CN108440673B

CN108440673B - Fc fusion protein PD1/FGFR1 and application thereof

Info

Publication number: CN108440673B
Application number: CN201810306766.0A
Authority: CN
Inventors: 郑少江; 郑立平; 卢彦达; 郭峻莉; 张晓钿; 黄用豪; 吴新来
Original assignee: Hainan Medical College
Current assignee: Hainan Medical College
Priority date: 2018-04-08
Filing date: 2018-04-08
Publication date: 2021-08-17
Anticipated expiration: 2038-04-08
Also published as: CN108440673A

Abstract

The invention relates to the technical field of antitumor drugs, and provides an Fc fusion protein PD1/FGFR1 obtained by encoding genes of PD1, FGFR1 and an Fc segment of a murine antibody. The Fc fusion protein PD1/FGFR1 has a remarkable tumor vessel targeting effect, so that effective substances are enriched in tumor tissues and/or tumor neovascularization at high concentration, contains PD1 protein, is combined with PDL1 in a tumor microenvironment, and is reduced by competitive combination of the PD1 on the surface of a T cell and ligands PDL1 and PDL2 on the surface of the tumor cell so as to block continuous activation of a PD1 signal channel, so that the immunosuppressive effect of the fusion protein removal is fully exerted, and the efficient tumor immunotherapy effect is provided.

Description

Fc fusion protein PD1/FGFR1 and application thereof

Technical Field

The invention relates to the field of antitumor drugs, in particular to an Fc fusion protein PD1/FGFR1 for coding specificity antitumor, a nucleotide sequence, a recombinant expression vector, an expression cell and application thereof, and also relates to an antitumor drug containing the Fc fusion protein PD1/FGFR 1.

Background

Programmed Cell death protein 1(PD1), an immunoglobulin superfamily type I transmembrane glycoprotein, belongs to the T Cell co-inhibitory receptor. It can be inducibly expressed on the surface of activated T cells, B cells, NK cells, monocytes and dendritic cells, and combined with its ligands PDL1, PDL2 (which are mainly expressed in the tumor microenvironment, exposed to antigen for a long time and mediate T cell inhibition) to inhibit the activation of lymphocytes, thereby inhibiting the immune response of immune cells in the tumor microenvironment.

Recent studies have shown that immunotherapy against PD1 is effective against a variety of tumors, and that immunosuppression of the tumor microenvironment can be effectively eliminated by blocking the PD1 and PDL1/2 signaling pathways, significantly increasing the anti-tumor immune activity of T cells, since immune cells can be individually emphatic and individually destroy tumor cells according to a combat program once they are attacked by the PD1 antibody. Immunotherapy against the PD1/PDL1, PDL2 pathway induces a very long lasting immune response even in patients who are not effective for other treatments, being by far the most successful immunotherapy strategy among all types of tumors.

At present, the immunotherapy cost of PD1 is expensive, and the immunotherapy for tumor therapy generally has the problem of low efficiency, so that the further clinical popularization is limited.

Disclosure of Invention

In order to further improve the anti-tumor effect of PD1, the invention provides a specific anti-tumor Fc fusion protein PD1/FGFR1, which has specific targeting on tumor cells and tumor neovascularization and can obviously inhibit tumor growth.

The invention also aims to provide a specific anti-tumor medicament comprising the Fc fusion protein PD1/FGFR 1.

In order to solve the technical problems, the invention provides the following technical scheme:

the invention provides an Fc fusion protein PD1/FGFR1 which is obtained by encoding PD1, FGFR1 and encoding genes of a murine antibody segment.

Preferably, the sequence of the PD1, FGFR1 and the Fc segment coding genes of the murine antibody is PD1-FGFR1-Fc from 5 'end to 3' end.

Preferably, the coding gene of the PD1 is selected from a nucleotide sequence shown in SEQ ID NO. 2 or a nucleotide sequence which has more than 99 percent of homology with the nucleotide sequence shown in SEQ ID NO. 2;

the encoding gene of FGFR1 is selected from the nucleotide sequence shown in SEQ ID NO. 3 or the nucleotide sequence with 99 percent homology with the nucleotide sequence shown in SEQ ID NO. 3;

the encoding gene of the Fc segment of the murine antibody is selected from a nucleotide sequence shown in SEQ ID NO. 4 or a nucleotide sequence which has over 99 percent of homology with the nucleotide sequence shown in SEQ ID NO. 4.

Preferably, the nucleotide sequence of the Fc fusion protein PD1/FGFR1 is shown as SEQ ID NO. 1.

Preferably, the amino acid sequence of the fusion protein is selected from the amino acid sequence shown in SEQ ID NO. 7 or an amino acid sequence with 99% homology with the amino acid sequence shown in SEQ ID NO. 7.

The invention provides a nucleic acid molecule which is a nucleotide sequence for coding Fc fusion protein PD1/FGFR1 in the technical scheme.

The invention provides a recombinant expression vector which comprises the nucleic acid molecule in the technical scheme.

The invention provides an expression cell containing the recombinant expression vector of the technical scheme.

The Fc fusion protein PD1/FGFR1, the nucleic acid molecule, the recombinant expression vector or the expression cell in the technical scheme of the invention are applied to the preparation of specific antitumor drugs.

The invention also provides a specific anti-tumor medicament which comprises the Fc fusion protein PD1/FGFR1 and pharmaceutically acceptable auxiliary materials.

Compared with the prior art, the technical scheme provided by the invention has the following advantages:

the invention provides an Fc fusion protein PD1/FGFR1 obtained by encoding genes of PD1, FGFR1 and an Fc segment of a murine antibody. The Fc fusion protein PD1/FGFR1 has a remarkable tumor blood vessel targeting effect, so that effective substances are enriched in tumor tissues and/or tumor neovascularization at high concentration, the PD1 protein contained in the Fc fusion protein PD1/FGFR1 is combined with PDL1 in a tumor microenvironment, and the combination of PD1 on the surface of a T cell and ligands PDL1 and PDL2 on the surface of the tumor cell is reduced through competitive combination so as to block the continuous activation of a PD1 signal path, thereby fully exerting the effect of removing immunosuppression and providing a high-efficiency tumor immunotherapy effect.

