CN108441434A - A kind of method of the separation of probiotic yak source lactic acid bacteria, identification and preliminary screening - Google Patents
A kind of method of the separation of probiotic yak source lactic acid bacteria, identification and preliminary screening Download PDFInfo
- Publication number
- CN108441434A CN108441434A CN201710852452.6A CN201710852452A CN108441434A CN 108441434 A CN108441434 A CN 108441434A CN 201710852452 A CN201710852452 A CN 201710852452A CN 108441434 A CN108441434 A CN 108441434A
- Authority
- CN
- China
- Prior art keywords
- lac
- hours
- aerobic
- lactic acid
- yak
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/02—Separating microorganisms from their culture media
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to biotechnology and a kind of disclose the separation of probiotic yak source lactic acid bacteria, identification and preliminary screening method, separating step is：Fecal specimens middle section about 1g is taken to be added in the peptone buffer agent equipped with the refrigeration that sterilized, 1mL stool supernatants are drawn under aseptic condition to be inoculated into equipped in MRS fluid nutrient mediums, 37 DEG C aerobic and Anaerobic culturel respectively for 24 hours, 200 μ l bacteria suspensions are taken to carry out MRS tablet coatings, aerobic and Anaerobic culturel is respectively for 24 hours, it chooses suspicious single bacterium colony and is seeded to corresponding plating medium, 37 DEG C aerobic after scribing line culture and Anaerobic culturel respectively for 24 hours, single bacterium colony is chosen again is seeded to 37 DEG C of aerobic and Anaerobic culturels of corresponding plating medium, after so purifying 2 times, it chooses single bacterium colony and is seeded to respective ramp culture medium, 37 DEG C aerobic and Anaerobic culturel respectively for 24 hours, 4 DEG C of refrigerators save backup.The present invention plays the role of protecting intestinal mucosa, to mitigate the inflammation and diarrhea of enteric epithelium.
Description
Technical field
Present invention relates particularly to a kind of methods of separation of probiotic yak source lactic acid bacteria, identification and preliminary screening, belong to
Biotechnology.
Background technology
Yak calf diarrhoeal diseases is always to influence the important diseases of Tibet yak aquaculture, and reason is complicated, is mostly handed in winter, spring
The season replaced occurs, and has in each county in Tibet, according to investigations, diarrhea is lethal in Bange County, the Yak calf of spring death reaches
70%.Due to the unreasonable use of the antibiotic in the disease therapeutic process, causing yak various pathogens, there are serious more
Weight drug resistance.Therefore, there is an urgent need to find effectively and the Yak calf diarrhoeal diseases of low-risk treatment and prevention method.
Probiotics is microorganism living, and intake is enough advantageous to host health.Bacillus acidi lactici is common probiotics, can be with
The barrier function for enhancing intestinal mucosa adjusts the immunity of body, inhibits pathogen.Deeply with research, more and more evidences
Show that Bacillus acidi lactici has important role in terms for the treatment of diarrhea.The study found that sandlwood saccharobacillus can induce the secretion of SIgA,
Slow down Escherichia coli to stick small intestinal mucosa, and then plays the role of protecting intestinal mucosa[3]。 KOBAYASHI H[4]Deng research
It was found that Lactobacillus Jensenii can reduce chemotactic factor (CF) in enterocyte (CCL8, CXCL5, CXCL9, CXCL10, and CXCL11)
Expression, to mitigate the inflammation and diarrhea of enteric epithelium.
The research of WEGMANN U and FRESE SA have shown that bacterium all has host specificity, the breast detached from certain animal
Acidfast bacilli bacterial strain has strong adhesive force to this kind of animal intestinal tract, is reduced to other animal adhesive forces or without adhesion strength.Furthermore in view of
Animal is different, and enteric microorganism composition is also different, therefore, the strain for being isolated from allogenic animal gastrointestinal tract be prebiotic strain most
Good source[7].This test intended is detached from the excrement, enteron aisle, intestinal contents of healthy yak can be used for preventing and treating Yak calf abdomen
The lactic acid bacteria rushed down.
Invention content
The technical problem to be solved in the present invention overcomes existing defect, provides a kind of point of probiotic yak source lactic acid bacteria
From, identification and the method for preliminary screening, the barrier function of intestinal mucosa can be enhanced, adjust the immunity of body, inhibit pathogen,
Escherichia coli can be slowed down to stick small intestinal mucosa, and then play the role of protecting intestinal mucosa, to mitigate the inflammation of enteric epithelium
Disease and diarrhea can effectively solve the problems in background technology.
In order to solve the above technical problem, the present invention provides the following technical solutions：
A kind of method that the present invention provides the separation of probiotic yak source lactic acid bacteria, identification and preliminary screening, separating step
For：It takes fecal specimens middle section about 1g to be added in the peptone buffer agent equipped with the refrigeration that sterilized, is drawn under aseptic condition
1mL stool supernatants are inoculated into equipped in MRS fluid nutrient mediums, 37 DEG C aerobic and Anaerobic culturel respectively for 24 hours, take 200 μ l bacteria suspensions
MRS tablet coatings are carried out, aerobic and Anaerobic culturel respectively for 24 hours, chooses suspicious single bacterium colony and is seeded to corresponding plating medium, crosses
37 DEG C aerobic after culture and Anaerobic culturel respectively for 24 hours, choose again single bacterium colony be seeded to 37 DEG C of corresponding plating medium it is aerobic and
Anaerobic culturel chooses single bacterium colony and is seeded to respective ramp culture medium so after purifying 2 times, and 37 DEG C aerobic and Anaerobic culturel is each
For 24 hours, 4 DEG C of refrigerators save backup.
