CN108464984A - A kind of epigenetic drug for treating osteosarcoma - Google Patents

Abstract

The invention discloses applications of the inhibitor GSK J4 of histone demethylase in preparing clinical treatment of osteosarcoma drug.It is related to clinical treatment of osteosarcoma that histone demethylase KDM5B is demonstrated for the first time.GSK J4 significantly inhibit human osteosarcoma cell proliferation by acting on this enzyme, therefore GSK J4 can become the new breakthrough mouth for preparing treatment osteosarcoma novel drugs；In addition the present invention also makes public for the first time the transfer ability that GSK J4 inhibit osteosarcoma cell by targeting KDM5B, and the drug for research and development treatment osteosarcoma with lung transfer and Bone tumour provides new thinking.

Description

A kind of epigenetic drug for treating osteosarcoma

Technical field

The present invention relates to pharmaceutical technology fields, and in particular to a kind of histone demethylase inhibitor is preparing osteosarcoma Application in medicine.

Background technology

Osteosarcoma is also known as osteogenic sarcoma, refers to a kind of pernicious connective that oncocyte can directly generate neoplastic bone and osteoid tissue Tissue tumor, incidence occupy first place in primary malignant tumor, are one of most common pernicious Boneforming tumors.The tumor Grade malignancy is very high, give it is rear very poor, can be in occurring lung's transfer in the several months, 3~5 annual survival rates are only 5~20% after amputation.It is swollen Tumor many places are accidental to be born in backbone or epiphysis in epiphysis.It is happened at account for about all osteosarcoma four of distal part of femur and proximal ends of tibia / tri-, other places such as humerus, proximal femur, fibula, vertebra, ilium etc. can also occur.Majority is osteolytic, also has the minority to be Osteogenic can be happened at any age, but mostly at 10~25 years old, male is more.Common osteosarcoma can be divided into：1, blood vessel Dilatancy osteosarcoma；2, differentiated intracortical osteosarcoma；3, differentiated intramedullary bone sarcoma；4, round cell osteosarcoma；5, by bone (by cortex) osteosarcoma；6, parosteal osteosarcoma is dedifferented.Have lung's micro metastasis, hair when most of Patients with Osteosarcoma are made a definite diagnosis The patient of raw Lung metastases lacks effective medicine, therefore metastases are the lethal major reasons of osteosarcoma.

The treatment means of current osteosarcoma are mainly operative treatment joint new adjuvant chemotherapy, and new adjuvant chemotherapy emphasizes preoperativeization Row tumorectomy formulates postoperative chemotherapy scheme, and continue chemotherapy half a year to 1 according to neoplasm necrosis degree again after treating 8~12 weeks Year.Currently, common chemotherapeutics has methopterin, adriamycin, cis-platinum and ifosfamide, wherein the toxic side effect packet of chemotherapy Include granulocyte, blood platelet decline and caused infection.The Clinical Trials for being clinically directed to osteosarcoma do not obtain always obviously Progress, it would be highly desirable to the drug for the treatment of osteosarcoma is sought by new thinking.The change of epigenetic regulation is the several important of cancer One of characteristic mark.Epigenetic regulation includes mainly three types：DNA methylation, histone modification and non-coding RNA (non-coding RNA).It being mutated different from genomic DNA, the gene expression regulation in epigenetics level is reversible, Therefore, the enzyme for adjusting epigenetic modification can be used as the most appropriate drug targets for the treatment of relevant disease.It finds suitable apparent For hereditary enzyme as clinical treatment of osteosarcoma target spot, targetedly formulating therapeutic strategy becomes an urgent demand for improving osteosarcoma survival rate.

GSK-J4 (CAS number 1373423-53-0), structure is shown in formula I, is a kind of Histone Demethylase inhibitor. The prior art think GSK-J4 by the demethylase UTX of the 27th amino acids of inhibition of histone H3 (also known as KDM6A) and JMJD3 (also known as KDM6B) activation plays effect, inhibits the proliferation of glioma and breast cancer cell.