Meanwhile, the Fc fusion protein PD1/FGFR1 comprises a mouse antibody Fc segment, the mouse antibody Fc segment can prolong the half-life of the fusion protein in vivo, so that the action time is prolonged, the presenting capability of antigen presenting cells to antigens is enhanced, the antigen presenting capability can be remarkably enhanced by combining the mouse antibody Fc segment with the FGFR1/PD1, and the killing capability of the Fc fusion protein PD1/FGFR1 to tumor cells is further enhanced. The Fc fusion protein PD1/FGFR1 skillfully utilizes the tumor blood vessel specific targeting function of FGFR1 and the functions of prolonging the half-life period in vivo and enhancing the antigen presenting capability of a mouse Fc section, so that PD1 can target tumor tissues more accurately and further induce stronger and lasting anti-tumor effect. Research shows that the Fc fusion protein PD1/FGFR1 has higher tumor vascular targeting property, can obviously inhibit the growth of tumors such as breast cancer and the like and reduce the tumor volume, and the tumor inhibition rate can reach more than 70%.

Drawings

FIG. 1 is a schematic structural diagram of a recombinant expression vector of the Fc fusion protein PD1/FGFR 1;

FIG. 2 is an electrophoretogram of PCR amplification products of step 3) of example 1,

wherein M is the DNA standard molecular weight, and 1-3 are amplification products obtained in the step 3);

FIG. 3 is an electrophoretogram of PCR identification of step 7) of example 1,

wherein M is DNA standard molecular weight, and 1-5 are randomly selected transformation bacterium amplification products;

FIG. 4 is an electrophoretogram identified by electrophoretic separation of Fc fusion protein PD1/FGFR1 in example 2,

wherein M is a protein standard molecular weight, Lane 1 is a denatured electrophoretogram of 1. mu.g Fc fusion protein PD1/FGFR1, Lane 2 is a non-denatured electrophoretogram of 1. mu.g Fc fusion protein PD1/FGFR 1;

FIG. 5 is a photograph of immunofluorescent staining in example 3,

wherein, A is the tumor tissue immunofluorescent staining pattern of a test group mouse, and B is the tumor tissue immunofluorescent staining pattern of a control group mouse;

FIG. 6 is a graph of the time of administration and tumor volume for each group of mice in example 4;

FIG. 7 is a bar graph of the effect of fusion protein drug on tumor weight of mouse breast cancer 4T 1;

indicates that there was a very significant difference from the saline control group.

Detailed Description

The invention provides an Fc fusion protein PD1/FGFR1 obtained by encoding genes of PD1, FGFR1 and an Fc segment of a murine antibody. The molecular weight of the Fc fusion protein PD1/FGFR1 is 83KDa, and the Fc fusion protein has tumor vascular targeting specificity and obvious anti-tumor effect.

In the invention, in the nucleotide sequence coding the Fc fusion protein PD1/FGFR1, the sequence of the coding genes is preferably as follows: PD1-FGFR1-Fc is arranged from the 5 'end to the 3' end in sequence.

In the invention, the encoding gene of PD1 is any nucleotide sequence capable of encoding PD1 protein, preferably selected from the nucleotide sequence shown in SEQ ID NO. 2 or a nucleotide sequence with more than 99% homology with the nucleotide sequence shown in SEQ ID NO. 2, and in some embodiments of the invention, the encoding gene of PD1 is more preferably the nucleotide sequence shown in SEQ ID NO. 2. The nucleotide sequence having more than 99% homology with the nucleotide sequence shown in SEQ ID NO. 2 can be obtained from PD1 coding sequence known in the art, and is not described in detail herein.

The nucleotide sequence shown in SEQ ID NO. 2 is as follows:

GAGGTCCCCAATGGGCCCTGGAGGTCCCTCACCTTCTACCCAGCCTGGCTCACAGTGTCAGAGGGAGCAAATGCCACCTTCACCTGCAGCTTGTCCAACTGGTCGGAGGATCTTATGCTGAACTGGAACCGCCTGAGTCCCAGCAACCAGACTGAAAAACAGGCCGCCTTCTGTAATGGTTTGAGCCAACCCGTCCAGGATGCCCGCTTCCAGATCATACAGCTGCCCAACAGGCATGACTTCCACATGAACATCCTTGACACACGGCGCAATGACAGTGGCATCTACCTCTGTGGGGCCATCTCCCTGCACCCCAAGGCAAAAATCGAGGAGAGCCCTGGAGCAGAGCTCGTGGTAACAGAGAGAATCCTGGAGACCTCAACAAGATATCCCAGCCCCTCGCCCAAACCAGAAGGCCGGTTTCAAGGCATG。

programmed cell death protein 1(PD1) belongs to a T cell co-inhibitory receptor, and is combined with ligands PDL1 and PDL2 to generate an inhibiting effect on the activation of lymphocytes. Ligands PDL1 and PDL2 of PD1 protein can be highly expressed in tumor cells, PDL1 and PDL2 produced by the tumor cells can be specifically combined with PD1 in a microenvironment, so that a PD1 pathway is continuously activated, the function of T cells is inhibited, and the tumor cells cannot be normally killed through immune action. The fusion protein encoded by the nucleotide sequence contains PD1 protein, is combined with PDL1 or PDL2 in a tumor microenvironment, and reduces the combination of PD1 on the surface of a T cell and PDL1 and PDL2 as ligands on the surface of the tumor cell through competitive combination, thereby blocking the continuous activation of a PD1 signal channel, achieving the effect of removing immune suppression, and activating a normal body immune system to kill tumor cells.

In the invention, the encoding gene of the FGFR1 is any nucleotide sequence capable of encoding FGFR1 protein, and is preferably selected from the nucleotide sequence shown in SEQ ID NO. 3 or a nucleotide sequence with more than 99% homology with the nucleotide sequence shown in SEQ ID NO. 3. In some embodiments of the invention, the gene encoding FGFR1 is more preferably the nucleotide sequence set forth in SEQ ID No. 3. The nucleotide sequence with more than 99 percent of homology with the nucleotide sequence shown in SEQ ID NO. 3 can be obtained from an FGFR1 coding sequence known in the field, and is not described in detail herein.