Preferably：The step of identifying be：(1) DNA is extracted；1. plus isopropanol 100ul is uniformly mixed Aspirate supernatant and is put into
In cylinder, it is then centrifuged for 8000rpm/1min；2. outwelling bottom liquid, add 500ul tissue depressant Inhibitor Removal, so
Bottom liquid is outwelled in centrifugation afterwards；3. plus washing lotion washing buffer500ul centrifugations；4. preheating distilled water to 37 DEG C, then will wash
Cylinder lower part lose, the centrifuge tube that renews, which is added distilled water 100ul and dissolves centrifugation in 10 minutes and retain bottom liquid, puts -20 DEG C of guarantors
It deposits；
(2) PCR amplification and sequencing approach；
16sRNA primer sequences：
16S-F：AGAGTTTGATCCTGGCTCAG
16S-R：AAGGAGGTGATCCAGCC
(3) PCR cuts glue purification according to kit recovery purifying.
Preferably：PCR amplification condition in step (2) is：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 40s, 55 DEG C of annealing
45s, 72 DEG C of extensions 1.2min, 72 DEG C of extension 5min.Totally 35 cycles.
The advantageous effect that is reached of the present invention is：The barrier function that intestinal mucosa can be enhanced adjusts the immunity of body, suppression
Pathogen processed can slow down Escherichia coli and stick to small intestinal mucosa, and then play the role of protecting intestinal mucosa, to mitigate intestines
The inflammation and diarrhea of epithelium.
Description of the drawings
Fig. 1 is four strains of lactic acid bacteria 16S sRNA amplified production agarose gel electrophoresis figures.
Fig. 2 is 4 plants of yak source Bacillus acidi lactici and type strain 16S rRNA systematic growth tree graphs.
Specific implementation mode
Hereinafter, preferred embodiments of the present invention will be described, it should be understood that preferred embodiment described herein is only used
In the description and interpretation present invention, it is not intended to limit the present invention.
Embodiment 1：
The method of a kind of separation of probiotic yak source lactic acid bacteria of the present invention, identification and preliminary screening, includes the following steps：
1 material and method
1.1 sample collection
The healthy yak one of Fromlingzhi, tibet 2.5 years old, after butchering, its duodenum of aseptic collection, jejunum, ileum, blind respectively
Intestines, colon, rectum and its content, are put into sterilizing plates, are put into after lid in refrigeration anaerobism box, take back laboratory as early as possible.
1.2 reagents and instrument and equipment
MRS agar, MRS meat soups, maconkey agar culture medium are Qingdao GaoKeYuan Hai Bo Bioisystech Co., Ltd product；
Blood agar medium is purchased from Chengdu Jie Rui Science and Technology Ltd.s；Pig cholate is Biotopped Products；Hydrochloric acid, glycerine are
Chinese medicines group chemistry manufactures experimently Co., Ltd's product.Bacterial genomes DNA extraction kit is purchased from Tiangeng biology Co., Ltd；DNA
Gel reclaims kit is green skies Products.
Superclean bench (Jiangsu Su Jing groups)；Centrifuge (Thermo companies, the U.S.)；Microscope band digital imaging system
(OLYMPUS, Japan)；Anaerobic culturel box and Anaerobic culturel bag (Mitsubishi, Japan)；Constant temperature, constant humidity incubator (the rich news in Shanghai).
1.3 bacterial strain
Escherichia coli O111Type is given by China Agricultural University's obstetrics laboratory；Escherichia coli O142Type, point
From from Tibet yak, is preserved by this laboratory, refer to document[8]；Killing property bus bacillus, are isolated from Tibet yak, by this experiment more
Room preserves, and refers to document[9]。
[8] this pearl of Soinam, Zeng Qunhui look into fruit, etc..The separation identification of test of Tibet yaks ' Escherichia coli and toxicity test
[J].Journal of Northwest Sci Tech University of Agriculture and Forestry (natural science edition), 2005,33 (9)：19-23.
SUO L S Z,Z Q H,CHA G.Isolation and appraisal and virulence test of
Tibet yaks’Escherichia coli[J].Jour of Northw est Sci-Tech Univ of Agri and
For (Nat.Sci.Ed.), 2005,33 (9)：19-23.
[9] Cui Ailian, Wu Qingxia, Dong Hailong, etc..The separation of Shannan District of Tibet Autonomous Region yak pasteurella multocida identify and
Drug sensitive test [J] herdings and animal doctor, 2016,48 (7)： 146-147.
CUI A L,WU Q X,DONG H-L,et al.Isolation and identification and drug
sensitive test of yaks’Pasteurella multocida in Lhoka prefecture of Tibet[J]
.Animal Husbandry& Veterinary Medicine,2016,48(7)：146-147.