Invention content

Inventor finally determines under study for action, inhibit epigenetic enzyme KDM5B (NCB I accession number NM_001314042.1, GENE I D:10765, SEQ I D NO:1) can effectively control the development of osteosarcoma, GSK-J4 can useful effect in KDM5B enzymes Activity, and then downstream gene expression is influenced, the final proliferative capacity and transfer ability for inhibiting osteosarcoma cell.The I of GSK-J4 C50 values are about 1-10 μ g/ml, have apparent inhibition to Growth of Osteosarcoma.Growths of the GSK-J4 for normal cell, generation It thanks and has no significant effect, toxic side effect is low.In addition, GSK-J4 can also be combined with chemotherapeutics, increase cell to chemotherapeutics Sensibility, so targeting kinases or transcription factor phase of the GSK-J4 as drug made of active ingredient and previous treatment osteosarcoma Than having more obvious advantage.

First demonstration that KDM5B enzymatic activitys are related to clinical treatment of osteosarcoma, by GSK-J4 specificity inhibit KDM5B from And inhibit osteosarcoma.Epigenetic enzyme inhibitor GSK-J4 is inhibiting the human osteosarcoma cell proliferation to have a remarkable effect, and GSK-J4 will be at To prepare the new breakthrough mouth for the treatment of osteosarcoma novel drugs；Present invention firstly discloses GSK-J4 by inhibit KDM5B enzymatic activitys from And inhibiting the transfer ability of osteosarcoma cell, the drug for research treatment osteosarcoma with lung transfer and Bone tumour provides new thinking.

The present invention provides a kind of target spot KDM5B that epigenetic drug GSK-J4 is functioned and its applications.

The present invention provides a kind of application of histone demethylase inhibitor in preparing clinical treatment of osteosarcoma drug.Its Described in histone demethylase inhibitor be GSK-J4 can be specifically the water soluble salt of GSK-J4.Either MiRNA, siRNA, dsRNA or the shRNA of inhibition of histone demethylase, particularly, the epigenetic enzyme is KDM5B。

The present invention provides a kind of drugs for treating osteosarcoma, it is characterised in that the drug inhibits comprising epigenetic enzyme Agent, particularly, the epigenetic enzyme is KDM5B.The epigenetic enzyme inhibitor is activity inhibitor and/or base Because of expression inhibiting agent.Wherein the gene expression inhibitor is preferably miRNA, siRNA, dsRNA or shRNA.Or wherein The epigenetic enzyme inhibitor is that GSK-J4 is specifically the water soluble salt of GSK-J4.

The present invention provides applications of the epigenetic enzyme KDM5B in the drug of screening treatment osteosarcoma.

The GSK-J4 concentration ranges that this programme provides are 1-10M.

Scheme provided by the invention is that GSK-J4 is acted on KDM5B, to the transfer to Growth of Osteosarcoma and osteosarcoma With apparent inhibition.Technical solution dosage provided by the invention is low, substantially reduces drug side-effect.It is measured through experiment Technical solution provided by the invention can obviously inhibit osteosarcoma cell to grow and shift, and have preferable antitumor efficacy.

Description of the drawings

Fig. 1 shows using the cell viability measuring drug GSK-J4 inhibition to the survival rate of 5 kinds of osteosarcoma cells respectively Effect

Fig. 2 shows the suppression of detection GSK-J4 tumor formations in experimental animal body to osteosarcoma cell SJSA1 cells and 143B cells It makes and uses；Wherein, the A figures left side be SJSA1 cell skins under tumor formation tumour growth volume curve, the right be 143B cell skins under at The tumour growth volume curve of tumor.B figures are the tumour that each experimental group is taken out after dissecting, and are from top to bottom followed successively by according to group, GSK-J4 Group 25mg/kg groups, GSK-J4 group 50mg/kg groups, GSK-J4 group 100mg/kg groups.