The nucleotide sequence shown in SEQ ID NO. 3 is as follows:

GGTGGAGGTTCGGGTGGAGGTTCAGGTGGAGGTTCTAGGCCAGCCCCAACCTTGCCTGAACAAGCTCAGCCCTGGGGAGTCCCTGTGGAAGTGGAGTCTCTCCTGGTCCACCCTGGCGACCTGCTACAGCTTCGCTGTCGGCTTCGCGATGATGTGCAGAGCATCAACTGGCTGCGGGATGGGGTGCAGCTGGTGGAGAGCAACCGTACCCGCATCACAGGGGAGGAGGTGGAGGTGCGGGACTCCATCCCCGCTGACTCTGGCCTCTACGCTTGCGTGACCAGCAGCCCCTCTGGCAGCGATACCACCTACTTCTCCGTCAATGTCTCAGATGCACTCCCATCCTCGGAAGATGATGACGACGACGATGACTCCTCCTCGGAGGAGAAAGAGACGGACAACACCAAACCAAACCGTAGGCCTGTAGCTCCCTACTGGACATCCCCAGAGAAAATGGAGAAGAAACTGCATGCGGTGCCCGCTGCCAAGACGGTGAAGTTCAAGTGCCCGTCGAGTGGGACACCCAACCCCACTCTGCGCTGGTTGAAAAATGGCAAAGAGTTTAAGCCTGACCACCGAATTGGAGGCTACAAGGTTCGCTATGCCACCTGGAGCATCATAATGGATTCTGTGGTGCCTTCTGACAAGGGCAACTACACCTGCATCGTGGAGAATGAGTATGGGAGCATCAACCACACCTACCAGCTTGACGTC GTGGAACGATCTCCGCACCGACCCATCCTTCAGGCAGGGCTGCCTGCCAACAAGACAGTGGCCCTGGGCAGCAATGTGGAGTTCATGTGTAAGGTGTACAGCGATCCGCAGCCTCACATTCAGTGGCTGAAGCACATCGAGGTGAACGGGAGTAAGATCGGGCCAGACAACTTGCCGTATGTCCAGATCCTGAAGACTGCTGGAGTTAATACCACCGACAAGGAAATGGAGGTGCTTCATCTACGGAATGTCTCCTTTGAGGATGCGGGGGAGTATACGTGCTTGGCGGGTAACTCTATCGGACTCTCCCATCACTCTGCATGGTTGACCGTTCTGGAAGCCCTGGAAGAGAGACCAGCTGTGATGACCTCACCGCTCTACCTGGA。

basic fibroblast growth factor receptor 1(FGFR1) plays a biological activity by binding with high-affinity ligand bFGF to promote tumor angiogenesis, and FGFR1 is selected to form fusion protein based on the following reasons: (1) the FGFR1 is highly expressed in endothelial cells of tumor new vessels, is not expressed in normal cells and vascular endothelial cells, and has extremely strong specificity to tumor cells; (2) genetic stability, genetic stability of vascular endothelial cells and low mutation rate, so that the treatment strategy aiming at the vascular endothelial cells of the tumor can not or only cause very little drug resistance. Therefore, the Fc fusion protein PD1/FGFR1 formed by the FGFR1, the PD1 and the Fc segment of the murine antibody can provide precise targeting effect, so that the antitumor active ingredients are concentrated in tumor cells and/or tumor neovasculature to fully exert antitumor efficacy.

The Fc fusion protein PD1/FGFR1 contains FGFR1 protein, can be specifically combined with high-expression bFGF in tumor cells after entering into a body, and achieves the purpose of specifically targeting the Fc fusion protein PD1/FGFR1 to the tumor cells andor tumor neovasculature. Meanwhile, after FGFR1 in the Fc fusion protein PD1/FGFR1 is combined with the ligand bFGF in a tumor cell, the Fc fusion protein can also interfere with a bFGF/FGFR1 signal pathway to further inhibit the generation of tumor neovascularization, so that the effect of inhibiting the tumor from continuing to grow is achieved.

In the invention, the encoding gene of the Fc segment of the murine antibody is any nucleotide sequence capable of encoding the Fc segment of the murine antibody, and is preferably selected from the nucleotide sequence shown in SEQ ID NO. 4 or a nucleotide sequence with more than 99% homology with the nucleotide sequence shown in SEQ ID NO. 4. In some embodiments of the invention, the gene encoding the Fc fragment of the murine antibody is preferably the nucleotide sequence shown in SEQ ID NO. 4. The nucleotide sequence having more than 99% homology with the nucleotide sequence shown in SEQ ID NO. 4 can be obtained from the coding sequence of the Fc segment of the murine antibody known in the field, and is not described in detail herein.

The nucleotide sequence shown in SEQ ID NO. 4 is as follows:

CAGAGGGCCCACAATCAAGCCCTGTCCTCCATGCAAATGCCCAGCACCTAACCTCTTGGGTGGACCATCCGTCTTCATCTTCCCTCCAAAGATCAAGGATGTACTCATGATCTCCCTGAGCCCCATAGTCACATGTGTGGTGGTGGATGTGAGCGAGGATGACCCAGATGTCCAGATCAGCTGGTTTGTGAACAACGTGGAAGTACACACAGCTCAGACACAAACCCATAGAGAGGATTACAACAGTACTCTCCGGGTGGTCAGTGCCCTCCCCATCCAGCACCAGGACTGGATGAGTGGCAAGGAGTTCAAATGCAAGGTCAACAACAAAGACCTCCCAGCGCCCATCGAGAGAACCATCTCAAAACCCAAAGGGTCAGTAAGAGCTCCACAGGTATATGTCTTGCCTCCACCAGAAGAAGAGATGACTAAGAAACAGGTCACTCTGACCTGCATGGTCACAGACTTCATGCCTGAAGACATTTACGTGGAGTGGACCAACAACGGGAAAACAGAGCTAAACTACAAGAACACTGAACCAGTCCTGGACTCTGATGGTTCTTACTTCATGTACAGCAAGCTGAGAGTGGAAAAGAAGAACTGGGTGGAAAGAAATAGCTACTCCTGTTCAGTGGTCCACGAGGGTCTGCACAATCACCACACGACTAAGAGCTTCTCCCGGACTCCGGGTAAATGA。

the Fc fusion protein is produced by fusion of fusion protein molecules and an antibody Fc segment, not only can retain the whole biological activity of the original functional protein, but also can prolong the half-life in vivo, and completely replaces the function of an antibody, so that the immunogenicity is extremely low. The invention utilizes the advantages of the murine antibody Fc segment, and can also enhance the presentation capacity of antigen presenting cells to target antigens. The Fc fusion protein PD1/FGFR1 is competitively combined with a PD1 ligand on the surface of a tumor cell in vivo through PD1, so that a PD1 channel is blocked to achieve the aim of removing immunosuppression. The effect of enhancing the presenting capability of the Fc segment of the murine antibody can further enhance the immune killing effect of organisms, and the anti-tumor effect is enhanced by the cooperation of PD1, so that the Fc fusion protein PD1/FGFR1 has a remarkable tumor cell killing effect.