The isolation and purification of 1.4 lactic acid bacterias
Fecal specimens middle section about 1g is taken to be added in the peptone buffer agent equipped with the refrigeration that sterilized, under aseptic condition
1mL stool supernatants are drawn to be inoculated into equipped in MRS fluid nutrient mediums, 37 DEG C aerobic and Anaerobic culturel respectively for 24 hours, take 200 μ l bacterium
Suspension carries out MRS tablet coatings, and aerobic and Anaerobic culturel is respectively for 24 hours.It chooses suspicious single bacterium colony and is seeded to corresponding plating medium,
37 DEG C aerobic after scribing line culture and Anaerobic culturel respectively for 24 hours, choose single bacterium colony again and be seeded to 37 DEG C of need of corresponding plating medium
Oxygen and Anaerobic culturel.After so purifying 2 times, chooses single bacterium colony and be seeded to respective ramp culture medium, 37 DEG C of aerobic and anaerobism trainings
Support it is each for 24 hours, 4 DEG C of refrigerators save backup.
1.5 optical microphotograph sem observations and bacterial strain preserve
By the inoculation of purifying in MRS fluid nutrient mediums stationary culture for 24 hours after, draw one drop does nacterial smear, remove from office
Blue Albert'stain Albert, optical microphotograph sem observation bacterium, is used in combination digital imaging system film recording.
Stationary culture for 24 hours after, centrifugation, with containing 40% sterile glycerol MRS fluid nutrient mediums be resuspended bacterium, mixing, -80 DEG C
It saves backup.
1.6 acidproof experiments
The pH of MRS fluid nutrient mediums is adjusted to 2.0 with the HCl of 1mol/L.By the lactobacillus suspension of culture for 24 hours with 1%
Ratio is respectively connected in the fluid nutrient medium of conventional liq culture medium and pH2.0, and 37 DEG C of culture 3h detect strain growth situation,
After each strain cultured solution doubling dilution, point calculates viable count, is repeated 3 times on plating medium, is trained with the routine of each bacterial strain
Nutrient solution compares, its survival rate is calculated by following formula.
Viable count/candidate strain conventional medium hair in survival rate (%)=candidate strain different PH culture medium zymotic fluid
Viable count × 100% in zymotic fluid.
1.7 bile tolerances are tested
Acidproof experiment screening provides the bacterial strain of good acid resistance, and culture is accessed often with 1% ratio for 24 hours, by bacterium solution
It advises in fluid nutrient medium and fluid nutrient medium containing 0.5% concentration bile salt, 37 DEG C of cultures for 24 hours, observe strain growth shape
Condition, after culture solution doubling dilution, point calculates viable count, is repeated 3 times, with each bacterial strain routine culture liquid on plating medium
It compares, its survival rate is calculated by following formula.
Viable count/candidate strain is normal in survival rate (%)=candidate strain difference bile salt concentration cultures zymotic fluid
Advise viable count × 100% in culture medium zymotic fluid.
1.8 potential probiotic lactic acid bacterium antibacterial experiments
It filters out acidproof, bile tolerance bacterial strain and carries out antibacterial tests.Potential probiotics is inoculated in MRS fluid nutrient mediums
In, 37 DEG C of stationary cultures are for 24 hours, spare.By 100 μ L even spreads of the Escherichia coli O111 types being incubated overnight and O142 types culture solution
In LB solid medium tablets surface；The 100 μ L of Pasteurella culture solution being incubated overnight are spread evenly across blood agar plate
Surface.It is equidistantly placed 4 Oxford cups on tablet, 200 μ L lactobacillus suspensions are added in Oxford cup, is placed in 37 DEG C of incubators and stands
Culture measures antibacterial circle diameter size afterwards for 24 hours.Each bacterial strain does 3 repetitions, and negative control is done with abacterial MRS culture solutions.
1.9 16S rRNA sequence analyses
From on the bacterial strain slant medium isolated and purified picking thalline access respective liquid culture medium, 37 DEG C culture 24~
After 48h, bacterial genomes DNA is extracted using QLAamp DNA Micro Kit kits, step operates progress to specifications.
Using the DNA of extraction as template, with 16S rRNA universal primers 16S-F：AGAGTTTGATC CTGGCTCAG and 16S-
R：AAGGAGGTGATCCAGCC carries out the amplification of 16S rRNA segments, and PCR amplification condition is：94 DEG C of pre-degeneration 5min；94 DEG C of changes
Property 40s, 55 DEG C annealing 45s, 72 DEG C extension 1.2min, 72 DEG C extension 5min, totally 35 cycle.
PCR after reaction, is detected by agarose gel electrophoresis, cuts band, is said according to DNA plastic recovery kits
Bright book program carries out recovery purifying to pcr amplification product.Dalian treasured bioengineering Co., Ltd is sent to be sequenced recovery product.It will
Obtained 16S rDNA sequences are compared on NCBI using BLAST, and MEGA5.1 softwares is used in combination to use
Neighbourjoining methods build chadogram.
2 results
2.1 lactic acid bacterias detach
It isolates to obtain 32 plants of lactic acid bacteria from 6 parts of yak excrement for coming from Tibet different places, number from Y-Lac-
1 arrives Y-Lac-32, and 9 plants are isolated from Linzhi yak excrement, 11 plants are isolated from that area's yak excrement, from mountain south yak dung
Just 8 plants are isolated in.
2.2 optical microphotograph sem observations
By the 28 plants of nacterial smears isolated and purified, Gram's staining, microscopically observation finds that all bacterial strains are equal
For Gram-positive, it is rod-shaped to have 8 plants, and 20 plants are spherical, no gemma.
2.3 acidproof experiments
32 plants of strains to be tested are cultivated into 3h under conditions of pH=2, survival rate is shown in Table 1.
