CN108441573B

CN108441573B - Camellia oleifera miRNA and application thereof

Info

Publication number: CN108441573B
Application number: CN201810236793.5A
Authority: CN
Inventors: 覃佐东; 刘晓霞; 罗小芳; 李治章; 何福林; 管天球
Original assignee: Hunan University of Science and Engineering
Current assignee: Hunan University of Science and Engineering
Priority date: 2018-03-21
Filing date: 2018-03-21
Publication date: 2021-08-24
Anticipated expiration: 2038-03-21
Also published as: CN108441573A

Abstract

The invention discloses a tea-oil tree miRNA and application thereof, and relates to the technical field of botany. The miRNA of the camellia oleifera is miR156, and the base sequence of the miR156 is shown in SEQ ID No. 1. The target gene of the miR156 in the invention is CL15005.Contig2_ All. The miR156 acts on a target gene CL15005.Contig2_ All, the target gene CL15005.Contig2_ All is expressed to generate butanol dehydrogenase for catalyzing 13-hydroxyoctadecadienoic acid to generate 13-oxo-octadecadienoic acid, and the expression of the miR156 and the target gene CL15005.Contig2_ All thereof is in significant negative correlation, so that the miR156 plays an important role in regulating and controlling the expression of the butanol dehydrogenase, the expression of the miR156 can regulate and control the metabolism of linoleic acid in the oil-tea tree, and the yield and the quality of the oil-tea tree can be improved by regulating and controlling the expression of the miR 156.

Description

Camellia oleifera miRNA and application thereof

Technical Field

The invention relates to the technical field of botany, and particularly relates to a tea-oil tree miRNA and application thereof.

Background

The camellia oleifera is an important woody oil plant originated from China, and can obtain the camellia oleifera oil from the kernel thereof. Tea oil is an edible oil of medicinal value, containing up to 90% of unsaturated fatty acids (including oleic, linoleic and palmitic acids) and a small amount of saturated fatty acids, and is called "eastern olive oil" because its fatty acid composition is similar to olive oil. The ripening process of the fruit of the camellia oleifera is a process of synthesizing and storing nutrient components, wherein oil is one of important nutrient accumulation substances, and the content and the quality of fatty acid are directly related to the economic value of the camellia oleifera. During the ripening process of the camellia oleifera fruits, the relative content of oleic acid gradually increases, and the relative content of linoleic acid is in a descending trend. At present, genes related to oil and fat synthesis, such as BCCP, ECH and FAD8, are cloned from oil tea trees, but the molecular basic research of oil tea trees is weak, particularly the molecular mechanism determining the yield and quality of oil tea trees, so the research on oil and fat synthesis in oil tea trees is still in an exploration stage.

MicroRNA (miRNA) is a non-coding single-stranded molecule with the size of about 22nt, recognizes target mRNA in a base complementary pairing mode, and leads to degradation or translation inhibition of the target mRNA according to different complementary degrees, thereby playing a role in carrying out negative regulation and control on gene expression at the level of transcription and post-transcription. The action mode of plant miRNA is mainly to cut target genes, most plant miRNAs precursors (pri-miRNA) are derived from transcription units of the plant miRNAs, are transcribed by RNA polymerase II (Pol II), and are transported to cytoplasm in the form of miRNA after the intracellular assembly and the enzyme catalysis, wherein the miRNA is degraded by small RNA degrading enzyme (SDN), and the other functional mature methylated miRNA and AGO protein (Argonaute) form RNA-induced silencing complex (RISC). The AGO1 protein in the RISC can directly cut the base complementary with the 10 th or 11 th position of the miRNA to form a small fragment and degrade the target mRNA, thereby leading to the degradation of the target gene.

Research has shown that miRNA plays an important role in plant growth, embryo development, organ development and maturation and stress resistance. At present, 223 species, 28645 precursor miRNAs and 35828 mature miRNAs are recorded in miRBase21.0 (http:// www.mirbase.org /), research objects mainly focus on herbaceous plants such as arabidopsis thaliana and sorghum, gramineae rice and corn, and reports on woody plants are less, particularly on the miRNAs of camellia oleifera. Due to the relative lack of gene background information of camellia oleifera, only a small number of miRNA of camellia oleifera discovered and subjected to predictive analysis so far are mirnas 5067, miR2118, miR482 and miR1861, which are involved in lipid synthesis.