The invention integrates tumor targeting (FGFR1), anti-tumor angiogenesis (FGFR1), immunosuppression clearing (PD1) and antigen presentation enhancing (murine antibody Fc segment) to construct a nucleotide sequence, thereby obtaining the Fc fusion protein PD1/FGFR1 with specific anti-tumor effect by coding, and all parts in the Fc fusion protein PD1/FGFR1 are mutually promoted, thereby cooperatively playing the anti-tumor effect and achieving the effects of inhibiting the tumor growth and prolonging the survival time of cancer patients.

The existing research mainly adopts a mode of directly injecting PD1 antibody into a body to block pathways of PD1/PDL1 and PDL2, however, on one hand, the mode has partial loss after the PD1 antibody enters a body; on the other hand, the PD1 antibody is difficult to directly reach tumor tissues after entering the body, the distribution of the PD1 antibody is difficult to effectively control, and therefore, an effective therapeutic dose is difficult to form in the tumor tissues. The fusion protein provided by the invention adopts Fc fusion protein PD1/FGFR1 which is preferably capable of local intratumoral administration, directly obtains high-concentration PD1 at a tumor cell site in a targeted manner, and solves the problems of activity loss and difficulty in obtaining effective concentration at a tumor tissue part in the direct administration of a conventional PD1 antibody.

In the invention, the amino acid sequence of the Fc fusion protein PD1/FGFR1 is selected from the amino acid sequence shown in SEQ ID NO. 7 or an amino acid sequence with 99% homology with the amino acid sequence shown in SEQ ID NO. 7.

The amino acid sequence shown in SEQ ID NO. 7 is as follows:

EVPNGPWRSLTFYPAWLTVSEGANATFTCSLSNWSEDLMLNWNRLSPSNQTEKQAAFCNGLSQPVQDARFQIIQLPNRHDFHMNILDTRRNDSGIYLCGAISLHPKAKIEESPGAELVVTERILETSTRYPSPSPKPEGRFQGMGGGSGGGSGGGSRPAPTLPEQAQPWGVPVEVESLLVHPGDLLQLRCRLRDDVQSINWLRDGVQLVESNRTRITGEEVEVRDSIPADSGLYACVTSSPSGSDTTYFSVNVSDALPSSEDDDDDDDSSSEEKETDNTKPNRRPVAPYWTSPEKMEKKLHAVPAAKTVKFKCPSSGTPNPTLRWLKNGKEFKPDHRIGGYKVRYATWSIIMDSVVPSDKGNYTCIVENEYGSINHTYQLDVVERSPHRPILQAGLPANKTVALGSNVEFMCKVYSDPQPHIQWLKHIEVNGSKIGPDNLPYVQILKTAGVNTTDKEMEVLHLRNVSFEDAGEYTCLAGNSIGLSHHSAWLTVLEALEERPAVMTSPLYLEDPRGPTIKPCPPCKCPAPNLLGGPSVFIFPPKIKDVLMISLSPIVTCVVVDVSEDDPDVQISWFVNNVEVHTAQTQTHREDYNSTLRVVSALPIQHQDWMSGKEFKCKVNNKDLPAPIERTISKPKGSVRAPQVYVLPPPEEEMTKKQVTLTCMVTDFMPEDIYVEWTNNGKTELNYKNTEPVLDSDGSYFMYSKLRVEKKNWVERNSYSCSVVHEGLHNHHTTKSFSRTPG

the invention provides a nucleic acid molecule for encoding Fc fusion protein PD1/FGFR1 in the technical scheme. The nucleotide sequence of the encoded Fc fusion protein PD1/FGFR1 is preferably shown as SEQ ID NO 1.

The invention provides a recombinant expression vector containing the nucleic acid molecule in the technical scheme, which is used for expressing Fc fusion protein PD1/FGFR 1. The recombinant expression vector is preferably a mammalian expression vector, and the expression of the recombinant expression vector in mammals is favorable for maintaining the biological activity of the Fc fusion protein PD1/FGFR 1. The map of the recombinant expression vector of the present invention is preferably as shown in FIG. 1.

The invention provides an expression cell containing the recombinant expression vector in the technical scheme, which is used for expressing Fc fusion protein PD1/FGFR 1. The invention preferably takes HEK293 cells as expression cells of the recombinant expression vector.

In the invention, the nucleotide sequence of the encoded Fc fusion protein PD1/FGFR1, the Fc fusion protein PD1/FGFR1 and the preparation and construction of the recombinant expression vector all adopt common methods in the field, and the invention is not particularly limited.

The invention also provides application of the Fc fusion protein PD1/FGFR1 in preparation of specific antitumor drugs.

The invention also provides application of the nucleotide sequence of the encoded Fc fusion protein PD1/FGFR1 in preparation of specific antitumor drugs.

The invention also provides application of the recombinant expression vector containing the nucleotide sequence of the encoded Fc fusion protein PD1/FGFR1 in preparation of specific antitumor drugs.

The invention also provides application of the expression cell of the recombinant expression vector containing the Fc fusion protein PD1/FGFR1 in preparation of specific antitumor drugs.

Preferably, the tumors in the above applications include, but are not limited to, breast cancer, malignant melanoma, non-small cell lung cancer, liver cancer, renal cell carcinoma, and the like.

The invention also provides a specific anti-tumor medicament which comprises the Fc fusion protein PD1/FGFR1 and pharmaceutically acceptable auxiliary materials. Preferably, in the specific antitumor drug, the content of the Fc fusion protein PD1/FGFR1 is 1-99%, and more preferably 50-99%.

In the invention, the specific anti-tumor medicine is preferably an anti-tumor vaccine, and the anti-tumor vaccine enriches high-concentration PD1 in local tumor tissues in vivo through intratumoral injection, thereby further playing an effective immune clearance role.

Furthermore, the specific anti-tumor medicament also comprises pharmaceutic adjuvants; the pharmaceutical excipients include, but are not limited to, one or more of pharmaceutical carriers, diluents, adjuvants and excipients. Wherein, the medicinal carrier comprises but is not limited to liposome, ethosome, polymer micelle, nano-structure lipid carrier, solid lipid nano-carrier, mesoporous silica nano-particle and the like; the medicinal adjuvants such as diluent, adjuvant and excipient can specifically include medicinal antiseptic, antioxidant, filler, disintegrant, wetting agent, emulsifier, suspending agent, solvent, dispersion medium, coating, antibacterial agent or isotonic and absorption retardant, etc.