Fig. 3 shows measures GSK-J4 for SJSA1 cells and 143B cell migrations using Transwell Cell migration assays Inhibiting effect.Drug is added in the upper chamber of Tranwell, and concentration is respectively 0M, 2.5M, 5M and 10M from left to right, is detected 24 hours The cell concentration of room under Transwell is moved to afterwards.

Fig. 4 shows changes (A) using KDM5B gene expression amounts after KDM5B shRNA interference, is interfered using KDM5B shRNA And 143B cell quantities change the inhibiting effect (C) of (B) and 143B cell migrations after GSK-J4.The result shows that the expression of KDM5B Amount significantly affects proliferation and the migration of 143B cells.

Specific implementation mode

With reference to embodiment, the present invention is further explained：

In following case study on implementation, inhibiting rate+survival rate=1.

1. embodiment 1

GSK-J4 is for use after being configured according to various concentration.

By the method for MTT experiment, detection test various concentration GSK-J4 to human osteosarcoma cell 143B, MG63, MNNG, The influence of SJSA1 and U2 proliferation.By 143B (the ATCC numbers CRL-8303 in the exponential rise period^TM, people source, Epithelial patch Wall grow), MG63 (ATCC numbers CRL-1427^TM, people source, Epithelial adherent growth), MNNG (ATCC numbers CRL-1547^TM, People source, Epithelial adherent growth), SJSA1 (ATCC numbers CRL-2098^TM, people source, Epithelial adherent growth) and U-2OS cells (ATCC numbers HTB-96^TM, people source, Epithelial adherent growth), it is digested respectively with pancreatin, dispels into single cell suspension, counted, connect In kind to 96 well culture plates.It cultivates in the incubator for 24 hours, after cell is adherent, the GSK-J4 that various concentration is added (is purchased from Selleck, article No. S7070), culture is terminated after acting on 48h respectively, 20 μ l MTT (5mg/mL) are added per hole, 37 DEG C are protected from light and incubate Educate 4h.Then liquid in each hole is discarded, 150 μ L DMSO is added, shaken 15min, so that crystal is fully dissolved, in enzyme mark Cell OD value is measured under instrument 490nm wavelength.

Inhibiting effect of the GSK-J4 to two kinds of cell line cells of osteosarcoma is detected using above-mentioned MTT methods respectively.Drug is made With relationship computational methods：Survival rate=(experimental group numerical value-blank group numerical value)/(values of control groups-blank group numerical value)

Experimental result：

The result shows that GSK-J4 pairs of five kinds of osteosarcoma cell 143B, MG63, MNNG, SJSA1 and U-2OS cells all have compared with Good inhibiting effect (Fig. 1).It is wherein best for MNNG and U-2OS inhibitions.

2. embodiment 2

There is inhibiting effect for Growth of Osteosarcoma using animal model verification GSK-J4.Experiment uses 6 week old Female nude mices, Purchased from Guangdong Province's Experimental Animal Center, weight is between 15~20g, sub-cage rearing under the conditions of without special pathogen (SPF), 12h alternate illuminations, free diet.Osteosarcoma cell 143B and SJSA1 use the DMEM high sugar trainings containing 10% high-quality fetal calf serum Nutrient solution culture to exponential phase is tested.It is thin with 5% trypsinized enzymic digestion when the bottom of bottle of cell confluent cultures bottle Born of the same parents, high-quality fetal calf serum terminate digestion, gently blow and beat to cell all from wall, 1500 revs/min of centrifugation 5min abandon supernatant.It uses again Brine cell 2 times.Cell is resuspended in physiological saline after the completion of washing, and adjustment cell concentration is 10⁷/ ml, under preserved skin at Tumor is used.For each osteosarcoma cell subcutaneous implantation tumor model, nude mice is randomly divided into four groups, every group 10, numbers respectively, carries out Preceding armpit is subcutaneously injected 10⁷150 μ l of/ml cell suspensions.Then 0mg/kg, 25mg/kg is injected intraperitoneally according to every group of difference next day, 50mg/kg, 100mg/kgGSK-J4 are administered 5 times altogether.