Survival rate of 1 strain to be tested of table in acid culture solution：
As seen from the above table, the acid resistance of Y-Lac-1 is most strong, and 3h survival rates are cultivated under conditions of pH=2 and are reached
63.75%, Y-Lac-27 cannot be grown under conditions of pH=2 substantially.Bacterial strain of the survival rate more than 10% has 11 plants, respectively
Y-Lac-1、Y-Lac-5、Y-Lac-9、 Y-Lac-10、Y-Lac-12、Y-Lac-17、Y-Lac-18、Y-Lac-20、Y-Lac-
22, Y-Lac-23, Y-Lac-28, this 11 strains of lactic acid bacteria will further carry out bile tolerance detection.
2.4 bile tolerances detect
11 strains of lactic acid bacteria by acid resistance test detection carry out bile tolerance experiment, and test result is shown in Table 2.
2 bile tolerance test result of table：
From in table 2 it is known that the survival rate after being cultivated for 24 hours in the fluid nutrient medium of 0.5% concentration bile salt most
Height reaches 59.26%；Secondly it is Y-Lac-1, reaches 43.75%.Survival rate be more than 10% bacterial strain have Y-Lac-10,
Y-Lac-22, respectively 25.29% and 13.71%.Bacterial strain of the survival rate less than 5% has Y-Lac-9, Y-Lac-17, Y-Lac-
20, Y-Lac-23, Y-Lac-28 show these bacterial strains not bile tolerance.It is more than 10% bacterial strain to select survival rate in this experiment
(Y-Lac-1, Y-Lac-10, Y-Lac-18, Y-Lac-22) carries out antibacterial tests.
2.5 16S rRNA the sequencing results
Using the lactic acid bacteria DNA of separation as template, the amplification of 16S rRNA segments is carried out with bacterium 16s rRNA universal primers,
Agarose gel electrophoresis detects amplified production, and as a result such as Fig. 1, four strains of lactic acid bacteria obtain the specific item of size about 1500bp
Band is consistent with expected results.
Glue, recovery purifying PCR product are cut, company is sent to be sequenced, obtained 16S rDNA sequences are used into BLAST on NCBI
Sequence analysis is carried out, the results are shown in Table 4:
Table 4
Embodiment 2：
The method of a kind of separation of probiotic yak source lactic acid bacteria of the present invention, identification and preliminary screening, includes the following steps：
1 material and method
1.1 sample collection
The healthy yak one of Fromlingzhi, tibet 2.5 years old, after butchering, its duodenum of aseptic collection, jejunum, ileum, blind respectively
Intestines, colon, rectum and its content, are put into sterilizing plates, are put into after lid in refrigeration anaerobism box, take back laboratory as early as possible.
1.2 reagents and instrument and equipment
MRS agar, MRS meat soups, maconkey agar culture medium are Qingdao GaoKeYuan Hai Bo Bioisystech Co., Ltd product；
Blood agar medium is purchased from Chengdu Jie Rui Science and Technology Ltd.s；Pig cholate is Biotopped Products；Hydrochloric acid, glycerine are
Chinese medicines group chemistry manufactures experimently Co., Ltd's product.Bacterial genomes DNA extraction kit is purchased from Tiangeng biology Co., Ltd；DNA
Gel reclaims kit is green skies Products.
Superclean bench (Jiangsu Su Jing groups)；Centrifuge (Thermo companies, the U.S.)；Microscope band digital imaging system
(OLYMPUS, Japan)；Anaerobic culturel box and Anaerobic culturel bag (Mitsubishi, Japan)；Constant temperature, constant humidity incubator (the rich news in Shanghai).
1.3 bacterial strain
Escherichia coli O111 types are given by China Agricultural University's obstetrics laboratory；Escherichia coli O142 types,
It is isolated from Tibet yak, is preserved by this laboratory, document [8] is referred to；Killing property bus bacillus, are isolated from Tibet yak more, by this
Laboratory preserves, and refers to document [9].
[8] this pearl of Soinam, Zeng Qunhui look into fruit, etc..The separation identification of test of Tibet yaks ' Escherichia coli and toxicity test
[J].Journal of Northwest Sci Tech University of Agriculture and Forestry (natural science edition), 2005,33 (9)：19-23.
SUO L S Z,Z Q H,CHA G.Isolation and appraisal and virulence test of
Tibet yaks’Escherichia coli[J].Jour of Northw est Sci-Tech Univ of Agri and
For (Nat.Sci.Ed.), 2005,33 (9)：19-23.
[9] Cui Ailian, Wu Qingxia, Dong Hailong, etc..The separation of Shannan District of Tibet Autonomous Region yak pasteurella multocida identify and
Drug sensitive test [J] herdings and animal doctor, 2016,48 (7)： 146-147.
CUI A L,WU Q X,DONG H-L,et al.Isolation and identification and drug
sensitive test of yaks’Pasteurella multocida in Lhoka prefecture of Tibet[J]
.Animal Husbandry& Veterinary Medicine,2016,48(7)：146-147.
The isolation and purification of 1.4 lactic acid bacterias
Above-mentioned acquired sample about 1g is taken to be added in the peptone buffer agent equipped with the refrigeration that sterilized, be vortexed concussion
5min draws 1mL supernatants MRS fluid nutrient mediums doubling dilution to 10-3 under aseptic condition, takes 10-3 doubling dilutions liquid 100
μ l carry out MRS tablet coatings, 37 DEG C aerobic and Anaerobic culturel respectively for 24 hours, choose the significantly suspicious single bacterium colony of molten calcium circle and be seeded to
Plating medium, 37 DEG C aerobic after scribing line culture and Anaerobic culturel respectively for 24 hours, choose single bacterium colony again and be seeded to plating medium
37 DEG C of aerobic and Anaerobic culturels.After so purifying 2 times, chooses single bacterium colony and be seeded to slant medium, 37 DEG C of aerobic and anaerobism
Culture is each for 24 hours, and 4 DEG C of refrigerators save backup.