Further, the dosage form of the specific antitumor drug of the present invention includes, but is not limited to, tablets, capsules, solutions, granules, pills, powders, ointments, pellets, suspensions, powders, injections, suppositories, creams, sprays, patches, sustained release preparations, controlled release preparations or targeted preparations; specifically, the tablets include, but are not limited to, sugar-coated tablets, film-coated tablets, enteric-coated tablets, buccal tablets, and the like; the solution includes but is not limited to injection and oral liquid; such capsules include, but are not limited to, hard capsules, soft capsules, and the like. Specifically, when the anti-tumor medicament needs to be prepared into a specific dosage form, a proper pharmaceutical auxiliary material is selected according to the dosage form.

Further, the administration route of the specific antitumor drug of the present invention includes, but is not limited to, injection, oral administration, rectal administration, and the like.

In order to further illustrate the present invention, the following embodiments are described in detail, but they should not be construed as limiting the scope of the present invention.

EXAMPLE 1 construction of recombinant plasmid

1) The PD1/Fc-pCDNA3.1 plasmid was prepared according to the method described in "cloning, eukaryotic expression and biological Activity detection of mouse soluble PD 1" (Amur, Liu dynasty, Tang nationality, et al. cloning, eukaryotic expression and biological Activity detection of mouse soluble PD1 [ J ]. Biotechnology report, 2011(2): 121-. The prepared PD1/Fc-pCDNA3.1 plasmid contains a PD1 coding gene shown as SEQ ID NO. 2.

2) According to the records of the literature, construction and expression of mouse FGFR1/MIP3a-Fc fusion gene eukaryotic expression vectors are recorded, MIP3a/FGFR1-Fc plasmids (Huangguhao, Yongzhuang, Zhang Dian, and the like, construction and expression of mouse FGFR1/MIP3a-Fc fusion gene eukaryotic expression vectors are prepared [ J ]. Chinese tropical medicine, 2017,17(4): 340. su 343.), and the prepared MIP3a/FGFR1-Fc plasmids contain the FGFR1 coding sequence shown as SEQ ID NO:3 and the murine antibody Fc fragment coding sequence shown as SEQ ID NO: 4.

3) Taking MIP3a/FGFR1-Fc plasmid prepared in the step 2) as a template, performing PCR amplification by using upstream and downstream primers to obtain an amplification product, performing electrophoresis on the amplification product, and obtaining a specific fragment with the size of about 1146bp by PCR amplification according to the result shown in figure 2, wherein the specific fragment conforms to a theoretical value, and thus the amplification product containing the target fragment, namely Linker-FGFR1-Fc is obtained.

Wherein, the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 5, namely:

AAGGCCGGTTTCAAGGCATGGGTGGAGGTTCGGGTGGAGGTTCAGGTGGAGGTTCTAG；

the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 6, namely:

GCTTGATTGTGGGCCCTCTGGGATCCTCCAGGTAGAGCGGTGAGGT。

the PCR amplification system is a 50 mu L system and comprises: ddH₂O41. mu.L, 10PCR Buffer 5. mu. L, dNTP (2.5mM each) 1. mu.L, upstream and downstream primers (20mM) 0.5. mu. L, Pfu each high fidelity DNA polymerase (2.5U/L) 1. mu.L, and template (20ng) 1. mu.L.

The PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min → denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 1min, and circulating for 30 times → full extension at 72 ℃ for 5 min.

4) Carrying out electrophoretic separation on the amplification product obtained in the step 3) by using 1.8% agarose gel, separating agarose gel of a target fragment Linker-FGFR1-Fc by using a scalpel in an ultraviolet transilluminator, and purifying the target fragment by using an Axygen agarose gel recovery kit (the detailed steps are shown in the relevant specifications).

5) Taking the PD1/Fc-pCDNA3.1 plasmid prepared in the step 1) as a vector, and carrying out enzyme digestion on the vector by using a restriction enzyme BamHI; taking 3 mu L of the target fragment (50ng) purified in the step 4), 3 mu L of the vector after enzyme digestion (50ng), 10 mu L of Gibson Mix and ddH₂Mixing O4. mu.L, and performing water bath at 50 ℃ for 15min to obtain a recombinant reaction solution.

6) Adding 5 μ l of the recombinant reaction solution into 50 μ l of competent cells of DH5a, mixing, and ice-cooling for 30 min; water bath at 42 deg.c for 90 sec and ice bath for 2 min; after 600. mu.l of LB was added and 1 hour at 37 ℃, 100. mu.l of the mixture was applied to an LB plate containing 100. mu.g/ml of LAmp and cultured overnight at 37 ℃ to obtain a transformant.

7) And (3) PCR identification of the recombinant plasmid:

randomly picking 8 clones with uniform size on the cultured transformed bacteria plate for PCR identification. A total of 25. mu.L of PCR reaction contained: ddH₂18.75 mu L of O, 2.5 mu L of 10PCRbuffer, 0.5 mu L of 10mmol dNTPs, 0.5 mu L of each of the upstream and downstream primers in the step 3), 0.25 mu L of Taq DNApolymerase (12U/L) and 2 mu L of the transformed strain.

The above system is pre-denatured at 94 ℃ for 5min, then denatured at 94 ℃ for 30sec, annealed at 56 ℃ for 30sec, extended at 72 ℃ for 1min, for 30 cycles, and finally extended at 72 ℃ for 5 min. The resulting product was detected by 1.2% agarose electrophoresis.

The results of the electrophoresis are shown in FIG. 3, and 4 clones out of 5 clones were positive clones. The specific DNA molecular fragment with the size of about 1146bp is obtained by the amplification of lanes 1-3 and 5, and the size of the specific DNA molecular fragment is consistent with that of the FGFR1 gene fragment, which indicates that the FGFR1 gene fragment is successfully inserted into a vector plasmid in the clones.

8) Sending the positive clone identified in the step 7) to Suzhou Jinzhi biotechnology and limited company for sequencing, and completely conforming to the expected sequence through sequencing comparison. The recombinant plasmid in the positive clone contains a nucleotide sequence shown as SEQ ID NO. 1.

