adenovirus DAdV-3 and DAdV-A universal detection primer and application thereof | |
| CN102154281B (en) | Molecular marker SIsv0010 closely linked with heading-date gene of millet | |
| KR102081965B1 (en) | Primer set for detection of 7 serotypes of foot-and-mouth disease viruses and uses thereof | |
| CN107955839A (en) | For detecting double PCR primer, detection method and the kit of 3 type of porcine circovirus 2 type and circovirus | |
| KR101149422B1 (en) | Primers and its application in multiplex PCR to identify Rinderpest, Peste-des-petits-ruminants virus, Bluetongue virus and Rift Valley fever | |
| Monini et al. | Full-length genomic analysis of porcine rotavirus strains isolated from pigs with diarrhea in Northern Italy | |
| CN113755565A (en) | Quadruple quantitative fluorescent probe primer combination, kit and identification method for identifying African swine fever wild viruses and vaccine strains | |
| CN107190103B (en) | Multiplex PCR primer group, kit and method for simultaneously detecting three fish viruses | |
| CN109735659A (en) | A kind of primer and kit and detection method using RPA detection Procambius clarkii picornavirus | |
| Madadgar et al. | Genotyping and determining the distribution of prevalent G and P types of group A bovine rotaviruses between 2010 and 2012 in Iran | |
| Prasad et al. | G and P genotyping of bovine group A rotaviruses in faecal samples of diarrhoeic calves by DIG-labelled probes | |
| CN111334528B (en) | Mink enteritis parvovirus whole genome infectious clone and construction method and application thereof | |
| CN112831609A (en) | PCR primer, kit and method for detecting African swine fever virus MGF-505-1R gene | |
| CN108707695A (en) | A kind of parrot young bird disease virus real-time fluorescence quantitative PCR detection kit | |
| Kye et al. | Phylogenetic analysis and genetic characterization of chicken anemia virus isolates from Cambodia | |
| CN109680087B (en) | A kind of dual PCR detection method and its primer sets of Sugarcane white leaf phytoplasma and informal voucher Xanthomonas campestris | |
| CN108486280A (en) | A kind of PCR primer for the short beak runting syndrome goose parvovirus of 5`-UTR genetic tests | |
| CN112941240B (en) | Primer pair, kit and method for detecting goose astrovirus and goose goblet virus | |
| KR101236197B1 (en) | Differential detection of West nile virus and Japanese encephalitis virus | |
| Zhang et al. | Molecular characterisation of canine parvovirus strains circulating in China | |
| CN108823332A (en) | The universal detection primer of one group of GPV and N-GPV and probe | |
| CN111996294A (en) | Primer pair and kit for quantitatively detecting eel herpesvirus | |
| CN108796132A (en) | A kind of N-MDPV detection primers and probe and its application | |
| JPWO2007119557A1 (en) | Koi herpesvirus (KHV) detection method | |
| CN107937620A (en) | A kind of PCR RFLP methods for distinguishing fowl tembusu virus attenuated vaccine strain and street strain |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |