CN108486123B - Modified human lactoferrin gene suitable for expression of silkworm silk gland and expression system and application thereof - Google Patents

Abstract

The invention relates to a modified human lactoferrin gene suitable for expression of silkworm silk glands, an expression system and application thereof, wherein the modified human lactoferrin gene is shown as SEQ ID No.1, and coded amino acid is shown as SEQ ID No.2, the modified human lactoferrin gene, a secretory sericin1 gene promoter and a secretory sericin1 gene terminator form an expression frame, the expression is enhanced by an enhancer hr3, and a piggyBac transposon arm and a fluorescence screening marker gene are connected to construct the expression system.

Description

Modified human lactoferrin gene suitable for expression of silkworm silk gland and expression system and application thereof

Technical Field

The invention belongs to the technical field of biology, and relates to a modified human lactoferrin gene suitable for expression of silkworm silk glands, and an expression system and application for expressing the human lactoferrin gene.

Background

Since the 21 st century, with the increasing demand for functional proteins for medical, pharmaceutical, edible, cosmetic, and health uses, human beings have been unable to meet the rapidly growing market demand by extracting and producing natural proteins. Establishing and perfecting various high-efficiency prokaryotic and eukaryotic expression systems, and using escherichia coli, yeast, insect cells, mammalian cells, insects, mammals and the like as host bioreactors, is an effective and sustainable method for realizing low-cost large-scale production of recombinant foreign proteins with biological activity, and becomes a hotspot of current world research. The method for producing the foreign protein by using the Chinese hamster ovary cells as the bioreactor is the most standard expression mode at present, but the operation cost and the requirement on the environment are extremely strict, and the large-scale popularization and application of the foreign protein are severely limited. In order to establish a low-cost, large-scale, safe, sustainable and efficient bio-factory for producing foreign proteins, since 2000, researchers have tried to produce recombinant foreign proteins using organs of transgenic organisms such as mammals, birds, insects and plants as bioreactors.

Silkworm is known as serials and is one of the first economic animals (insects) completely domesticated and utilized by human beings. The silk gland of silkworm is the organ for synthesizing and secreting silk protein, and is the biological basis of whole silk industry. After thousands of years of artificial domestication, the silk gland of the silkworm has super strong protein synthesis and secretion capacity, and the silkworm with the weight of about 5g can synthesize and secrete about 0.5g of fibroin, which is the best of the known insects at present. The fibroin is mainly composed of silk fibroin (fibriin) and sericin (sericin) coated on the outer layer of the fibroin: the silk fibroin is the main body of silk, accounts for about 75 percent, is synthesized by the posterior silk gland of the silkworm, comprises three main components of fib-H chain, fib-L chain and P25, and is insoluble in water; the rest is sericin, accounting for about 25%, synthesized by middle silk gland of silkworm, including sericin 1: (A)Sericin1) Sericin 2(Sericin2) And sericin 3(Sericin3) The three main components, the highest sericin1 protein content, are all soluble in water. With the development of modern molecular biology and transgenic technology, the characteristics of high-efficiency synthesis and silk protein secretion of silkworm spun silk glands and the protein post-translational modification processing capacity of glycosylation, methylation and the like which are extremely important for maintaining the activity of foreign proteins are achieved, the feeding cost is low, the silkworm silk gland protein can be produced in an industrial manner, and the silkworm silk gland protein is safe to people and livestock, so that the silkworm silk gland protein becomes an ideal bioreactor model and is concerned by researchers in various countries and competitively developed and utilized.

In 2000, Tiancun et al used pBac transposon to mediate microinjection of silkworm eggs and obtain stably inherited transgenic silkworms; in 2003, Xiuqingyou et al completed the silkworm genome project, important coding genes related to silk protein synthesis in silkworm silk glands, such as promoter regulatory elements of fibroin heavy chain (FibH chain) gene, fibroin light chain (FibL chain) gene, Sericin1 (Sericin 1) gene, Sericin2 (Sericin 2) gene, Sericin3 (Sericin 3) gene, P25 gene and the like were identified and cloned, and at the same time, the expression system was optimized in the early stage of the research laboratory, so that a high-efficiency transgenic silkworm Sericin1 expression system was obtained. These basic research results make it possible to produce recombinant foreign proteins in silk glands in large scale by using the tissue specific expression system of transgenic silkworms. In recent years, various exogenous proteins are tried to be expressed in silk glands at home and abroad by utilizing a pBac transposon mediated transgenic technology and a silkworm tissue specific promoter element, and the exogenous proteins comprise: the silk fibroin heavy chain fused EGFP (ZHao et al 2010), cat interferon (Kurihara et al 2007), spider silk traction protein (ZHuet al 2010), human collagen type III partial peptide (Tomita et al 2003), enhanced red fluorescent protein (Tomita et al 2003), silk fibroin light chain fused hydroxyproline collagen partial peptide (Adachi et al 2006), fibroblast growth factor (Hino et al 2006), enhanced green fluorescent protein (Shimizu et al 2007), partial collagen peptide (Yanagisawa et al 2007), and P25 fused red fluorescent protein (Royer et al 2005) are expressed in the posterior silk gland; human serum albumin (Ogawa et al 2007), enhanced green fluorescent protein (Tomita et al 2007), murine monoclonal antibody (Iizuka et al 2009), human collagen alpha chain gene (Adachi et al 2010), soluble GM-Csf receptor alpha (Urano et al 2010), and the like are expressed in the middle silk gland. The comprehensive research results at home and abroad show that the production of the foreign protein with high added value by using the silkworm silk gland as the bioreactor not only has wide market prospect, but also breaks the barrier that the silkworm can only be used as the traditional industry, and provides basic technical system guarantee for the development of the novel industry of the silkworm.

Human lactoferrin is a single-chain glycoprotein consisting of 716 amino acids and has a molecular weight of about 78 kDa. Human lactoferrin can transport and store iron, and is one of transferrin family members. Lactoferrin has a wide spectrum of biological activities such as antibacterial, antiviral, anti-inflammatory, inhibiting tumor cell growth, and regulating immune responses, and is closely related to promoting development of digestive tracts of young children and promoting iron absorption. The application of lactoferrin in the existing market is mainly concentrated on adding the lactoferrin into milk powder as a nutrition enhancer for enhancing the immunity of infants. At present, the commercial production of human lactoferrin is mainly realized by a whey separation and purification approach, however, with the vigorous consumption of lactoferrin, the traditional separation and purification method is difficult to meet the market demand. Traditional separation methods are not only very expensive, but also risk the transmission of diseases such as hepatitis and HIV. The regulatory authorities have also called upon pharmaceutical companies to use whey of non-animal origin for the production of lactoferrin so that the risk of infection with disease agents can be effectively controlled. Therefore, the human lactoferrin is produced by using the gene recombination technology, so that the risk of disease transmission can be effectively controlled, and the human lactoferrin can be used as a substitute for the human lactoferrin from whey and has a huge market development prospect. In 2009, wanghong disclosed the study of expressing recombinant human lactoferrin by using a silkworm silk gland bioreactor, but this method can only express a small amount of protein in the middle silk gland of silkworm, and almost detects the expression of recombinant human lactoferrin in silk.

Therefore, the development of transgenic silkworm materials for efficiently producing human lactoferrin recombinant proteins in a large scale with industrial value is urgently needed, and the feasibility of the practicability of the transgenic silkworm silk gland bioreactor is explored.

Disclosure of Invention

In view of the above, the present invention aims to provide a modified human lactoferrin gene suitable for expression of silkworm silk gland; the invention also aims to provide an expression system containing the modified human lactoferrin gene suitable for expressing the silkworm silk gland; the invention also aims to provide the application of the expression system in expressing recombinant human lactoferrin in silkworm silk gland; the fourth purpose of the invention is to provide a method for expressing the recombinant human lactoferrin in the bombyx mori silkworm gland by using the expression system.

In order to achieve the purpose, the invention provides the following technical scheme:

1. the modified human lactoferrin gene suitable for expression of silkworm silk glands is shown as SEQ ID No. 1.

2. An expression system comprising the modified human lactoferrin gene of claim 1 or 2 suitable for expression in silk glands of silkworms.

Preferably, the expression system comprises the enhancer hr3, the secretory sericin1 gene promoter, the modified human lactoferrin gene and the sericin1 gene terminator, which are sequentially linked.

Preferably, the expression system further comprises a fluorescent selectable marker gene expression cassette upstream of the enhancer hr 3.

3. The expression system is applied to the expression of recombinant human lactoferrin in the bombyx mori silk gland.

4. The method for expressing the recombinant human lactoferrin in the bombyx mori silk gland by using the expression system comprises the following steps of: and (2) converting the expression system to remove diapause silkworm eggs, sealing the silkworm eggs with non-toxic glue, sterilizing the silkworm eggs with formaldehyde steam, incubating, screening transgenic positive moth rings, taking positive transgenic silkworm cocoon shells, crushing the positive transgenic silkworm cocoon shells into powder in liquid nitrogen, dissolving the powder in a buffer solution containing 50mM Tris-Cl, 8M Urea and pH 8.0, carrying out water bath at 80 ℃ for 40min, centrifuging, collecting supernatant, and purifying to obtain the recombinant human lactoferrin.

Preferably, the concentration of the cocoon shell powder dissolved in the buffer solution is 20 mg/mL.

Preferably, the specific method for purifying is as follows: passing the supernatant through His Trap^TMAnd (3) eluting the FF chromatography column by using imidazole eluent with the concentration of 0-500 mM, preparing the imidazole eluent by using a Urea solution with the pH of 7.0-7.5 and the concentration of 8M, and collecting the eluent, wherein the eluent is the purified recombinant human lactoferrin.

The invention has the beneficial effects that: the invention obtains the human lactoferrin gene sequence suitable for the codon preference of the silkworm by optimizing the coding sequence of the human lactoferrin, forms an expression frame by the optimized human lactoferrin gene sequence, a promoter containing secretory sericin1 gene and a terminator, and utilizes an enhancer hr3 to enhance expression, fluorescent marker gene screening and piggyBac transposition arm to construct a high-efficiency expression system.

Drawings

In order to make the object, technical scheme and beneficial effect of the invention more clear, the invention provides the following drawings for explanation:

FIG. 1 shows the structure of the transgene expression vector (3 xp3RFP represents the transgene fluorescence screening marker gene; hr3CQ represents the enhancer hr 3; Ser1 represents the secretory sericin1 gene promoter; rhLF represents the human lactoferrin gene coding sequence optimized by codon; Ser1PA represents the terminator of the sericin1 gene; and ITR represents the piggyBac transposon arm sequence).

FIG. 2 shows the fluorescence screening of transgenic moths (A: white light graph; B: fluorescence graph).

FIG. 3 is SDS-Page electrophoretogram of sgrhLF silkworm cocoon shell protein (1-65: 65 transgene positive individual cocoon shell proteins; WT: normal cocoon shell protein).

FIG. 4 shows the detection of rhLF in the silkworm cocoon shell protein of sgrhLF (A: SDS-Page electrophoretogram; B: Western blot).

FIG. 5 shows the rhLF sericin solution and the quantitative detection of purification (A: SDS-PAGE electrophoresis; B: Western blot detection).

Fig. 6 shows the secondary structure detection of recombinant rhLF protein.

FIG. 7 shows that rhLF reduces LPS-induced cell inflammation (A: TNF-. alpha.content; B: NO content; C: relative blot to detect iNOs produced by cells; D: relative expression of iNOs).

FIG. 8 shows the result of the detection of the antibacterial activity of recombinant human lactoferrin.

Detailed Description

Preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings.