Therefore, there is a need to further explore and identify functional mirnas in camellia oleifera, especially mirnas regulating lipid synthesis and metabolism, explore a mechanism for accumulating lipid in camellia oleifera fruits from a molecular level, and improve yield and quality of camellia oleifera.

Disclosure of Invention

In view of the above, the present invention aims to provide a tea-oil tree miRNA and an application thereof, wherein the tea-oil tree miRNA can regulate and control expression of butanol dehydrogenase (camellia dehydrogenase), that is, the tea-oil tree miRNA can regulate and control a process of catalyzing 13-hydroxyoctadecadienoic acid (13-hydroxy-octadecadienoic acid,13-HODE) to generate 13-oxo-octadecadienoic acid (13-oxo-octadecadienoic acid,13-oxoODE), and has a potential application value in improving yield and quality of tea-oil trees.

Based on the aim, the invention provides the oil-tea tree miRNA and the application thereof, the oil-tea tree miRNA is miR156, and the base sequence of the miR156 is shown in SEQ ID NO. 1.

According to the invention, miR156 is identified from tea-oil tree Xianglin No. 210 for the first time through HiSeq2500 high-throughput sequencing platform, bioinformatics analysis and other technologies, the difference of miR156 and target gene expression thereof is verified through fluorescence quantitative PCR, the conclusion that linoleic acid metabolism and miR156 show a significant negative correlation is obtained, and the target gene function analysis finds that the miR156 has an important regulation and control effect on the expression of butanol dehydrogenase in the linoleic acid metabolic pathway in the maturation process of tea-oil tree fruits, and has potential application value in improving the yield and quality of tea-oil trees.

In some embodiments of the invention, the base sequence of the upstream primer of miR156 is shown in SEQ ID NO.3, and the base sequence of the downstream primer of miR156 is shown in SEQ ID NO. 4.

In some embodiments of the invention, the base sequence of the target gene of the miR156 is shown in SEQ ID NO.2, the base sequence of the upstream primer of the target gene is shown in SEQ ID NO.6, and the base sequence of the downstream primer of the target gene is shown in SEQ ID NO. 7.

The target gene of the miR156 in the invention is CL15005.Contig2_ All. The miR156 acts on a target gene CL15005.Contig2_ All, the target gene CL15005.Contig2_ All can generate butanol dehydrogenase catalyzing 13-hydroxy octadecadienoic acid to generate 13-oxo-octadecadienoic acid after being expressed, and the expression of the miR156 and the target gene CL15005.Contig2_ All presents significant negative correlation. Therefore, the miR156 has an important regulation and control function on the expression of butanol dehydrogenase in the linoleic acid metabolic pathway in the fruit maturation process of the oil tea, so that the yield and the quality of the oil tea can be improved by regulating and controlling the expression of the miR 156.

Based on the same inventive concept, the invention also provides the application of the oil-tea tree miRNA in the regulation of linoleic acid metabolism.

In some embodiments of the invention, the miR156 regulates the expression of butanol dehydrogenase.

Compared with the prior art, the invention has the following beneficial effects:

the miR156 can regulate and control the expression of butanol dehydrogenase in the oil tea fruit by acting on the target gene CL15005.Contig2_ All, so that the miR156 plays an important role in regulating and controlling the process of generating 13-oxo-octadecadienoic acid from 13-hydroxyoctadecadienoic acid, the expression of the miR156 of the oil tea tree can regulate and control the metabolism of linoleic acid in the maturation process of the oil tea fruit, and the miR156 has potential application value in improving the yield and the quality of the oil tea.

Drawings

FIG. 1 is a KEGG Pathway graph of linoleic acid metabolism;

FIG. 2 shows the relative expression amounts of miR156 and target gene CL15005.Contig2_ All in fruits and flowers of Camellia oleifera.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to specific embodiments and the accompanying drawings.