1.5 optical microphotograph sem observations and bacterial strain preserve
By the inoculation of purifying in MRS fluid nutrient mediums stationary culture for 24 hours after, draw one drop does nacterial smear, remove from office
Blue Albert'stain Albert, optical microphotograph sem observation bacterium, is used in combination digital imaging system film recording.
Stationary culture for 24 hours after, centrifugation, with containing 40% sterile glycerol MRS fluid nutrient mediums be resuspended bacterium, mixing, -80 DEG C
It saves backup.
1.6 acidproof experiments
The pH of MRS fluid nutrient mediums is adjusted to 2.0 with the HCl of 1mol/L.By the lactobacillus suspension of culture for 24 hours with 1%
Ratio is respectively connected in the fluid nutrient medium of conventional liq culture medium and pH2.0, and 37 DEG C of culture 3h detect strain growth situation,
After each strain cultured solution doubling dilution, point calculates viable count, is repeated 3 times on plating medium, is trained with the routine of each bacterial strain
Nutrient solution compares, its survival rate is calculated by following formula.
Viable count/candidate strain conventional medium hair in survival rate (%)=candidate strain different PH culture medium zymotic fluid
Viable count × 100% in zymotic fluid.
1.7 bile tolerances are tested
Acidproof experiment screening provides the bacterial strain of good acid resistance, and culture is accessed often with 1% ratio for 24 hours, by bacterium solution
It advises in fluid nutrient medium and fluid nutrient medium containing 0.5% concentration bile salt, 37 DEG C of cultures for 24 hours, observe strain growth shape
Condition, after culture solution doubling dilution, point calculates viable count, is repeated 3 times, with each bacterial strain routine culture liquid on plating medium
It compares, its survival rate is calculated by following formula.
Viable count/candidate strain is normal in survival rate (%)=candidate strain difference bile salt concentration cultures zymotic fluid
Advise viable count × 100% in culture medium zymotic fluid.
1.8 potential probiotic lactic acid bacterium antibacterial experiments
It filters out acidproof, bile tolerance bacterial strain and carries out antibacterial tests.Potential probiotics is inoculated in MRS fluid nutrient mediums
In, 37 DEG C of stationary cultures are for 24 hours, spare.The Escherichia coli O that will be incubated overnight111Type and O142100 μ L of type culture solution are spread evenly across
LB solid medium tablets surface；The 100 μ L of Pasteurella culture solution being incubated overnight are spread evenly across blood agar plate table
Face.It is equidistantly placed 4 Oxford cups on tablet, 200 μ L lactobacillus suspensions are added in Oxford cup, is placed in 37 DEG C of incubators and stands training
It supports, measures antibacterial circle diameter size afterwards for 24 hours.Each bacterial strain does 3 repetitions, and negative control is done with abacterial MRS culture solutions.
1.9 16S rRNA sequence analyses
From on the bacterial strain slant medium isolated and purified picking thalline access respective liquid culture medium, 37 DEG C culture 24~
After 48h, bacterial genomes DNA is extracted using QLAamp DNA Micro Kit kits, step operates progress to specifications.
Using the DNA of extraction as template, with 16S rDNA universal primers 16S-F：AGAGTTTGATC CTGGCTCAG and 16S-
R：AAGGAGGTGATCCAGCC carries out the amplification of 16S rDNA segments, and PCR amplification condition is：94 DEG C of pre-degeneration 5min；94℃
40s, 55 DEG C of annealing 45s, 72 DEG C of extensions 1.2min, 72 DEG C of extension 5min are denaturalized, totally 35 cycles.
PCR after reaction, is detected by agarose gel electrophoresis, cuts band, is said according to DNA plastic recovery kits
Bright book program carries out recovery purifying to pcr amplification product.Dalian treasured bioengineering Co., Ltd is sent to be sequenced recovery product.It will
Obtained 16S rDNA sequences are compared on NCBI using BLAST, and MEGA5.1 softwares is used in combination to use
Neighbourjoining methods build chadogram.
1.10 yak enterocytes stick
Original cuiture yak intestinal epithelial cell is in 6 orifice plates, when growth reaches ware bottom 50%, with antibiotic-free
DMEN-F12 culture solutions clean 1~2 time, while by each candidate bacterium and the DMEN- of type strain mouse lactose bacillus antibiotic-free
F12 culture solutions clean 2 times, and it is 1 × 105CFU/ml that DMEN-F12 culture solutions adjustment bacterial concentration, which is used in combination, is then added and is ready to
Above-mentioned yak enterocyte in, per hole 2mL, every plant of bacterium is cooked 3 repetitions.Each group sets 5%CO2 incubator culture culture 2h,
After incubation, coverslip is taken out, is rinsed 5 times using sterile PBS buffer, to remove impurity and non-adherent bacteria etc..It is natural
It dries or low temperature drying, methanol fixes 20min, Gram's staining is observed each bacterial strain and sticked to yak endometrial epithelial cell
Property.Every group is selected 10 visuals field at random under the microscope, counts the quantity of average each cell adhesion bacterium under each visual field.