Start to measure tumour major diameter (a) and minor axis (b) after 2 days after 5 injections, according to formula V=ab²/ 2 calculate Gross tumor volume.And nude mice is put to death after 6 weeks in inoculating cell suspension, tumor formation rate is calculated, strips tumour.Whether there is or not tumours for observation at a distance Send out transfer.Tumor tissues are taken to make pathological section, microscopically observation microvessel density difference.Data result is with χ ± s tables Show, data processing is carried out using SPSS15.0 softwares.Comparison among groups are carried out using chi-square criterion.Use P<0.05 indicates the notable of difference Property.

As a result show that GSK-J4 is notable for the tumor growth inhibitory effect of osteosarcoma, and inhibition and drug dose Dose dependent (Fig. 2) is showed, shows that GSK-J4 is likely to become the drug for the treatment of osteosarcoma.

3. embodiment 3

There is inhibition for osteosarcoma cell 143B and SJSA1 bone and flesh tumor metastasis using Transwell experimental verifications GSK-J4 It acts on (Fig. 3).

One piece of 24 orifice plate is taken, 24 cells Transwell are added, are divided into 8 groups, 4 groups of each cell, every group of 3 multiple holes.According to It is secondary to each small indoor 50 μ L BD matrigel matrigels of addition, the DMEM cultures of 50 μ L serum-frees are added after its solidification Base, then successively in the small indoor 143B or SJSA1 cells for being inoculated with exponential phase respectively, 50 μ L culture mediums of every hole containing 2 × 10⁴ A cell.GSK-J4 is added in the upper chamber of Tranwell, and concentration is respectively 0 μM, 2.5 μM, 5 μM and 10 μM from left to right.Edge respectively 24 orifice plate hole walls are slowly added to the 500 μ L of cell culture medium containing 10% fetal calf serum, are placed in 5%CO2,37 DEG C of constant temperature and humidity cultures It is cultivated for 24 hours in case.It waits removing culture medium in the cells Transwell and hole after testing successively, PBS is cleaned 3 times, 10min/ It is secondary.After sequentially adding 500 μ L paraformaldehydes fixation 30min along hole wall, paraformaldehyde is removed.It is sequentially added further along hole wall 500 μ L violet staining 10min remove Crystal Violet Dye.The cells Transwell are placed in distilled water and are rinsed 3 times, cotton swab is used Gently the droplet of small chamber interior walls is dried, cell, which is placed in ventilation, waits for that it is air-dried.The cell air-dried under gently being hung with blade Counterdie is placed in mounting on slide, and mounting, which is placed in ventilation after it is air-dried, takes pictures under microscope, handles picture and data.

As a result it shows：GSK-J4 can inhibit the transfer ability of osteosarcoma cell, and as the increase of dosage inhibits to imitate Fruit is more preferably apparent (P ＜ 0.01).This is the result shows that GSK-J4 is likely to become the drug for the treatment of bone and flesh tumor metastasis.

4. embodiment 4

Confirm that KDM5B expressions inhibit GSK-J4 the shadow of osteosarcoma cell vigor and transfer ability using gene knockout It rings

It is ATCGCTTGCTTCATCGATATT (SEQ ID NO using targeting sequence：2) shRNA (SEQ ID NO：3) KDM5B genes are carried out to strike drop, do not strike drop and strike the degree (Fig. 4 A) of KDM5B expression downwards in the case of two kinds of drop.By bone Sarcoma cell line 143B cells are divided into four groups, and I groups are dropped for no clpp gene and the control group of GSK-J4；GSK-J4 is added in II groups；III Group is that KDM5B clpp genes are come down to a lower group；IV groups are carried out at the same time GSK-J4 processing and KDM5B strikes drop.It is cultivated under same culture conditions, profit The influence that drop inhibits GSK-J4 osteosarcoma cell vigor and transfer ability is struck with the method observation KDM5B in embodiment 2 and example 3