Example 1 screening and identification of miRNA

1.1 preparation of plant Material and samples

Taking the variety of No. 210 camellia oleifera of Hunan forest of science and technology institute of Hunan province in Cold Water beach district, Yongzhou city, Hunan province as a test material, picking fruits of 10 months and 7 months respectively by adopting an S-type sampling method, and freezing the fruits at minus 80 ℃ for later use after quick freezing by liquid nitrogen.

1.2 high throughput sequencing of Camellia MiRNA

Extracting camellia oleifera RNA by Trizol method

(1) Respectively taking 0.1g of camellia oleifera flowers and 0.1g of camellia fruits, putting the camellia oleifera flowers and the camellia fruits in a grinding process, immediately adding liquid nitrogen, and grinding the camellia oleifera flowers and the camellia fruits into fine powder;

(2) respectively transferring the flower and fruit powder into a 1.5mL centrifuge tube treated by DEPC, respectively adding 1000 mu L Trizol reagent, fully mixing uniformly, and standing on ice for 5 min;

(3) respectively adding 200 mu L of chloroform into the centrifuge tubes treated in the step (2), tightly covering the centrifuge tubes, forcibly shaking for 15s to fully mix the substances in the centrifuge tubes, standing for 5min, and centrifuging for 15min at 12000r/min at 4 ℃;

(4) after the centrifugation is finished, respectively absorbing 500 mu L of upper-layer water phase of the centrifuge tube, then respectively transferring the upper-layer water phase into new centrifuge tubes, adding isopropanol with the same volume, fully and uniformly mixing, standing at room temperature for 10min, and centrifuging at 12000r/min at 4 ℃ for 10 min;

(5) respectively removing the supernatant liquid in the centrifuge tube treated in the step (4), then respectively adding 1mL of 75% ethanol prepared in situ into the centrifuge tube, oscillating, washing and precipitating once, and centrifuging for 5min at the temperature of 4 ℃ at 7500 r/min;

(6) respectively removing the supernatant liquid in the centrifuge tube treated in the step (5), then placing the centrifuge tube with the precipitate in an ultra-clean bench for blowing for 10min, and respectively adding 30 mu L of DEPC-treated double distilled water for dissolving;

(7) analyzing the degradation degree of RNA and whether pollution exists or not through agarose gel electrophoresis; detecting the purity of RNA by using Nanodrop, namely the ratio of OD260/OD 280; accurately quantifying the RNA concentration by a Qubit fluorometer; the integrity of the RNA was accurately tested using Agilent 2100. After the Sample is detected to be qualified, a library is constructed by using a Small RNA Sample Pre Kit, then high-throughput sequencing is carried out by adopting an illuminaHiSeq TM2000 platform, and hybridization is finished by high and new technology development limited company of Tianke, Zhejiang, to obtain a miRNA sequence of 18-40 nt.

1.3 identification of miRNA

Firstly, processing rawreads data obtained by high-throughput sequencing by adopting an illuminathSeq TM2000 platform to obtain clean reads, wherein the processing specific steps are as follows: (1) removing low-quality reads, namely removing reads with the base number of which the quality value sQ is less than or equal to 5 and accounts for more than 50 percent of the whole read; (2) removing reads with the proportion of N being more than 10%, namely removing reads with the proportion of undeterminable base information being more than 10%; (3) removing reads contaminated with 5' linkers; (4) removing reads without 3' linker sequence and insert; (5) trim 3' linker sequence; (6) the reads of polyA/T/G/C are removed, and most of continuous polyA/T/G/C reads can be caused by sequencing errors and have low information entropy, so that analysis can be omitted. And performing Blast comparison on the obtained clean reads sequence and known plant transcriptome data in a mirbase21.0 database, performing secondary structure analysis on the aligned EST sequence of the camellia oleifera tree, and if a stable stem-loop structure of a miRNA precursor (pre-miRNA) is formed, determining that the sequence is the miRNA of the camellia oleifera tree. By the method, miR156 of the camellia oleifera is identified, the mature sequence of the miR156 is shown in SEQ ID NO.1, and the sequence is as follows: UUGACAGAAGAUAGAGAGC are provided.