The materials used in the examples of the invention are as follows: the test silkworm variety Dazao (P50) was stored in the laboratory. The larvae were fed with artificial diet in a 25 ℃ climatic chamber. Mouse peritoneal macrophage raw264.7 was stored in the laboratory and cultured in the presence of 10% (v/v) fetal bovine serum (FB)S, Gibco) in DMEM medium at 37 deg.C and 5% CO₂. Plasmid vectors pSLfa1180fa, pBac {3xp3EGFPAF }, pBac {3xp3DsRedaf } were stored in the laboratory.

Preparation of main reagents and solutions: the conventional media and reagent buffers used in the molecular cloning procedure were prepared according to the section on the laboratory protocol (S1-S11) in "third edition of molecular cloning Manual" and "catalog of TaKaRa trade Markov. DNA polymerase Ex-Taq, LA-Taq Kit, conventional restriction enzyme, alkaline phosphatase, sequencing cloning vector pMD19-T simple vector Kit, DNA Ligation Kit Ver.2.0, fluorescent quantitative PCR Kit SYBRPremix Ex TaqTM were purchased from TaKaRa. Escherichia coli competent cells Trans1-T1 were used for transformation, and a conventional Plasmid DNA extraction Kit Easypure Plasmid MiniPrep Kit was purchased from Hokko Swinhonis. Agarose Gel DNA recovery Kit Gel Extraction Mini Kit (50) was purchased from Shunhua Biotech. The ultra-pure plasmid extraction Kit QIA prep Spin Miniprep Kit (50) for transgene injection was purchased from QIAGEN. Total RNA Kit II (50) kits were purchased from Omega Bio-Tec. The human lactoferrin polyclonal antibody anti-rhLF anti-body and the recombinant human lactoferrin standard rhLF-std are purchased from Sigma, the Nitric Oxide Synthase (iNOs) polyclonal antibody anti-iNOs anti-body is purchased from abcam, the NO detection kit is purchased from Biyunnan, and the TNF-alpha detection kit is purchased from R & D systems.

Example 1 engineering human lactoferrin Gene Synthesis

Downloading a mature peptide amino acid sequence of Human lactoferrin (hLF, GenBank: M93150.1) from NCBI, carrying out optimization design on a coding sequence according to the codon usage preference of silkworm, wherein the specific sequence is shown as the 7 th to 2106 th sites of SEQ ID NO.1, and the amino acid sequence is shown as the 1 st to 700 th sites of SEQ ID NO.2, and synthesizing a gene sequence by a company. The C-terminal of the human lactoferrin (hLF) amino acid sequence was fused with 6 histidine amino acids to form hLF-his 6. BamHI and NotI enzyme cutting sites are respectively connected to two ends of the two synthesized recombinant protein gene sequences, as shown in SEQ ID NO.1, and the coded amino acid sequence is shown in SEQ ID NO. 2.

Example 2 construction of transgenic expression vectors

A commercially synthesized hLF-his6 gene coding sequence is constructed into psl1180[ hr3Pser1spRedSer1PA ] through BamHI and NotI enzyme cutting sites to form psl1180[ hr3CQSer1sphLFSer1], a nucleotide sequence is shown as SEQ ID NO.3, and the coding sequence is constructed into an AscI site of a pBac {3xp3EGFPAF } vector through an AscI site to form a transgenic expression vector phShLFSer, and the vector structure is shown as figure 1.

Example 3 microinjection and fluorescence screening

The plasmid extraction Kit of QIAGEN plasmid Mini Mini Kit is used for extracting the transgene expression vector phShLFSer1 and the auxiliary vector pHA3PIG plasmid, the concentration of each plasmid is diluted to 400 ng/mu l, and the plasmids are respectively mixed with the auxiliary vector pHA3PIG plasmid according to the molar ratio of 1: 1. Injecting the mixed plasmid into a large-sized early embryo (2-5 h after spawning) with diapause removed, sealing an injection hole with nontoxic glue, sterilizing for 5 minutes by 35% formaldehyde steam, placing in an environment with 25 ℃ and 85% relative humidity for hatching, breeding the hatched larva (G0 generation) with artificial feed, selfing or backcrossing to produce seeds after adult, detecting the obtained G1 generation silkworm eggs (7 th day) under a macroscopic stereovision fluorescence microscope (Olypus MVX10, Japan), detecting red fluorescence observation with exciting light with the wavelength of 510-550 nm, screening out a transgenic positive moth ring which specifically excites red fluorescence in eyes or nerves, and naming the moth ring as sghLF as shown in figure 2. The fluorescence screening statistics of transgenic silkworms are shown in table 1.

TABLE 1 transgenic screening statistics

The results showed that a total of 12 positive moth-rings were screened from the 43G 1 moth-rings of sgrhLF with a positive rate of 27.90%.

Example 4 SDS-Page and Western blot assays

The extraction and detection method of the recombinant protein in the cocoon shell total protein comprises the following steps: crushing cocoon shells into powder in liquid nitrogen, dissolving the powder in 50mM Tris-Cl, pH 8.0 and 8M Urea buffer solution according to the cocoon shell concentration of 20mg/ml, carrying out water bath at 80 ℃ for 40min, and then centrifuging to collect supernatant, wherein the centrifugation conditions are as follows: 13500 Xrpm, 25 ℃, 15 min. The extracted cocoon shell total protein was detected by 12% SDS-Page electrophoresis and stained with Coomassie Brilliant blue. And (3) carrying out electrophoretic separation on the extracted total protein by 12% SDS-Page gel, and transferring the protein in the SDS-Page gel to a PVDF membrane by adopting an electrotransformation method. PVDF membrane in 5% skimmed milk powder TBST buffer, 4 degrees overnight blocking. Prior to immunohybridization, PVDF membrane was washed 3 times 5min each with TBST at room temperature. Preparing anti-rhLF (Sigma) primary anti-hybridization solution by using TBST containing 5% skimmed milk powder according to a dilution ratio of 1000 times, immersing the PVDF membrane into the hybridization solution, oscillating and incubating for 2h at room temperature, and washing the membrane for 5 times by using TBST, wherein each time is 10 min. Preparing a goat anti-rabbit secondary antibody (purchased from Biyuntian) hybridization solution marked by HRP (horse radish) by using TBST according to 20000-fold dilution ratio, immersing the PVDF membrane cleaned by the TBST into the secondary antibody hybridization solution, and incubating for 2h at room temperature with oscillation, wherein the membrane is cleaned by the TBST for 5 times, and each time is 10 min. Placing the cleaned PVDF membrane on a clean preservative film, uniformly dripping ECL (Amersham Biosciences) on the PDVF membrane surface, incubating for 5min at room temperature in a dark place, and carrying out exposure and imaging by using a Chemiscope instruments (Clinx science instruments) instrument.