Table 1 strikes the shRNA sequences of drop KDM5B genes

The result shows that：Its vigor of the repressed cell of KDM5B genes and transfer ability be remarkably decreased, and KDM5B strikes Drop cannot be further increased inhibitions (Fig. 4 B and 4C) of the GSK-J4 to osteosarcoma cell vigor and transfer ability.Such knot Fruit shows that KDM5B is to regulate and control the key gene of osteosarcoma cell vigor and transfer ability, and is GSK-J4 in osteosarcoma cell In target spot.GSK-J4 for the inhibiting effect of osteosarcoma cell vigor and transfer ability is realized by KDM5B.

It is above the wherein specific implementation of the present invention, the description thereof is more specific and detailed, but can not therefore manage Solution is the limitation to the scope of the claims of the present invention.It should be pointed out that for those of ordinary skill in the art, not departing from Under the premise of present inventive concept, various modifications and improvements can be made, these obvious alternative forms belong to this hair Bright protection domain.

Sequence table

<110>The Xuzhou bio tech ltd Wei Kang

<120>A kind of epigenetic drug for treating osteosarcoma

<130> 201810083

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4743

<212> DNA

<213>People (Homo sapiens)

<400> 1

atggaggcgg ccaccacact gcacccaggc ccgcgcccgg cgctgcccct cgggggcccg 60

ggcccgctgg gcgagttcct gcctccaccc gagtgcccgg tcttcgaacc cagctgggaa 120

gagttcgcgg accccttcgc tttcatccac aagatccggc ccatagccga gcagactggc 180

atctgtaagg tgcggccgcc gccggattgg cagccaccat ttgcatgtga tgttgataaa 240

cttcatttta cgccacgtat ccagagactg aatgaattgg aggcccaaac tcgtgtaaaa 300

ttgaatttct tggaccagat tgcaaagtac tgggagttac agggaagtac tctgaaaatt 360

ccacatgtgg agaggaagat cttggactta tttcagctta ataagttagt tgcagaagaa 420

ggtggatttg cagttgtttg caaggataga aaatggacca aaattgctac caagatgggg 480

tttgctcctg gcaaagcagt gggctcacat atcagagggc attatgaacg aattctcaac 540

ccctacaact tattcctgtc cggagacagc ctaaggtgtt tgcagaagcc aaacctgacc 600

acagacacta aggacaagga gtacaaaccc catgatattc cccagaggca gtctgtgcag 660

ccttcggaaa cgtgcccccc agcccgacga gcaaaacgca tgagagcaga gagacagagt 720

ctcgctgtgt tgcccaggct ggagtgcagt ggcgcgatct tggctcactg caacctccgc 780

ctcctagatt ccagcaattc ttctgcctca gcctcccaag ccatgaatat taaaatagaa 840

cccgaggaga caacggaagc cagaactcat aatctgagac gtcgaatggg ttgtccaact 900

ccaaaatgtg aaaatgagaa agaaatgaag agtagcatca agcaagaacc tattgagagg 960

aaagattata ttgtagaaaa tgagaaggaa aagcccaaga gtcgatctaa aaaagccacc 1020

aatgctgtgg acctgtatgt ctgtctttta tgtggcagtg gcaatgatga agaccggcta 1080

ctgttgtgtg atggctgtga tgacagttac catacctttt gcttgatccc acctctccat 1140

gatgttccca agggagactg gaggtgtcct aagtgtttgg ctcaggaatg tagtaagcca 1200

caagaagcat ttggctttga acaagcagcc agggactata ccctccgtac ttttggggaa 1260