1.11 yak protectiveness are tested
It selects acidproof, resistance to bile salt, in-vitro antibacterial better performances, have preferable Adhesion property to yak enterocyte
Bacterium is cooked in vivo studies to yak.Experimental design is as follows：3-6 monthly ages yak 20 is chosen, is randomly divided into 4 groups (5/group), the
One group with Escherichia coli O111Bacterial strain attacks poison；Second group of feeding Bacillus acidi lactici is after 3 days, with Escherichia coli O111Bacterial strain attacks poison；Third
Group attacks malicious group simultaneously for feeding lactic acid bacillus mycopremna；4th group with Escherichia coli O111Bacterial strain attacks poison, starts within second day to feed lactic acid
Bacillus.The variation of the yak course of disease, statistics morbidity and mortality, final to determine the protecting effect for obtaining bacterial strain during record experiment
And application method.
2 results
2.1 lactic acid bacterias detach
It isolates to obtain 28 plants of bacterium to be measured from duodenum, jejunum, ileum, caecum, colon, rectum and its content,
Number is from Y-Lac-1 to Y-Lac-28.
2.2 optical microphotograph sem observations
By the 28 plants of nacterial smears isolated and purified, Gram's staining, microscopically observation finds that all bacterial strains are equal
For Gram-positive, it is rod-short to have 18 plants, and 4 plants are the elongated rod-shaped for having forked growth, 6 plants of elongated rod-shapeds for no bifurcated,
Without gemma.
28 plants of strains to be tested are cultivated into 3h under conditions of pH=2, survival rate is shown in Table 1.
Survival rate of 1 strain to be tested of table in acid culture solution：
As seen from the above table, the acid resistance of Y-Lac-1 is most strong, and 3h survival rates are cultivated under conditions of pH=2 and are reached
63.75%, Y-Lac-27 cannot be grown under conditions of pH=2 substantially.Bacterial strain of the survival rate more than 10% has 11 plants, respectively
Y-Lac-1、Y-Lac-5、Y-Lac-9、 Y-Lac-10、Y-Lac-12、Y-Lac-17、Y-Lac-18、Y-Lac-20、Y-Lac-
22, Y-Lac-23, Y-Lac-28, this 11 strains of lactic acid bacteria will further carry out bile tolerance detection.
2.4 bile tolerances detect
11 strains of lactic acid bacteria by acid resistance test detection carry out bile tolerance experiment, and test result is shown in Table 2.
2 bile tolerance test result of table：
From in table 2 it is known that after Y-Lac-18 cultivates for 24 hours in the fluid nutrient medium of 0.5% concentration bile salt
Survival rate highest, reaches 59.26%；Secondly it is Y-Lac-1, reaches 43.75%.Survival rate is more than that 10% bacterial strain also has Y-
Lac-10, Y-Lac-22, respectively 25.29% and 13.71%.Bacterial strain of the survival rate less than 5% has Y-Lac-9, Y-Lac-
17, Y-Lac-20, Y-Lac-23, Y-Lac-28 show these bacterial strains not bile tolerance.The survival rate in this experiment is selected to be more than
10% bacterial strain (Y-Lac-1, Y-Lac-10, Y-Lac-18, Y-Lac-22) carries out antibacterial tests.
2.5 potential probiotic lactic acid bacterium antibacterial experiments
Y-Lac-1, Y-Lac-10, Y-Lac-18, Y-Lac-22 bacterial strain antibacterial experiment the results are shown in Table 3.
Antibacterial circle diameter size (the unit of 34 plants of bacterium to be measured of table：mm)
Y-Lac-1, Y-Lac-10, Y-Lac-18, Y-Lac-22 bacterial strain are all to Escherichia coli O as seen from the above table111It is type, big
Enterobacteria O142Type, Pasteurella have certain inhibiting effect, but there are strain specificities.To Escherichia coli O111Type fungistatic effect
Most preferably Y-Lac-22 bacterial strains, to Escherichia coli O142Type fungistatic effect most preferably Y-Lac-10, and it is antibacterial to Pasteurella
Effect most preferably Y-Lac-18.
2.6 16S rRNA the sequencing results
Using the DNA of Y-Lac-1, Y-Lac-10, Y-Lac-18, Y-Lac-22 bacterial strain of separation as template, with bacterium 16s
RRNA universal primers carry out the amplification of 16S rRNA segments, and agarose gel electrophoresis detects amplified production, and four strains of lactic acid bacteria obtain
The specific band for obtaining size about 1500bp, is consistent with expected results；
Glue, recovery purifying PCR product are cut, company is sent to be sequenced, obtained 16S rDNA sequences are used into BLAST on NCBI
Sequence analysis is carried out, is used in combination MEGA6 softwares to build chadogram using neighbourjoining methods, as a result See Figure yak
4 plants of source Bacillus acidi lactici and type strain 16S rRNA phylogenetic trees (such as Fig. 2)：
In Fig. 2 in addition to bacterium to be measured, other bacterial strains are the Yue Shi lactobacillus of separate sources.、 Y-Lac-10、Y-Lac-
18, Y-Lac-22 and the Yue Shi lactobacillus in other sources are not same family, and farther out, they are belonging respectively to 3 races to distance.Y-
Two plants of Pseudomonas of Lac-18, Y-Lac-22 are in same family, and the Yue Shi lactobacillus apart from other sources is apart from more farther.This may be with
Bacterium adapts to High aititude anoxic and the yak of cold environment and resistance to roughage is related.Prove that the bacterium got may be Yue Shi breasts
Bacillus, it is also possible to the closer novel lactobacillus with Yue Shi lactobacillus affiliations.