Example 2 expression and purification of Fc fusion protein PD1/FGFR1

(1) Transient expression of Fc fusion protein PD1/FGFR1 in HEK293 cells

HEK293 cells in logarithmic growth phase were trypsinized and diluted to 6X 10⁵Density of/mL, inoculated into 15cm dishes, each dish with 20mL serum-free medium, cultured for 24 hours for transfection. The recombinant plasmid obtained in example 1 was transfected into HEK293 cells using Lipofectamine 2000 transfection reagent (Invitrogen corporation), and the plasmid used was extracted by endotoxin-free plasmid extraction kit (Sigma corporation). After the transfected cells were cultured in a 5% carbon dioxide incubator for 5 days, a supernatant was obtained. The yield of the fusion protein in the supernatant was measured by enzyme-linked immunosorbent assay (ELISA) at an expression concentration of 3.3 mg/L.

(2) Purification of Fc fusion protein PD1/FGFR1

The collected culture supernatant was purified by a ProteinA affinity column (purchased from GE). The purification column was washed and equilibrated with 1 × PBS (pH 7.4), loading rate 2mL/min, over 15 column volumes. The flow rate of the sample is adjusted to 1mL/min for sample loading. After the end of the loading, the purification column was washed with 1 × PBS (pH 7.4) at a loading rate of 2mL/min, and the column volume was 15 times. The liquid inlet end was changed to glycine solution (pH 2.5), and the flow rate was adjusted to 1mL/min to elute the fusion protein. The proteins were adjusted to neutral pH by adding tris8.0 buffer to the collection tubes. Finally the fusion protein was dialyzed into 1X PBS (pH 7.4). The purified Fc fusion protein PD1/FGFR1 is detected by SDS-PAGE.

The SDS-PAGE result is shown in FIG. 4, lane 1 is a denatured electrophoretogram of FGFR1-PD1/Fc fusion protein, and the molecular weight of the fusion protein is 130 KDa; lane 2 is a non-denaturing electrophoretogram of Fc fusion protein PD1/FGFR1, the molecular weight of the fusion protein being 83 KDa. It can be seen that the purified protein shows a relatively single band at around 83kDa, indicating that the collected protein is purified as a recombinant protein of interest.

Comparative example 1

1) The PD1/Fc-pCDNA3.1 plasmid was prepared according to the method described in "cloning, eukaryotic expression and biological Activity detection of mouse soluble PD 1" (Xiao Lin, Liu dynasty, Tang Guo Hui, et al. cloning, eukaryotic expression and biological Activity detection of mouse soluble PD1 [ J ]. Biotechnology Notification, 2011(2): 121-. The prepared PD1/Fc-pCDNA3.1 plasmid contains a PD1 coding gene shown as SEQ ID NO. 2.

2) The PD1/Fc-pCDNA3.1 plasmid was transferred into HEK293 cells for expression and purification according to the method described in example 2, resulting in a PD1/Fc fusion protein.

Comparative example 2

1) Cloning the coding sequence of FGFR1 protein and the coding gene of the Fc segment of the murine antibody into pCDNA3.1(+) plasmid (purchased from Invitrogen) according to a Gibson cloning method to prepare an FGFR1/Fc recombinant expression vector; wherein the coding sequence of the FGFR1 protein is shown as SEQ ID NO. 3, and the coding gene sequence of the Fc segment of the murine antibody is shown as SEQ ID NO. 4;

2) transferring the FGFR1/Fc recombinant expression vector obtained in the step 1) into HEK293 cells for expression and purification according to the method described in the example 2 to obtain the FGFR1/Fc fusion protein.

Example 3 tumor-specific targeting of Fc fusion protein PD1/FGFR1

1 preparation of the model

Mouse breast cancer cell line 4T1 was purchased and cultured, and the cell sap concentration of the cultured mouse breast cancer cell 4T1 was adjusted to 1X 10⁷one/mL, 0.1mL each, was inoculated subcutaneously into the right axilla of mice.

2 grouping and administration

The inoculated mice were randomly divided into test and control groups of 8 mice each until tumors grew to a volume of about 110mm³The Fc fusion protein PD1/FGFR1 prepared in example 2 and the fusion protein PD1/Fc prepared in comparative example 1 are injected into a test group and a control group in a tumor manner according to the proportion of 500 mug/kg of mouse body weight. Mice were sacrificed 30 days after each group administration, tumor tissues were taken out for cryo-sectioning and observation by immunofluorescence staining.

The result is shown in fig. 5, a is a staining graph of the tumor section of the experimental group of mice, and it can be seen that the green fluorescence signal deposition is seen on the surface of the tumor microvascular, while no fluorescence signal is evident in other tissue components; b is a staining image of the section of the mouse in the control group, and no green fluorescence signal deposition is observed on the surface of the tumor microvasculature in the control group.

The Fc fusion protein PD1/FGFR1 prepared by the invention has higher tumor tissue specificity and blood vessel targeting property, can effectively enrich in tumor tissues and tumor neovascularization, and can reduce the dosage of medicaments.

Example 4

1. Preparation of the model

2. Grouping and administration of drugs

When the tumor grows to 100-150 mm³Animals were randomly divided into 5 groups of 8 animals each. The specific grouping is as follows:

(1) PD1/FGFR1/Fc group: the Fc fusion protein PD1/FGFR1 prepared in example 2 was mixed with adjuvant (freund's complete adjuvant for the first time, and freund's incomplete adjuvant for the rest) 1:1 after emulsification, carrying out intratumoral injection on the mouse, and once every three days of administration;

(2) PD1/Fc group: the PD1/Fc fusion protein prepared in comparative example 1 was mixed with adjuvant (Freund's complete adjuvant was used for the first time, and Freund's incomplete adjuvant was used for the remainder) 1:1 after emulsification, carrying out intratumoral injection on the mouse, and once every three days of administration;

(3) FGFR1/Fc group: the FGFR1/Fc fusion protein prepared in comparative example 2 was mixed with adjuvant (freund's complete adjuvant was used for the first time, and freund's incomplete adjuvant was used for the rest) 1:1 after emulsification, carrying out intratumoral injection on the mouse, and once every three days of administration;

(4) adjuvant saline group: equal volumes of saline and adjuvant (Freund's complete adjuvant was used for the first time, and Freund's incomplete adjuvant was used for the rest) 1:1 after emulsification, carrying out intratumoral injection on the mouse, and once every three days of administration;

(5) physiological saline group: the same volume of physiological saline as that of the group (1) was injected intratumorally and administered once for three days.

The antitumor effect of the test sample was dynamically observed using a method for measuring tumor size. Animals were observed for changes in the course of and after administration (activity, appearance, spirit), and after 30 days of continuous administration, mice were sacrificed immediately and tumor masses were surgically removed and weighed.