The SDS-Page detection result is shown in FIG. 3, and the result shows that the transgenic cocoon shell protein lane has a difference band above a 70kDa molecular Marker, the size of the difference band is consistent with the theoretical molecular weight of rhLF protein, and the content of the difference band in cocoon shell total protein of different transgenic individual sources is obviously different. In order to further identify the specific band as rhLF, Western blot detection is carried out on cocoon shell proteins with the numbers of 53-65, and the result is shown in FIG. 4. The result shows that the difference band of the transgenic cocoon shell protein above the 70kDa molecular Marker can specifically react with the antibody of rhLF, and the result proves that the difference band is the rhLF protein specifically expressed by the transgenic silkworm.

The rhLF content in 1g of silk was calculated to be about 10.27mg by gray scale comparison with rhLF standard, i.e. rhLF accounts for 0.93% of rhLF transgenic silkworm cocoons (FIG. 5). The results show that the Ser1 expression system established in the research can efficiently produce the human lactoferrin through recombination and secrete the human lactoferrin into silkworm silk. In addition, the content of the recombinant protein in individuals from different positive moth circles has obvious difference, and the fact that the expression of the trans-rhLF gene in the silkworm silk gland cells is influenced by strong chromosome position effect is suggested.

While 192 mug/ml is detected in the silk gland only by using the Wangzheng method, the rhLF protein content in 1g of silk gland is calculated to be about 2.4 mg, and the rhLF protein is hardly detected in the silk.

Example 5 isolation and purification of rhLF from silkworm cocoon and detection

Shearing 1g of hLF transgenic silkworm cocoon, centrifuging in a buffer solution of 50mM Tris-Cl, pH 8.0 and 8M Urea at 80 ℃ for 15min at 13500rpm and 25 ℃, and collecting the supernatant. The supernatant first passed through His Trap^TMFF crude affinity chromatography column (GE healthcare) allows rhLF to bind to nickel ions in the column, and then to be eluted and collected with imidazole eluents of various concentrations (8 MUrea, pH7.0-7.5, imidazole concentration 0, 20, 50, 100, 500 mM). After the sample is collected, 12% SDS-PAGE and western blot are carried out to detect the purification and yield. The results show that: a differential protein band appears on the transgenic silkworm cocoon extracted protein above a 70kDa molecular Marker, the differential protein band can specifically react with an antibody of rhLF, the result is consistent with that of a rhLF standard substance, and urea is proved to be capable of dissolving rhLF in silk. Further analysis of the results of SDS-PAGE and Western blot on the rhLF purified product can obtain rhLF protein with a purity of about 90%, and 1g of silkworm cocoon can be purified to obtain 9.21mg of rhLF, with a purification yield of 89.25% (FIG. 5).

(1) Detection of recombinant protein Secondary Structure

The purified rhLF sample was dissolved in deionized water, and the CD profile of rhLF at 190-250nm was determined at a concentration of 0.5mg/mL, as shown in FIG. 6. The results show that, in CD: 190-250nm, the rhLF expressed by the transgenic silkworm has similar absorption peak value with the commercialized rhLF standard protein, and the rhLF expressed by the silkworm and the commercialized rhLF standard protein have similar absorption peak value through calculationα-a helix,β-folding over,βThe secondary structure of the protein was more consistent with the secondary structure of the protein, such as turn and random coil (Table 2). Therefore, we speculate that rhLF expressed using transgenic silkworms should have its biological function. The results mark the Ser1 expression system established in this studyCan realize high-efficiency recombinant expression, separation and purification of the foreign protein.

TABLE 2 Secondary Structure analysis of recombinant rhLF proteins

Sample name	α-helix (%)	βFold (%)	β-angle of rotation (%)	Random crimp (%)
					rhLF-std	52.60	10.35	14.90	22.50
rhLF	51.20	10.90	15.30	22.90

(2) Detection of anti-inflammatory activity of recombinant human lactoferrin

The purified rhLF sample was dissolved in deionized water for use. raw264.7 cells were resuspended and plated into 96-well cell culture plates at a density of 5X 10⁴One/well, cells are attached after 12h of culture, and bacterial lipopolysaccharide (LPS, 50 n) is addedg/mul) and rhLF with different concentrations (final concentration is 0 mug/ml, 10 mug/ml, 20 mug/ml and 30 mug/ml) are continuously cultured for 12h, rhLFstd is positive control, 12h later, a cell culture medium kit is taken to measure the concentrations of NO and TNF- α, the cells are washed twice by ice PBS, lysate is used for cracking the cells, Westernblotting is used for measuring the expression condition of the cellular iNOs, the result is shown in figure 7, the result shows that LPS can induce raw264.7 cells to generate inflammatory factors such as NO and TNF- α and the iNOs are over-expressed, the GRRRR and RKVRGPP sequences at the N end of the human lactoferrin molecule can combine with LPS, thereby reducing the LPS to induce the cells to generate inflammatory factors, the result of the anti-inflammatory activity detection experiment carried out on the purified rhLF shows that the 10 mug/ml rhLF can remarkably reduce the LPS to induce the raw264.7 cells to generate TNF- α and NO and the inhibitory rate is increased along with the increase of the concentration of the LPS, the Western detection cell to generate the anti-inflammatory activity detection result shows that the rLF is equivalent to 20 g/ml when the rLF is used as a blank control for producing the recombinant silkworm LF, and the result shows that the recombinant gene has the effect is more than that the standard of the rLF.