atggcagatg cgttcaaatc tgattacttc aacatgccag tccatatggt ccccacagag 1320

cttgttgaga aagaattttg gagactagta agcactattg aggaggatgt cacagtggaa 1380

tatggagctg acattgcctc aaaggaattt ggcagtggct ttcctgtccg agatgggaaa 1440

atcaaactct cacctgagga agaggagtat cttgatagtg gctggaattt gaacaacatg 1500

ccagtgatgg agcagtctgt ccttgcacat attactgctg atatatgtgg catgaaactt 1560

ccttggttgt atgtgggaat gtgcttttct tcattctgtt ggcacattga agaccactgg 1620

agctattcaa ttaactactt gcactggggt gagccaaaaa cctggtatgg agtcccaggg 1680

tatgctgctg agcagctaga aaatgtaatg aagaaactag ctccagaact ctttgtgtcc 1740

cagccggatc tcctccatca gcttgtgacc atcatgaacc ccaataccct gatgactcat 1800

gaagtgcctg tttaccgaac taatcagtgt gctggggagt ttgtgattac atttccaaga 1860

gcctaccaca gtggttttaa ccagggtttt aattttgctg aggctgttaa cttctgcact 1920

gttgattggc tgccattagg ccgacagtgt gtggagcatt atcgcttgct tcatcgatat 1980

tgtgtgtttt cccacgatga gatgatctgc aagatggctt ccaaggctga tgtattagat 2040

gttgtagtgg cttcaactgt tcagaaagac atggccatta tgattgagga tgagaaagct 2100

ttaagagaaa ctgtccgtaa attgggagtg attgattcgg aaagaatgga ttttgagctg 2160

ttgccagatg atgaacgtca gtgtgtaaaa tgcaaaacta catgcttcat gtctgccatc 2220

tcctgttctt gtaaacctgg ccttcttgtt tgcctgcatc atgtaaaaga attgtgttcc 2280

tgtcctcctt acaaatataa attgcggtat aggtacacgc tggatgatct ctaccctatg 2340

atgaatgcat tgaagcttcg agcagaatct tacaacgaat gggccttgaa tgtgaatgaa 2400

gctttggagg caaagatcaa caagaagaaa agccttgtca gcttcaaggc tttaattgaa 2460

gaatctgaaa tgaagaaatt cccagacaat gatcttttgc gacaccttcg cctagtcaca 2520

caggatgcag agaagtgtgc ctctgttgcg cagcagttgc ttaatggcaa aaggcaaact 2580

agatatcgat ctggtggagg gaaatcccaa aatcagttga cagtgaatga gctccggcag 2640

tttgtaacac agctgtatgc tcttccatgt gtcctcagtc agacaccatt actaaaggat 2700

ctcttgaatc gtgtagaaga ttttcaacag catagtcaga aactactctc tgaggaaacg 2760

cctagtgctg cggagctgca ggacttgcta gatgtcagct ttgaatttga tgttgaactt 2820

ccacagcttg ctgagatgcg tatccgtttg gaacaagccc gttggctaga agaggtgcag 2880

caagcttgcc tagaccccag ctcccttact ttagatgata tgagacgtct catagaccta 2940

ggggtagggc tggccccgta ttcagcagtg gagaaagcta tggcccggct gcaggaactg 3000

ctcacagtgt cagagcactg ggacgacaaa gccaagagtc tcctcaaggc caggccacga 3060

cattcattga atagccttgc tacggcagta aaggaaatcg aagagatccc tgcatatctg 3120

cccaatggtg cggctctgaa agactcagtg cagagagcca gagactggct tcaggatgta 3180

gagggcctgc aggctggagg acgtgtgcca gtgttagaca cactcataga acttgttaca 3240

cgaggccgat ctatccccgt acatctgaat tctttgccaa gactggaaac cctagtagct 3300

gaggttcagg cttggaaaga atgtgctgtt aatacattct tgactgagaa ttctccatat 3360

tctctcttag aggtgctgtg tcctcgatgt gatattggcc ttttgggatt gaaaaggaag 3420

cagagaaagt taaaggagcc cttgccaaat ggaaagaaaa aaagcaccaa attagagagt 3480

ctgagtgacc tggagagagc tttaactgaa agcaaggaga ctgcttcagc tatggcaact 3540

cttggggaag ctcgcctaag ggaaatggaa gccttgcagt ctctcagact cgccaatgaa 3600