The preparation method of the fusion protein and the adjuvant comprises the following steps:

the drug administration dose in the experiment is 500ug/kg, the concentration of the fusion protein is 0.1mg/ml, and the administration volume is 100ul/20g mouse body weight. When in preparation, the protein is diluted to the concentration of 0.2mg/ml by normal saline, the mixture is ground according to the volume ratio of 1:1 to the adjuvant, the obtained concentration is 0.1mg/ml, and the mixture is injected into tumors according to 100ul/20 g.

The saline adjuvant group is ground and emulsified by 1:1 of saline and adjuvant, and injected intratumorally according to 100ul/20 g.

The emulsification method of the adjuvant and the fusion protein solution comprises the following steps: a certain volume of adjuvant is put into a sterile glass mortar, and then an equal volume of fusion protein solution is slowly dripped while grinding in the same direction. After all the protein is added, continuously grinding for a period of time to make the milk white viscous water-in-oil emulsion.

Freund's complete adjuvant used in this experiment was purchased from Sigma, cat # F5881; freund's incomplete adjuvant was purchased from Sigma, cat # F5506.

3. Observation index

1) The formula for Tumor Volume (TV) is:

TV＝1/2×a×b²

wherein a and b represent length and width, respectively.

2) Calculating Relative Tumor Volume (RTV) according to the measurement result, wherein the calculation formula is as follows:

RTV＝V_t/V₀

wherein V₀When administered separately from the cage (i.e. d)₀) Measurement of the resulting tumor volume, V_tFor the tumor volume at each measurement.

3) Evaluation indexes of antitumor activity: the relative tumor proliferation rate T/C (%) was calculated as follows:

T_RTV: treatment group RTV (relative tumor volume); c_RTV: model group (saline group) RTV (relative tumor volume);

4) evaluation indexes of antitumor activity: the tumor growth inhibition (%) is calculated as follows:

4. and (4) observing results:

(1) effect of PD1/FGFR1/Fc on tumor volume

TABLE 1 tumor volume change (cm) in groups administered for 30d consecutively³)

Group of	Physiological saline group	Adjuvant physiological saline group	FGFR1/Fc group	PD1/Fc group	PD1/FGFR1/Fc group
						1d	0.112	0.109	0.112	0.111	0.112
4d	0.204	0.191	0.181	0.174	0.166
						7d	0.327	0.319	0.265	0.254	0.230
10d	0.523	0.479	0.379	0.360	0.337
						13d	0.771	0.747	0.498	0.494	0.413
16d	1.035	0.966	0.594	0.571	0.475
						19d	1.305	1.189	0.665	0.646	0.541
22d	1.584	1.467	0.742	0.713	0.587
						25d	1.825	1.701	0.791	0.739	0.635
28d	2.192	1.969	0.871	0.786	0.677
						31d	2.550	2.348	0.937	0.845	0.730

The tumor volume change observed for each group of mice after 30 days of continuous administration is shown in FIG. 6, and the specific results are shown in Table 1.

As shown in fig. 6 and the data in table 1, the tumor volumes of the PD1/FGFR1/Fc group, the FGFR1/Fc group, and the PD1/Fc group were all significantly decreased compared to the saline group or the adjuvant saline group, and the tumor volumes did not significantly increase with the prolonged administration, i.e., the Fc fusion proteins PD1/FGFR1, FGFR1/Fc fusion protein, and PD1/Fc fusion protein all had a certain tumor growth inhibitory effect.

It can also be seen that the tumor volumes were smaller in the PD1/FGFR1/Fc group compared to the FGFR1/Fc group and the PD1/Fc group, and were significantly different. The Fc fusion protein PD1/FGFR1 provided by the invention has more remarkable effects of inhibiting tumor growth and reducing tumor volume compared with the PD1/Fc fusion protein and the FGFR1/Fc fusion protein.

(2) Effect of Fc fusion protein PD1/FGFR1 on tumor weight

TABLE 2 tumor weight (g) after 30 days of administration for each group

Group of	Physiological saline	Adjuvant physiological saline group	FGFR1/Fc group	PD1-Fc group	PD1/FGFR1/Fc group
						Mouse
1	2.75	2.86	1.06	1.16	0.86
						Mouse 2	2.89	2.79	1.05	1.24	0.93
Mouse 3	3.16	3.04	1.37	1.18	0.81
						Mouse 4	3.06	2.69	1.41	0.91	0.99
Mouse 5	3.2	2.81	1.18	1.35	0.87
						Mean tumor weight	3.01	2.84	1.21	1.17	0.89
P value	-	0.13	2.86×e^-7	2.30×e^-7	2.30×e^-6
						Tumor inhibition rate	-	5.8％	59.7％	61.2％	70.4％

The tumor weights of the mice in each group after 30 days of continuous administration are shown in FIG. 7, and the specific tumor weights and tumor inhibition rates are shown in Table 2.

As shown in FIG. 7 and Table 2, the tumor weights of the PD1/FGFR1/Fc group, the FGFR1/Fc group and the PD1/Fc group are significantly different from those of the normal saline group or the adjuvant normal saline group, which indicates that the Fc fusion proteins PD1/FGFR1, FGFR1/Fc fusion protein and PD1/Fc fusion protein all have significant effects of inhibiting tumor growth and killing tumors.

It can also be seen that compared with the FGFR1/Fc group and the PD1/Fc group, the tumor weight of the PD1/FGFR1/Fc group is lower after 30d administration, and the tumor inhibition rate reaches 70.4 percent, namely the Fc fusion protein PD1/FGFR1 has more obvious tumor inhibition effect and obvious curative effect compared with the FGFR1/Fc fusion protein and the PD1/Fc fusion protein.