(3) Detection of antibacterial activity of recombinant human lactoferrin

The purified rhLF sample was dissolved in deionized water for use. Escherichia coli was activated with LB medium and inoculated into 96-well plates at 100. mu.l/well, rhLF (concentration: 0.5mg/ml, 1mg/ml, 2 mg/ml) was added at different concentrations and incubated with Escherichia coli, absorbance was measured at 600nm every 1h for 12h continuously, and the results are shown in FIG. 8. The results show that rhLF is dose-dependent and time-dependent on E.coli growth. Human lactoferrin can competitively bind to ferric ions required for growth of escherichia coli, thereby inhibiting growth of escherichia coli. The result of the purified rhLF inhibiting the escherichia coli shows that the rhLF has an inhibiting effect on the growth of the escherichia coli from the 3 rd hour, the inhibition rate is enhanced along with the increase of time, and the bacterial growth tends to be smooth at 8 hours; in addition, the rhLF (2 mg/ml) with high concentration has lower inhibitory effect (0.5 mg/ml) and obvious inhibitory effect on rhLF; at 12h, the inhibition rate of 2mg/ml rhLF reaches the maximum of 29.85%.

In conclusion, the invention utilizes the established Ser1 expression system hSRSE to carry out recombinant expression on human lactoferrin (rhLF). A coding gene of human lactoferrin (rhLF) is artificially designed and synthesized according to the preference of the codon usage of the silkworm genome, and a transgenic expression vector phSrhLFSer1 is constructed. By microinjecting silkworm embryos, we established transgenic silkworm strains sgrhLF, which was screened to obtain 7 strains without positive moth coil sources.

The rhLF protein is detected to be efficiently expressed in cocoon shells of sgrhLF silkworms by using an SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and Western blot detection method. And comparing the rhLF standard substance with the gray scale, and calculating that the content of rhLF protein in the sgrhLF cocoon filaments is 10.27 mg/g. The result shows that the expression efficiency of the hSRSE expression system established by systematic optimization reaches the level of the expression system currently used abroad. On the basis, the sgrhLF silkworm fibroin is separated and purified by urea, and His Trap is used at the present stage^TMThe rhLF protein with the purity of 90% can be obtained by one-step purification of the FF crude affinity chromatography column, and the purity of the recombinant protein is further improved through further optimization of the purification step. And then, CD spectral scanning is carried out on the secondary space structure of the recombinant protein obtained by purification, the result shows that the rhLF protein has a consistent secondary structure with the commercialized rhLF protein, and further the anti-inflammatory activity detection experiment result proves that the rhLF expressed by the silkworm silk gland has biological activity consistent with the commercialized rhLF.

Therefore, the hSRSE of the Ser1 expression system established in the prior art can realize the high-efficiency secretory expression of the foreign protein in the transgenic silkworm silk gland and produce the recombinant protein with biological activity through the recombinant expression, separation and purification and activity identification of the rhLF target foreign protein. The result shows that the hSRSE expression system can be a basic technical system of the practical process of the biological reaction of the silkworm silk gland.

Finally, it is noted that the above-mentioned preferred embodiments illustrate rather than limit the invention, and that, although the invention has been described in detail with reference to the above-mentioned preferred embodiments, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the scope of the invention as defined by the appended claims.

Sequence listing

<110> university of southwest

<120> modified human lactoferrin gene suitable for expression of silkworm silk gland, expression system and application thereof

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>2121

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atgggcagaa gaagaagatc tgtccaatgg tgcgctgtga gccagccgga agccaccaaa 60