And the sequence of the precursor of miR156, namely pre-miRNA is shown in SEQ ID NO.8, and the sequence is: GGGCACTGGTGGTGATGTTGTTGACAGAAGATAGAGAGCACAGATGATGATATGCAATTA are provided.

The sequences of miR156 and its precursor pre-miRNA are shown in Table 1,

table 1.

1.4 prediction of miR156 target genes

Predicting and annotating a target gene of the camellia oleifera tree by using an online prediction software program psRobot _ start (http:// omicslab. genetics. ac. cn/psRobot/target _ prediction _1.php), obtaining a target gene corresponding to miR156 as CL15005.Contig2_ All, wherein the target gene has a sequence shown in SEQ ID NO.2 and has a sequence as follows:

CAAGTGGGTATGGATCAAACTCAACAGCTGAGCAAGTTACTCAGCATTCTTCTTCTTCTTCCTTACTCCCTTCTCATCATCTCACTGCAATTGTCACTGGTGCAACATCAGGCATTGGGGCTGAAACAGCAAGAATATTAGCAAAGAGAGGTGTGAGGATTGTGATTCCAGCAAGAGATTTGAAGAAAGCTACTGAAGTAAAGGAATGTATCCAAAAGGAGAGTCCAGAGGCTGAGATTGTATTATTGGAGATTGATCTAAGCTCATTAGCTTCTGTCAAGAGATTTTGTTCTGAGTTCTTGTCTCTAGGATTACCCCTTAATCTTCTCATAAACAATGCCGGGAAATTTTCACAAAAGTTGGAGTTCTCTGAAGACAAAGTTGAGATGACTTTTGCTACAAACTACTTGGGTCATTTTATGTTGACAGAATTATTGTTAGAGAAGATGGTGGAGACAGCAGCACATACTGGTATTCAAGGAAGGATTATTAATGTTTCTTCTGTAATTCATAGCTGGGTGAAACCAGAAACTTTCTGCTTCAACCAATTGCTTAATCCAAACAACTATAACGGCACTGATGCATACGCTCAATCCAAACTAGCCAACATATTGCATACCAAGGAAATCGCAAGACAGCTTAAGGCAAGAAATGCAAGAGTAACCATGAATGCAGTACACCCAGGAATTGTGAAGACTGGCATCATCAGAGACCACAAAGGATTCGTCACAGATTCTGTGTTTTTCCTCACATCCAAACTACTAAAAACAACACCCCAGGGTGCATCAACAACCTGCTATGTTGCACTAAGCCAACAAACAGAAGGAGTGAGTGGGAAGTACTTTGCAGATTGCAATGAAAGCAACTGTTCAGCCCTTGCAAATGATGAATCTCAAGCCCACATGCTCTGGAAGCAGACCCGTGCACTGATCCGTACACGATTACGTCAACCAGTAACTTAATAGAAACATAAAAATCAATTACAGAACTCTACATAACCTTCTCATACAAGATGGGTTGCTATTGGGCCTAGCTCTTACTGAGCTATTTCCAAGCCGTAAAACAACATGACAAATAGTGCTAATAAATTGTTGCGTTTTGTCATGTGTGCCTGTTGCCACAAGAAGTGCATTAGGGTACACGTTGCAAAGCCACGATTGAGGCAAAGGCATCTCTCCAAACTTTACAACTGTCCGAGCTTTTGGCCGCATAAGACTGAGACCCGCCTCATATGAGAGAGTTATGTTTGATTTTGTGATTAGTTATTTGTGTTTAAAAAAAAAAATTAGTTGCAGTCATACATATACATGAAATAATTATGTTGTATATATCTACTTCTAGAGAAGGTATATATACACTATGGTACATGAAAATAAAGAGCCTACCCTGTCAGCATTGTCCCTAAAATATTGTTCCTCCACTTGAGAAGCTATATTTTGAATAACAGAAGTGTAAACATTTACGTAAAAA。

the site fragments of miR156 and target gene CL15005.Contig2_ All are shown in Table 2,

table 2.