2.7 yak enterocytes stick
Adhesion assay proves that the Adhesion property of Y-Lac-10 is best, reaches 156/cell, is secondly Y-Lac-18, reaches
To 123/cell, it is 78/cell that Y-Lac-1, which sticks quantity, and the quantity of sticking of Y-Lac-22 is 67/cell.Worst
For sandlwood saccharobacillus type strain, it is 36/cell to stick quantity.
3 discuss
This test intended screens yak with probiotics, therefore it is yak gastrointestinal tract and its content to screen position.Probiotics
Application method is typically all by oral, and the probiotics into gastrointestinal tract must overcome the adverse environment of gastrointestinal tract to get to spy
Determine position to play a role, so the probiotics filtered out must be resistant to hydrochloric acid in gastric juice, tolerance cholate.
Acid resistance test proves, Y-Lac-1, Y-Lac-5, Y-Lac-9, Y-Lac-10, Y-Lac-12, Y-Lac-17, Y-
Lac-18, Y-Lac-20, Y-Lac-22, Y-Lac-23, Y-Lac-28 cultivate 3h survival rates under conditions of pH=2
10%.Its resistance to bile salt characteristic is further detected to acidproof bacterial strain, is trained in the fluid nutrient medium of 0.5% concentration bile salt
Supporting the bacterial strain that rear survival rate for 24 hours is more than 10% has Y-Lac-1, Y-Lac-18, Y-Lac-10, Y-Lac-22.For not only acidproof but also
4 plants of bacterial strains of resistance to bile salt carry out antibacterial tests, and selected bacterial strain is the Escherichia coli O for being isolated from illness yak111Type, Pasteur
Bacillus and reference culture Escherichia coli O142Type, 4 plants of strains to be tested pair, 3 plants of pathogenic bacterial strains have inhibition, but there are bacterium
Strain specificity.Y-Lac-22 bacterial strains are to Escherichia coli O111Type fungistatic effect is best, and Y-Lac-10 is antibacterial to Escherichia coli O142 types
Effect is best, and to Pasteurella fungistatic effect most preferably Y-Lac-18.
Finally it should be noted that：The foregoing is only a preferred embodiment of the present invention, is not intended to restrict the invention,
Although the present invention is described in detail referring to the foregoing embodiments, for those skilled in the art, still may be used
With technical scheme described in the above embodiments is modified or equivalent replacement of some of the technical features.
All within the spirits and principles of the present invention, any modification, equivalent replacement, improvement and so on should be included in the present invention's
Within protection domain.
Claims (3)
1. a kind of method of the separation of probiotic yak source lactic acid bacteria, it is characterised in that：Separating step is：It takes among fecal specimens
Part about 1g is added in the peptone buffer agent equipped with the refrigeration that sterilized, and the inoculation of 1mL stool supernatants is drawn under aseptic condition
To in equipped with MRS fluid nutrient mediums, 37 DEG C aerobic and Anaerobic culturel respectively for 24 hours, take 200 μ l bacteria suspensions to carry out MRS tablet coatings, need
Oxygen and Anaerobic culturel respectively for 24 hours, choose suspicious single bacterium colony and are seeded to corresponding plating medium, after scribing line culture 37 DEG C it is aerobic and detest
Oxygen culture respectively for 24 hours, chooses single bacterium colony and is seeded to 37 DEG C of aerobic and Anaerobic culturels of corresponding plating medium, so purify 2 again
After secondary, choose single bacterium colony and be seeded to respective ramp culture medium, 37 DEG C aerobic and Anaerobic culturel respectively for 24 hours, 4 DEG C of refrigerators preserve standby
With.
2. a kind of method of the identification of probiotic yak source lactic acid bacteria according to claim 1, it is characterised in that：Identification
Step is：
(1) DNA is extracted；
1. plus isopropanol 100ul is uniformly mixed Aspirate supernatant and is put into cylinder, is then centrifuged for 8000rpm/1min；
2. outwelling bottom liquid, adds 500ul tissue depressant Inhibitor Removal, be then centrifuged for outwelling bottom liquid；
3. plus washing lotion washing buffer500ul centrifugations；
4. preheating distilled water to 37 DEG C, then washed cylinder lower part is lost, distilled water 100ul is added in the centrifuge tube renewed
Dissolving centrifugation in 10 minutes retains bottom liquid and puts -20 DEG C of preservations；
(2) PCR amplification and sequencing approach；
16sRNA primer sequences：
16S-F：AGAGTTTGATCCTGGCTCAG
16S-R：AAGGAGGTGATCCAGCC
(3) PCR cuts glue purification according to kit recovery purifying.