tgtttccaat ggcagagaaa tatgagaaag gttagaggtc ctccagtctc ttgcataaaa 120

agagatagcc ccatccaatg tattcaggct atagccgaaa acagagctga cgccgtgaca 180

ttggatggtg gattcatcta cgaagctggt ctcgccccgt acaaactgag acccgttgct 240

gccgaagtct acggaaccga aagacaaccg agaacacact actacgctgt ggccgtggtt 300

aaaaagggcg gttctttcca attgaatgaa ctccagggtc tgaagagctg ccacaccggt 360

ctgagaagaa cagctggatg gaatgttcct actggcacct tgagaccatt cctcaactgg 420

acaggaccgc ccgaacctat tgaagctgcc gttgctagat tcttctcagc ctcttgcgtc 480

cctggagctg acaagggcca attcccaaat ttgtgcagac tctgtgctgg tactggagaa 540

aacaaatgcg ccttctcatc tcaggaacca tacttcagct actccggagc tttcaagtgt 600

ttgagagacg gcgctggtga cgtcgccttc ataagagaat ccaccgtgtt cgaagacctc 660

tcggatgaag ctgaaagaga cgaatacgaa ctgttgtgcc cggataacac aagaaaaccc 720

gttgacaaat tcaaggattg tcacctcgct agagtgccaa gtcacgctgt cgtggccaga 780

tcagttaatg gtaaagaaga tgctatctgg aacctcctga gacaagccca ggaaaaattc 840

ggaaaagaca agagcccgaa gttccaactg ttcggttcgc ccagtggaca gaaagacttg 900

ctcttcaagg atagtgctat cggattctca agagtccctc caagaattga ttccggcttg 960

tacctcggat cgggctactt cacagccatc cagaatttga gaaaatcaga agaagaagtt 1020

gctgccagaa gagctagagt tgtctggtgc gccgtcggtg aacaagaact gagaaagtgt 1080

aaccagtggt cgggcttgag tgaaggttca gtgacttgca gctccgcttc tacaactgaa 1140

gactgtattg ccctggtttt gaaaggcgaa gctgacgcca tgagcctgga tggaggctac 1200

gtctacaccg cttgcaagtg tggtctggtt cctgtcttgg ccgaaaatta caaatctcaa 1260

cagtcgtcag accctgaccc taactgcgtg gatagaccag ttgaaggata cttggctgtg 1320

gccgtggtta gaagatctga cacaagcctc acttggaaca gtgtcaaagg caaaaagtca 1380

tgtcacactg ctgtggacag aaccgccggt tggaatattc cgatgggact gttgttcaac 1440

caaactggct cctgcaagtt cgacgaatac ttctcacagt cttgtgctcc tggttccgat 1500

ccaagatcga atctgtgcgc cttgtgtata ggagacgaac aaggcgaaaa caaatgcgtc 1560

cccaattcga acgaaagata ctacggttac accggagctt tcagatgtct cgctgaaaat 1620

gccggagacg tcgccttcgt gaaggatgtg acagttctgc agaacactga tggcaacaat 1680

aacgaagctt gggccaaaga cctcaagctg gctgatttcg ccctcctgtg cctggacgga 1740

aaaagaaagc ctgtgactga agctagaagt tgtcacttgg ctatggcccc aaaccacgcc 1800

gtcgtgtcaa gaatggataa agtggaaaga ctgaagcaag ttttgctcca ccaacaggct 1860

aaattcggca gaaatggttc cgactgccct gataaattct gtttgttcca gtcggaaaca 1920

aagaacctgt tgttcaatga caacactgaa tgcctcgcta gactgcacgg caaaaccaca 1980

tacgaaaagt acctcggccc gcaatacgtt gctggtataa ctaatctgaa aaagtgcagc 2040

acctcccccc tcctggaagc ctgtgaattc ttgagaaaag aaaacctcta cttccagtca 2100

caccaccacc accaccacta a 2121

<210>2

<211>706

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Met Gly Arg Arg Arg Arg Ser Val Gln Trp Cys Ala Val Ser Gln Pro