gggaaattgc tgtcgcctct ccaagatgtg gatataaaaa tctgcctatg tcagaaggcc 3660

ccagctgccc ctatgattca atgtgaactc tgcagggatg ctttccacac cagttgtgtg 3720

gcggtaccca gtatttcaca gggcctgcga atctggcttt gtccccattg tcggaggtca 3780

gagaaacctc cattagagaa aattctgccc ctgctcgcct cccttcagcg tatccgagtt 3840

cgccttcctg agggagatgc acttcgatat atgattgaaa gaaccgtgaa ctggcagcac 3900

agagcccagc aactgctttc gtcagggaat cttaaatttg tgcaagatcg agtgggctca 3960

ggactgttat atagcagatg gcaagcctca gcaggacagg tgtcagacac aaacaaggta 4020

tctcaacctc ctggcacaac atcattttct ttgcctgatg actgggacaa cagaacctca 4080

tatttgcact cccccttctc aactggacga agttgtatcc ccctccatgg tgttagtcca 4140

gaagtgaatg aactattgat ggaagcccag ctgctccagg tatcccttcc tgaaattcag 4200

gaactttacc agactttact tgcaaagcca agccctgctc agcagactga ccgaagctca 4260

ccagtgagac ccagcagtga gaagaatgac tgttgccgag ggaagcgaga tggaattaac 4320

agtcttgaga gaaaactgaa gagacgcctg gaaagagagg gcctctccag tgagcggtgg 4380

gaacgagtta agaaaatgcg gacccccaaa aagaagaaaa tcaaactgag ccaccccaag 4440

gacatgaaca atttcaagtt agagagagag cgtagctatg aattagttcg ttctgctgaa 4500

actcattccc tgccctcaga cacatcctat tccgaacagg aagactctga ggatgaagat 4560

gccatctgcc cagctgtgag ctgcctgcag ccagaaggag atgaggtgga ctgggtccag 4620

tgtgatggca gctgcaatca gtggtttcat caggtctgtg ttggtgtctc cccagagatg 4680

gcagagaaag aagactacat ctgtgtgcgc tgtactgtga aggacgcacc aagccgaaag 4740

taa 4743

<210> 2

<211> 21

<212> DNA

<213>People (Homo sapiens)

<400> 2

atcgcttgct tcatcgatat t 21

<210> 3

<211> 57

<212> DNA

<213>Artificial sequence (artificial)

<400> 3

ccggatcgct tgcttcatcg atattctcga gaatatcgat gaagcaagcg atttttt 57

Claims (10)

1. a kind of application of histone demethylase inhibitor in the drug for preparing treatment osteosarcoma.

2. application according to claim 1, wherein the histone demethylase inhibitor is GSK-J4.

3. application according to claim 2, wherein the histone demethylase inhibitor is the water solubility of GSK-J4 Salt.

4. a kind of drug for treating osteosarcoma, it is characterised in that the drug includes histone demethylase inhibitor.

5. drug according to claim 4, it is characterised in that the histone demethylase inhibitor is KDM5B suppressions Preparation.

6. drug according to claim 4 or 5, wherein the histone demethylase inhibitor is inhibition of enzyme activity Agent and/or gene expression inhibitor.

7. drug according to claim 6, wherein the gene expression inhibitor is the miRNA of inhibition of gene expression, SiRNA, dsRNA or shRNA.

8. drug according to claim 4, it is characterised in that the histone demethylase inhibitor is targeting SEQ ID NO:The inhibitor of nucleic acid shown in 2.

9. drug according to claim 8, it is characterised in that the histone demethylase inhibitor is SEQ ID NO:ShRNA shown in 3.

10. applications of the epigenetic enzyme KDM5B in the drug of screening treatment osteosarcoma.