Example 2 application of oil tea tree miR156 in linoleic acid metabolism regulation

2.1 extraction of fatty acids from Camellia oleifera fruit

Fatty acid in the oil tea fruits is extracted by a Soxhlet extraction method. Weighing 2g of powdered camellia seeds, placing the powdered camellia seeds in a filter paper cylinder, pressing the upper part of the powdered camellia seeds tightly by using absorbent cotton, fastening the powdered camellia seeds by using cotton threads, placing the powdered camellia seeds in a Soxhlet extractor, adding 180mL of petroleum ether, extracting for 6 hours at 88 ℃, and then evaporating and concentrating a solvent to obtain the camellia oil.

2.2 fatty acid composition analysis in tea oil

Pretreating a sample by methyl esterification: putting 2-3 drops of tea oil samples into the bottom of a clean test tube, adding 2.0mL0.5mol/L sodium hydroxide-methanol solution, fully shaking up, carrying out water bath at 60 ℃ for 30min, then adding 5mL n-hexane, mixing uniformly, standing for a moment until the solution is layered, and absorbing the upper layer solution for GC-MS analysis.

The fatty acid composition of tea oil was analyzed using shimadzu model QP2010S gas chromatograph.

The GC detection conditions were as follows:

the chromatographic column is a quartz capillary column HP-5(30m × 0.25mm × 0.25 μm); a hydrogen Flame Ionization Detector (FID); the temperature of a sample inlet is 25 ℃; the sample injection amount is 1.0 mu L, and the split ratio is 20: 1; the carrier gas is high-purity helium, and the flow rate is 1.0 mL/min; the temperature programming is as follows: the initial temperature is 180 ℃, the temperature is kept for 5min, the temperature is increased to 230 ℃ at the heating rate of 3 ℃/min, and the temperature is kept for 15 min.

The MS detection conditions were as follows:

adopting an Electron Ionization (EI) ion source, wherein the electron energy is 70 eV; the ion source temperature is 230 ℃; the temperature of the four-level bar is 150 ℃; the temperature of the transmission line is 280 ℃; the mass range is 30-450 u, and the full scanning mode is adopted; the solvent was delayed for 3 min.

2.3 extraction of Total RNA

Extraction and quality detection of total RNA of camellia oleifera trees were performed with reference to example 1.

2.4qRT-PCR detection of miR156 and expression of corresponding target gene CL15005.Contig2_ All

2.4.1 reagents and instruments

Reagent: RNase inhibitor, M-MLV reverse transcriptase, 10mM dNTP Mix, SYBR Green qPCR Super-Mix-UDG with Rox, RNase-free Water; wherein the recombinant RNase inhibitor, M-MLV reverse transcriptase, 10mM dNTP Mix are purchased from TaKaRa company, SYBR Green qPCR Super-Mix-UDG with Rox is purchased from invitrogen company, and RNase-free Water is purchased from Ambion company;

the instrument comprises the following steps: normal temperature centrifuge (Thermo), micro ultraviolet spectrophotometer (Nanodrop 2000-Thermo), and fluorescent quantitative PCR instrument (ABI StepOneplus).

2.4.2 reverse transcription of miR156 to synthesize cDNA

SSR design of reverse transcription Primer RT Primer is carried out by using Primer3(Primer3-2.3.7, default parameters), the base sequence of the RT Primer is shown as SEQ ID NO.5, and the base sequence is as follows: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCTCTC the flow of the air in the air conditioner,

the following reaction mixture (6.0. mu.L) was prepared:

incubating at 70 deg.C for 10min, and adsorbing on ice for 3min to obtain 6.0 μ L denatured total RNA and RT Primer; the following reverse transcription reaction solution (10.0. mu.L) was prepared:

after the reaction at 42 ℃ for 1h, at 70 ℃ for 15min, after the reaction was completed, 15. mu.L of LRNase-free Water was added to dilute the reaction solution, and the diluted solution was placed in a refrigerator at 8 ℃ for further use.