1 5 10 15

Glu Ala Thr Lys Cys Phe Gln Trp Gln Arg Asn Met Arg Lys Val Arg

20 25 30

Gly Pro Pro Val Ser Cys Ile Lys Arg Asp Ser Pro Ile Gln Cys Ile

35 40 45

Gln Ala Ile Ala Glu Asn Arg Ala Asp Ala Val Thr Leu Asp Gly Gly

50 55 60

Phe Ile Tyr Glu Ala Gly Leu Ala Pro Tyr Lys Leu Arg Pro Val Ala

65 7075 80

Ala Glu Val Tyr Gly Thr Glu Arg Gln Pro Arg Thr His Tyr Tyr Ala

85 90 95

Val Ala Val Val Lys Lys Gly Gly Ser Phe Gln Leu Asn Glu Leu Gln

100 105 110

Gly Leu Lys Ser Cys His Thr Gly Leu Arg Arg Thr Ala Gly Trp Asn

115 120 125

Val Pro Thr Gly Thr Leu Arg Pro Phe Leu Asn Trp Thr Gly Pro Pro

130 135 140

Glu Pro Ile Glu Ala Ala Val Ala Arg Phe Phe Ser Ala Ser Cys Val

145 150 155 160

Pro Gly Ala Asp Lys Gly Gln Phe Pro Asn Leu Cys Arg Leu Cys Ala

165 170 175

Gly Thr Gly Glu Asn Lys Cys Ala Phe Ser Ser Gln Glu Pro Tyr Phe

180 185 190

Ser Tyr Ser Gly Ala Phe Lys Cys Leu Arg Asp Gly Ala Gly Asp Val

195 200 205

Ala Phe Ile Arg Glu Ser Thr Val Phe Glu Asp Leu Ser Asp Glu Ala

210 215 220

Glu Arg Asp Glu Tyr Glu Leu Leu Cys Pro Asp Asn Thr Arg Lys Pro

225 230 235 240

Val Asp Lys Phe Lys Asp Cys His Leu Ala Arg Val Pro Ser His Ala

245 250 255

Val Val Ala Arg Ser Val Asn Gly Lys Glu Asp Ala Ile Trp Asn Leu

260 265 270

Leu Arg Gln Ala Gln Glu Lys Phe Gly Lys Asp Lys Ser Pro Lys Phe

275 280 285

Gln Leu Phe Gly Ser Pro Ser Gly Gln Lys Asp Leu Leu Phe Lys Asp

290 295 300

Ser Ala Ile Gly Phe Ser Arg Val Pro Pro Arg Ile Asp Ser Gly Leu

305 310 315 320

Tyr Leu Gly Ser Gly Tyr Phe Thr Ala Ile Gln Asn Leu Arg Lys Ser

325 330 335

Glu Glu Glu Val Ala Ala Arg Arg Ala Arg Val Val Trp Cys Ala Val

340 345 350

Gly Glu Gln Glu Leu Arg Lys Cys Asn Gln Trp Ser Gly Leu Ser Glu

355 360 365

Gly Ser Val Thr Cys Ser Ser Ala Ser Thr Thr Glu Asp Cys Ile Ala

370 375 380

Leu Val Leu Lys Gly Glu Ala Asp Ala Met Ser Leu Asp Gly Gly Tyr

385 390 395400

Val Tyr Thr Ala Cys Lys Cys Gly Leu Val Pro Val Leu Ala Glu Asn

405 410 415

Tyr Lys Ser Gln Gln Ser Ser Asp Pro Asp Pro Asn Cys Val Asp Arg

420 425 430

Pro Val Glu Gly Tyr Leu Ala Val Ala Val Val Arg Arg Ser Asp Thr

435 440 445

Ser Leu Thr Trp Asn Ser Val Lys Gly Lys Lys Ser Cys His Thr Ala

450 455 460

Val Asp Arg Thr Ala Gly Trp Asn Ile Pro Met Gly Leu Leu Phe Asn

465 470 475 480

Gln Thr Gly Ser Cys Lys Phe Asp Glu Tyr Phe Ser Gln Ser Cys Ala

485 490 495

Pro Gly Ser Asp Pro Arg Ser Asn Leu Cys Ala Leu Cys Ile Gly Asp

500 505 510

Glu Gln Gly Glu Asn Lys Cys Val Pro Asn Ser Asn Glu Arg Tyr Tyr

515 520 525

Gly Tyr Thr Gly Ala Phe Arg Cys Leu Ala Glu Asn Ala Gly Asp Val

530 535 540

Ala Phe Val Lys Asp Val Thr Val Leu Gln Asn Thr Asp Gly Asn Asn

545 550 555560

Asn Glu Ala Trp Ala Lys Asp Leu Lys Leu Ala Asp Phe Ala Leu Leu

565 570 575

Cys Leu Asp Gly Lys Arg Lys Pro Val Thr Glu Ala Arg Ser Cys His

580 585 590

Leu Ala Met Ala Pro Asn His Ala Val Val Ser Arg Met Asp Lys Val

595 600 605

Glu Arg Leu Lys Gln Val Leu Leu His Gln Gln Ala Lys Phe Gly Arg

610 615 620

Asn Gly Ser Asp Cys Pro Asp Lys Phe Cys Leu Phe Gln Ser Glu Thr

625 630 635 640

Lys Asn Leu Leu Phe Asn Asp Asn Thr Glu Cys Leu Ala Arg Leu His

645 650 655

Gly Lys Thr Thr Tyr Glu Lys Tyr Leu Gly Pro Gln Tyr Val Ala Gly

660 665 670

Ile Thr Asn Leu Lys Lys Cys Ser Thr Ser Pro Leu Leu Glu Ala Cys

675 680 685

Glu Phe Leu Arg Lys Glu Asn Leu Tyr Phe Gln Ser His His His His

690 695 700

His His

705

<210>3

<211>4157

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ccatggcagc gtcgtgaaaa gaggcaatga caaatacaaa acgacgtatg agcagacccg 60