3. the method for a kind of separation of probiotic yak source lactic acid bacteria according to claim 2, identification and preliminary screening,
It is characterized in that：PCR amplification condition in step (2) is：94 DEG C of pre-degeneration 5min；94 DEG C denaturation 40s, 55 DEG C annealing 45s, 72 DEG C
Extend 1.2min, 72 DEG C of extension 5min, totally 35 cycles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710852452.6A CN108441434A (en) | 2017-09-19 | 2017-09-19 | A kind of method of the separation of probiotic yak source lactic acid bacteria, identification and preliminary screening |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710852452.6A CN108441434A (en) | 2017-09-19 | 2017-09-19 | A kind of method of the separation of probiotic yak source lactic acid bacteria, identification and preliminary screening |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108441434A true CN108441434A (en) | 2018-08-24 |
Family
ID=63190927
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710852452.6A Pending CN108441434A (en) | 2017-09-19 | 2017-09-19 | A kind of method of the separation of probiotic yak source lactic acid bacteria, identification and preliminary screening |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108441434A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109943487A (en) * | 2019-04-24 | 2019-06-28 | 桑艳玲 | A kind of method and its application preparing lactobacillus suspension from caprophyl |
| CN110878266A (en) * | 2019-11-21 | 2020-03-13 | 中国农业科学院兰州兽医研究所 | Lactobacillus johnsonii and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105950496A (en) * | 2016-02-04 | 2016-09-21 | 曲靖市千村农牧科技有限公司 | Lactobacillus agilis and application thereof |
| CN106554925A (en) * | 2015-09-16 | 2017-04-05 | 兰州大学 | One plant of leuconostoc lactis with high-yield extracellular polysaccharide |
| CN109022313A (en) * | 2018-08-02 | 2018-12-18 | 中国农业科学院兰州兽医研究所 | One lactobacillus plantarum |
-
2017
- 2017-09-19 CN CN201710852452.6A patent/CN108441434A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106554925A (en) * | 2015-09-16 | 2017-04-05 | 兰州大学 | One plant of leuconostoc lactis with high-yield extracellular polysaccharide |
| CN105950496A (en) * | 2016-02-04 | 2016-09-21 | 曲靖市千村农牧科技有限公司 | Lactobacillus agilis and application thereof |
| CN109022313A (en) * | 2018-08-02 | 2018-12-18 | 中国农业科学院兰州兽医研究所 | One lactobacillus plantarum |
Non-Patent Citations (3)
| Title |
|---|
| 周晏阳等: "牦牛源产细菌素的乳酸菌的筛选鉴定", 《西南民族大学学报( 自然科学版)》 * |
| 我们还年轻1的店: "试剂盒DNA提取详细操作步骤https://wenku.baidu.com/view/4731b6555f0e7cd184253666.html", 《百度文库》 * |
| 杨鸢劼主编: "《水生动物病害防治员培训教材》", 31 July 2012, 吉林人民出版社 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109943487A (en) * | 2019-04-24 | 2019-06-28 | 桑艳玲 | A kind of method and its application preparing lactobacillus suspension from caprophyl |
| CN110878266A (en) * | 2019-11-21 | 2020-03-13 | 中国农业科学院兰州兽医研究所 | Lactobacillus johnsonii and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110577919B (en) | Heat-resistant animal bifidobacterium lactis subspecies separated from infant feces | |
| Sharifuzzaman et al. | Properties of probiotics Kocuria SM1 and Rhodococcus SM2 isolated from fish guts | |
| CN111100821B (en) | Streptococcus and application thereof | |
| CN108048352B (en) | Enterococcus faecium XC2 capable of producing antibacterial substances and screening method and application thereof | |
| CN113249255B (en) | Bacillus subtilis for preventing and controlling enteritis of poultry and application thereof | |
| CN110004072B (en) | Probiotic enterococcus faecalis isolate A3-1 and application thereof | |
| CN110438044B (en) | Bacillus belgii YFI-4 and application thereof in preparation of aquatic bacteria bacteriostatic agent | |
| Li et al. | Virulence properties of Vibrio vulnificus isolated from diseased zoea of freshness shrimp Macrobrachium rosenbergii | |
| CN117143767B (en) | Breast milk-derived fermented lactobacillus mucilaginosus MSJK capable of regulating intestinal flora and application thereof | |
| Ahmed et al. | Molecular and phenotypical characterization of mannheimia haemolytica isolated from goats in Baghdad province | |
| CN115725456A (en) | Lactobacillus salivarius and application thereof | |
| CN116162569A (en) | Bifidobacterium animalis subspecies BL03 and application thereof | |
| CN108441434A (en) | A kind of method of the separation of probiotic yak source lactic acid bacteria, identification and preliminary screening | |
| Rapsang et al. | Molecular and probiotic functional characterization of Lactobacillus spp. associated with traditionally fermented fish, Tungtap of Meghalaya in northeast India | |
| JP6785324B2 (en) | Bacillus licheniformis NY1505 strain that mass-produces α-glucosidase inhibitors | |
| CN109897800B (en) | Selenium-rich enterococcus durans A8-1 and application thereof | |
| Joh et al. | Characterization of Yersinia ruckeri isolated from the farm-cultured eel Anguilla japonica in Korea | |
| KR101201420B1 (en) | A feed additive containing novel Lactobacillus jonhsonnii | |
| CN114395511B (en) | Bacillus licheniformis FY1 and application thereof | |
| Darniati et al. | Detection of multidrug-resistance Klebsiella pneumoniae isolated from oropharyngeal swab in broiler chickens | |
| CN114480204B (en) | Bacillus nicotinate FY2 and application thereof | |
| Zhao et al. | Isolation and characterization of four pathogenic strains of Vibrio spp. from farmed sea urchins, Strongylocentrotus intermedius, in China | |
| CN116064317B (en) | Raccoon dog-derived extra-intestinal pathogenic escherichia coli and application thereof | |
| CN117070413B (en) | Lactobacillus paracasei BY5 and application thereof | |
| CN111607541B (en) | Rainbow trout-derived bacillus subtilis strain and screening method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180824 |