2.4.3 Targeted Gene CL15005.Contig2_ All reverse transcription

The following reaction mixture (6.0. mu.L) was prepared:

2.4.3SYBR fluorescent quantitative PCR

Performing reverse transcription to obtain a first cDNA chain of the tea-oil tree, taking the first cDNA chain as a template, then adopting SYBR Green qPCR Super-Mix-UDG with Rox to ensure that a primer is correctly combined with the template, and then using DNA polymerase I and RNaseH (Promega, Madison, Wis.) to perform random primer and second chain cDNA synthesis to obtain an upstream primer and a downstream primer of miR156, wherein the base sequence of the upstream primer miR156-F of miR156 is shown as SEQ ID NO.3, the base sequence of the downstream primer miR156-R of miR156 is shown as SEQ ID NO.4, the base sequence of the upstream primer CL15005-F of the target gene CL15005.Contig2_ All is shown as SEQ ID NO.6, the base sequence of the downstream primer CL15005-R of the target gene CL15005.Contig2_ All is shown as SEQ ID NO.7, and the primer sequence refers to the sequence shown in Table 3:

table 3.

Prepare 20.0 μ L of the quantification system:

the reaction conditions were as follows:

the PCR reaction was carried out at 50 ℃ for 2min, 95 ℃ for 5min, then at 95 ℃ for 15s, and finally at 60 ℃ for 31s, repeated 40 times.

Each sample is repeated 3 times, EF1a2 is used as an internal reference, data analysis is carried out by adopting a 2^ (-delta Delta CT) method, the relative expression quantity of each miRNA is normalized through the expression level of EF1a2, and fold-change is carried out by adopting 2^-ΔΔCTThe method was analyzed and the results are shown in Table 4 and Table 4, respectivelyAs shown in fig. 2.

Table 4.

Wherein Δ CT is (Group 1 Δ CT) - (Group 2 Δ CT), Group1 represents fruit, and Group2 represents flower. Fold Change > 2^ (- Δ Δ CT), with greater than 2 significant upregulation, less than 0.5 significant downregulation, and p-value less than 0.05 indicating that biological duplication is significant.

As can be seen from FIG. 2, in comparison of fruits with flowers, the relative expression level of miR156 in fruits is significantly less than that of flowers, while the relative expression level of CL15005.Contig2_ All is higher than that of flowers.

2.4.4 measurement of relative content of linoleic acid in Camellia oleifera fruits in different months

GC-MS is adopted to respectively determine the relative contents of oleic acid, linoleic acid, palmitic acid and stearic acid in the camellia oleifera fruits in July, August and September, the results are shown in Table 5,

table 5.

Analysis of data in table 5 shows that the relative content of linoleic acid and miR156 have a significant negative correlation, and miR156 can regulate and control the metabolism of linoleic acid in the fruit ripening process of camellia oleifera.

As can be seen from example 1 and example 2,

the target gene of the miR156 in the invention is CL15005.Contig2_ All. The miR156 acts on a target gene CL15005.Contig2_ All, the target gene CL15005.Contig2_ All is expressed to generate butanol dehydrogenase catalyzing 13-hydroxyoctadecadienoic acid to generate 13-oxo-octadecadienoic acid, and the expression of the miR156 and the target gene CL15005.Contig2_ All is in significant negative correlation, so that the miR156 plays an important role in regulating and controlling the expression of the butanol dehydrogenase, the expression of the miR156 can regulate and control the metabolism of linoleic acid in the oil-tea tree, and the yield and the quality of the oil-tea tree can be improved by regulating and controlling the expression of the miR 156.

Those of ordinary skill in the art will understand that: the discussion of any embodiment above is meant to be exemplary only, and is not intended to intimate that the scope of the disclosure, including the claims, is limited to these examples; within the idea of the invention, also technical features in the above embodiments or in different embodiments may be combined and there are many other variations of the different aspects of the invention as described above, which are not provided in detail for the sake of brevity. Therefore, any omissions, modifications, substitutions, improvements and the like that may be made without departing from the spirit and principles of the invention are intended to be included within the scope of the invention.