tcgccaagac gggtctacct ctaagatgat gtcatttgtt ttttaaaact aactcgcttt 120

acgagtagaa ttctacgtgt aaaacataat caagagatga tgtcatttgt ttttcaaaac 180

caaactcgct ttacgagtag aattctacgt gtaaaacaca atcaaaagat gatgtcattc 240

gtttttcaaa accgaattta agaaatgatg tcatttgttt ttcaaaacca aactcgcttt 300

acgagcagaa ttctacgtgt aaaacacaat caagagatga tgtcatttgt ttttcaaaac 360

tgaatgatgt catttgtttt tcaaaactaa acttgctttg cgagtagaat tctacgtgta 420

aaacacagtc aagagatgat gtcatttgtt tttcaaaact gaaccggctt tacgagtaga 480

attctacttg taaaacataa tcaagagatg atgtcatttg tttttcaaaa ctgaactggc 540

tttacgagta gaattctacg tgtaaaacat aatcaagaga tgatgtcatc attaaactga 600

tgtcatttta tacacgattg ttaacatgtt taataatgac taatttgttt ttccaaatta 660

aactcgcttt acgagtagaa ttctacttgt aacgcacgat taagtatgaa tcataagctg 720

atgtcatttg ttttcgacat aaaatgttta tacaatggaa tcttcttgta aattatccaa 780

ataatataat ttatccgatt ctacgttaca tttaaattcg ttgttatcgt acaattcttc 840

aggacacgcc atgtattggt catttttagc gtgcaaccaa cgattgtatt tgacgccgtc 900

gttggattgc gtgttcaggt tggcgtacac gtgactgggc acggcttctt tttccatggg 960

acgtcgacga aaacagcaca cacactacat accatgtatt tgacgcacac acgcatgtat 1020

actatttatt gtcaaacttt tgttcttgac gtctgtgttc aaactgagaa tagattaaat 1080

attgtttgtc tttattaata ttttttaata gtgtagtctt ggcgaaattt gtgattataa 1140

aagtataaaa tacaatcata atagtgtacg aacttacaat tccaattaat tatagtcgaa 1200

tttcgactac tgcgggacct ctagtattaa taattctctt taaaaaaaaa cagagcatca 1260

aatactgcac aaatgtcaag cgggtctcaa cgagccatga ataaattaga aatcaattaa 1320

taacataaaa taggcaaaca aaataaaacc atttacatag agaacgtttg ttgaacaaaa 1380

acaataactt gtatacattg tttgcacaaa tgtttgaagc gaaaatttat tactctctac 1440

gtaagcttga tcaaacttcg ttttcgtata aaacgcgttg gcccaaccac tttggcatag 1500

tcgtcttatc atcgggtctc taaggatcaa gcgatccaaa gaccgccaac atgcgtttcg 1560

ttctgtgctg cactttgatt gcgttggctg cgctcagcgt aaaagccttc ggtcaccacc 1620

ccggcaatcg agatacagga tccatgggca gaagaagaag atctgtccaa tggtgcgctg 1680

tgagccagcc ggaagccacc aaatgtttcc aatggcagag aaatatgaga aaggttagag 1740

gtcctccagt ctcttgcata aaaagagata gccccatcca atgtattcag gctatagccg 1800

aaaacagagc tgacgccgtg acattggatg gtggattcat ctacgaagct ggtctcgccc 1860

cgtacaaact gagacccgtt gctgccgaag tctacggaac cgaaagacaa ccgagaacac 1920

actactacgc tgtggccgtg gttaaaaagg gcggttcttt ccaattgaat gaactccagg 1980

gtctgaagag ctgccacacc ggtctgagaa gaacagctgg atggaatgtt cctactggca 2040

ccttgagacc attcctcaac tggacaggac cgcccgaacc tattgaagct gccgttgcta 2100

gattcttctc agcctcttgc gtccctggag ctgacaaggg ccaattccca aatttgtgca 2160

gactctgtgc tggtactgga gaaaacaaat gcgccttctc atctcaggaa ccatacttca 2220

gctactccgg agctttcaag tgtttgagag acggcgctgg tgacgtcgcc ttcataagag 2280

aatccaccgt gttcgaagac ctctcggatg aagctgaaag agacgaatac gaactgttgt 2340

gcccggataa cacaagaaaa cccgttgaca aattcaagga ttgtcacctc gctagagtgc 2400

caagtcacgc tgtcgtggcc agatcagtta atggtaaaga agatgctatc tggaacctcc 2460

tgagacaagc ccaggaaaaa ttcggaaaag acaagagccc gaagttccaa ctgttcggtt 2520

cgcccagtgg acagaaagac ttgctcttca aggatagtgc tatcggattc tcaagagtcc 2580

ctccaagaat tgattccggc ttgtacctcg gatcgggcta cttcacagcc atccagaatt 2640

tgagaaaatc agaagaagaa gttgctgcca gaagagctag agttgtctgg tgcgccgtcg 2700

gtgaacaaga actgagaaag tgtaaccagt ggtcgggctt gagtgaaggt tcagtgactt 2760

gcagctccgc ttctacaact gaagactgta ttgccctggt tttgaaaggc gaagctgacg 2820

ccatgagcct ggatggaggc tacgtctaca ccgcttgcaa gtgtggtctg gttcctgtct 2880

tggccgaaaa ttacaaatct caacagtcgt cagaccctga ccctaactgc gtggatagac 2940

cagttgaagg atacttggct gtggccgtgg ttagaagatc tgacacaagc ctcacttgga 3000

acagtgtcaa aggcaaaaag tcatgtcaca ctgctgtgga cagaaccgcc ggttggaata 3060

ttccgatggg actgttgttc aaccaaactg gctcctgcaa gttcgacgaa tacttctcac 3120

agtcttgtgc tcctggttcc gatccaagat cgaatctgtgcgccttgtgt ataggagacg 3180

aacaaggcga aaacaaatgc gtccccaatt cgaacgaaag atactacggt tacaccggag 3240

ctttcagatg tctcgctgaa aatgccggag acgtcgcctt cgtgaaggat gtgacagttc 3300

tgcagaacac tgatggcaac aataacgaag cttgggccaa agacctcaag ctggctgatt 3360

tcgccctcct gtgcctggac ggaaaaagaa agcctgtgac tgaagctaga agttgtcact 3420

tggctatggc cccaaaccac gccgtcgtgt caagaatgga taaagtggaa agactgaagc 3480

aagttttgct ccaccaacag gctaaattcg gcagaaatgg ttccgactgc cctgataaat 3540

tctgtttgtt ccagtcggaa acaaagaacc tgttgttcaa tgacaacact gaatgcctcg 3600

ctagactgca cggcaaaacc acatacgaaa agtacctcgg cccgcaatac gttgctggta 3660

taactaatct gaaaaagtgc agcacctccc ccctcctgga agcctgtgaa ttcttgagaa 3720

aagaaaacct ctacttccag tcacaccacc accaccacca ctaagcggcc gctacaacta 3780

aacacgactt ggagtattcc ttgtagtgtt taagatttta aatcttactt aatgacttcg 3840

aacgatttta acgataactt tctctttgtt taactttaat cagcatacat aaaaagcccc 3900

ggttttgtat cgggaagaaa aaaaatgtaa ttgtgttgcc tagataataa acgtattatc 3960

aaagtgtgtg gttttccttt accaaagacc cctttaagat gggcctaatg ggcttaagtc 4020

gagtcctttc cgatgtgtta aatacacatt tattacactg atgcgtcgaa tgtacacttt 4080

taataggata gctccactaa aaattatttt atttatttaa tttgttgcac caaaactgat 4140

acattgacga aaagctt 4157

Claims (8)

1. Be suitable for transformation human lactoferrin gene of silkworm silk gland expression, its characterized in that: the modified human lactoferrin gene is shown in SEQ ID NO. 1.

2. An expression vector containing the modified human lactoferrin gene suitable for the expression of silk glands of silkworms of claim 1.

3. The expression vector of claim 2, wherein: the expression vector contains sequentially connected enhancer hr3, secretory sericin1 gene promoter, modified human lactoferrin gene and sericin1 gene terminator.

4. The expression vector of claim 2, wherein: the expression vector also contains a fluorescent screening marker gene expression cassette, which is located upstream of the enhancer hr 3.

5. Use of the expression vector of claim 3 or 4 for expressing recombinant human lactoferrin in bombyx mori glands.

6. A method for expressing recombinant human lactoferrin in bombyx mori silkworm gland using the expression vector of claim 3 or 4, comprising the steps of: and (2) converting the expression vector to remove diapause silkworm eggs, sealing the silkworm eggs with non-toxic glue, sterilizing the silkworm eggs with formaldehyde steam, incubating, screening transgenic positive moth rings, taking positive transgenic silkworm cocoon shells, crushing the positive transgenic silkworm cocoon shells into powder in liquid nitrogen, dissolving the powder in a buffer solution containing 50mM Tris-Cl, 8M Urea and pH 8.0, carrying out water bath at 80 ℃ for 40min, centrifuging, collecting supernatant, and purifying to obtain the recombinant human lactoferrin.

7. The method of claim 6, wherein: the concentration of the cocoon shell powder dissolved in the buffer solution is 20 mg/mL.

8. The method of claim 6, wherein the purification is performed in a specific mannerThe method comprises the following steps: passing the supernatant through HisTrap^TMAnd (3) eluting the FF chromatography column by using imidazole eluent with the concentration of 0-500 mM, preparing the imidazole eluent by using a Urea solution with the pH of 7.0-7.5 and the concentration of 8M, and collecting the eluent, wherein the eluent is the purified recombinant human lactoferrin.

Images