Sequence listing

<110> Hunan institute of science and technology

<120> oil tea tree miRNA and application thereof

<130>FI180065-ND

<160>8

<170>PatentIn version 3.5

<210> 1

<211>19

<212>RNA

<213> Camellia oleifera (Camellia oleifera) Xianglin No. 210

<400> 1

uugacagaag auagagagc 19

<210>2

<211>1470

<212>RNA

<213> Camellia oleifera (Camellia oleifera) Xianglin No. 210

<400>2

caagtgggta tggatcaaac tcaacagctg agcaagttac tcagcattct tcttcttctt 60

ccttactccc ttctcatcat ctcactgcaa ttgtcactgg tgcaacatca ggcattgggg 120

ctgaaacagc aagaatatta gcaaagagag gtgtgaggat tgtgattcca gcaagagatt 180

tgaagaaagc tactgaagta aaggaatgta tccaaaagga gagtccagag gctgagattg 240

tattattgga gattgatcta agctcattag cttctgtcaa gagattttgt tctgagttct 300

tgtctctagg attacccctt aatcttctca taaacaatgc cgggaaattt tcacaaaagt 360

tggagttctc tgaagacaaa gttgagatga cttttgctac aaactacttg ggtcatttta 420

tgttgacaga attattgtta gagaagatgg tggagacagc agcacatact ggtattcaag 480

gaaggattat taatgtttct tctgtaattc atagctgggt gaaaccagaa actttctgct 540

tcaaccaatt gcttaatcca aacaactata acggcactga tgcatacgct caatccaaac 600

tagccaacat attgcatacc aaggaaatcg caagacagct taaggcaaga aatgcaagag 660

taaccatgaa tgcagtacac ccaggaattg tgaagactgg catcatcaga gaccacaaag 720

gattcgtcac agattctgtg tttttcctca catccaaact actaaaaaca acaccccagg 780

gtgcatcaac aacctgctat gttgcactaa gccaacaaac agaaggagtg agtgggaagt 840

actttgcaga ttgcaatgaa agcaactgtt cagcccttgc aaatgatgaa tctcaagccc 900

acatgctctg gaagcagacc cgtgcactga tccgtacacg attacgtcaa ccagtaactt 960

aatagaaaca taaaaatcaa ttacagaact ctacataacc ttctcataca agatgggttg 1020

ctattgggcc tagctcttac tgagctattt ccaagccgta aaacaacatg acaaatagtg 1080

ctaataaatt gttgcgtttt gtcatgtgtg cctgttgcca caagaagtgc attagggtac 1140

acgttgcaaa gccacgattg aggcaaaggc atctctccaa actttacaac tgtccgagct 1200

tttggccgca taagactgag acccgcctca tatgagagag ttatgtttga ttttgtgatt 1260

agttatttgt gtttaaaaaa aaaaattagt tgcagtcata catatacatg aaataattat 1320

gttgtatata tctacttcta gagaaggtat atatacacta tggtacatga aaataaagag 1380

cctaccctgt cagcattgtc cctaaaatat tgttcctcca cttgagaagc tatattttga 1440

ataacagaag tgtaaacatt tacgtaaaaa 1470

<210>3

<211>21

<212>DNA

<213> Artificial Synthesis

<400> 3

ccagcgtgtt gacagaagat a 21

<210>4

<211>21

<212>DNA

<213> Artificial Synthesis

<400> 4

cagtgcaggg tccgaggtat t 21

<210>5

<211>50

<212>DNA

<213> Artificial Synthesis

<400> 5

gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacgctctc 50

<210>6

<211>21

<212>DNA

<213> Artificial Synthesis

<400> 6

ttcttcttcc ttactccctt c 21

<210>7

<211>21

<212>DNA

<213> Artificial Synthesis

<400> 7

ccttttggat acattccttt a 21

<210>8

<211>60

<212>RNA

<213> Camellia oleifera (Camellia oleifera) Xianglin No. 210

<400> 8

gggcactggt ggtgatgttg ttgacagaag atagagagca cagatgatga tatgcaatta 60

Claims

1. The application of the miRNA in the regulation of linoleic acid metabolism of the oil-tea camellia is characterized in that the miRNA is miR156, and the base sequence of the miR156 is shown in SEQ ID No. 1.

2. The use of the camellia oleifera miRNA of claim 1 for regulating linoleic acid metabolism, wherein the miR156 regulates the expression of butanol dehydrogenase.