To sum up, the experiment establishes a 4T1 breast cancer tumor model to observe the anti-tumor effect of the Fc fusion protein PD1/FGFR1, and the result shows that the Fc fusion protein PD1/FGFR1 can effectively treat the tumor by being used as the anti-tumor drug (the single FGFR1/Fc fusion protein, the PD1/Fc fusion protein, the normal saline adjuvant and the normal saline group are used as controls), so that the tumor growth is obviously inhibited, the tumor volume is obviously reduced, and the tumor weight is obviously reduced; the immunotherapy of the single FGFR1/Fc fusion protein and PD1/Fc fusion protein has certain anti-tumor effect, but the anti-tumor effect is not as remarkable as that of the Fc fusion protein PD1/FGFR1 provided by the invention.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Hainan college of medicine

<120> Fc fusion protein PD1/FGFR1 and application thereof

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2242

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aagcttcgag gtccccaatg ggccctggag gtccctcacc ttctacccag cctggctcac 60

agtgtcagag ggagcaaatg ccaccttcac ctgcagcttg tccaactggt cggaggatct 120

tatgctgaac tggaaccgcc tgagtcccag caaccagact gaaaaacagg ccgccttctg 180

taatggtttg agccaacccg tccaggatgc ccgcttccag atcatacagc tgcccaacag 240

gcatgacttc cacatgaaca tccttgacac acggcgcaat gacagtggca tctacctctg 300

tggggccatc tccctgcacc ccaaggcaaa aatcgaggag agccctggag cagagctcgt 360

ggtaacagag agaatcctgg agacctcaac aagatatccc agcccctcgc ccaaaccaga 420

aggccggttt caaggcatgg gtggaggttc gggtggaggt tcaggtggag gttctaggcc 480

agccccaacc ttgcctgaac aagctcagcc ctggggagtc cctgtggaag tggagtctct 540

cctggtccac cctggcgacc tgctacagct tcgctgtcgg cttcgcgatg atgtgcagag 600

catcaactgg ctgcgggatg gggtgcagct ggtggagagc aaccgtaccc gcatcacagg 660

ggaggaggtg gaggtgcggg actccatccc cgctgactct ggcctctacg cttgcgtgac 720

cagcagcccc tctggcagcg ataccaccta cttctccgtc aatgtctcag atgcactccc 780

atcctcggaa gatgatgacg acgacgatga ctcctcctcg gaggagaaag agacggacaa 840

caccaaacca aaccgtaggc ctgtagctcc ctactggaca tccccagaga aaatggagaa 900

gaaactgcat gcggtgcccg ctgccaagac ggtgaagttc aagtgcccgt cgagtgggac 960

acccaacccc actctgcgct ggttgaaaaa tggcaaagag tttaagcctg accaccgaat 1020

tggaggctac aaggttcgct atgccacctg gagcatcata atggattctg tggtgccttc 1080

tgacaagggc aactacacct gcatcgtgga gaatgagtat gggagcatca accacaccta 1140

ccagcttgac gtcgtggaac gatctccgca ccgacccatc cttcaggcag ggctgcctgc 1200

caacaagaca gtggccctgg gcagcaatgt ggagttcatg tgtaaggtgt acagcgatcc 1260

gcagcctcac attcagtggc tgaagcacat cgaggtgaac gggagtaaga tcgggccaga 1320

caacttgccg tatgtccaga tcctgaagac tgctggagtt aataccaccg acaaggaaat 1380

ggaggtgctt catctacgga atgtctcctt tgaggatgcg ggggagtata cgtgcttggc 1440

gggtaactct atcggactct cccatcactc tgcatggttg accgttctgg aagccctgga 1500

agagagacca gctgtgatga cctcaccgct ctacctggag gatcccagag ggcccacaat 1560

caagccctgt cctccatgca aatgcccagc acctaacctc ttgggtggac catccgtctt 1620

catcttccct ccaaagatca aggatgtact catgatctcc ctgagcccca tagtcacatg 1680

tgtggtggtg gatgtgagcg aggatgaccc agatgtccag atcagctggt ttgtgaacaa 1740

cgtggaagta cacacagctc agacacaaac ccatagagag gattacaaca gtactctccg 1800

ggtggtcagt gccctcccca tccagcacca ggactggatg agtggcaagg agttcaaatg 1860

caaggtcaac aacaaagacc tcccagcgcc catcgagaga accatctcaa aacccaaagg 1920

gtcagtaaga gctccacagg tatatgtctt gcctccacca gaagaagaga tgactaagaa 1980

acaggtcact ctgacctgca tggtcacaga cttcatgcct gaagacattt acgtggagtg 2040

gaccaacaac gggaaaacag agctaaacta caagaacact gaaccagtcc tggactctga 2100

tggttcttac ttcatgtaca gcaagctgag agtggaaaag aagaactggg tggaaagaaa 2160

tagctactcc tgttcagtgg tccacgaggg tctgcacaat caccacacga ctaagagctt 2220

ctcccggact ccgggtaaat ga 2242

<210> 2

<211> 432

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaggtcccca atgggccctg gaggtccctc accttctacc cagcctggct cacagtgtca 60

gagggagcaa atgccacctt cacctgcagc ttgtccaact ggtcggagga tcttatgctg 120

aactggaacc gcctgagtcc cagcaaccag actgaaaaac aggccgcctt ctgtaatggt 180

ttgagccaac ccgtccagga tgcccgcttc cagatcatac agctgcccaa caggcatgac 240

ttccacatga acatccttga cacacggcgc aatgacagtg gcatctacct ctgtggggcc 300

atctccctgc accccaaggc aaaaatcgag gagagccctg gagcagagct cgtggtaaca 360

gagagaatcc tggagacctc aacaagatat cccagcccct cgcccaaacc agaaggccgg 420

tttcaaggca tg 432

<210> 3

<211> 1100

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggtggaggtt cgggtggagg ttcaggtgga ggttctaggc cagccccaac cttgcctgaa 60

caagctcagc cctggggagt ccctgtggaa gtggagtctc tcctggtcca ccctggcgac 120

ctgctacagc ttcgctgtcg gcttcgcgat gatgtgcaga gcatcaactg gctgcgggat 180

ggggtgcagc tggtggagag caaccgtacc cgcatcacag gggaggaggt ggaggtgcgg 240

gactccatcc ccgctgactc tggcctctac gcttgcgtga ccagcagccc ctctggcagc 300

gataccacct acttctccgt caatgtctca gatgcactcc catcctcgga agatgatgac 360

gacgacgatg actcctcctc ggaggagaaa gagacggaca acaccaaacc aaaccgtagg 420

cctgtagctc cctactggac atccccagag aaaatggaga agaaactgca tgcggtgccc 480

gctgccaaga cggtgaagtt caagtgcccg tcgagtggga cacccaaccc cactctgcgc 540

tggttgaaaa atggcaaaga gtttaagcct gaccaccgaa ttggaggcta caaggttcgc 600

tatgccacct ggagcatcat aatggattct gtggtgcctt ctgacaaggg caactacacc 660

tgcatcgtgg agaatgagta tgggagcatc aaccacacct accagcttga cgtcgtggaa 720

cgatctccgc accgacccat ccttcaggca gggctgcctg ccaacaagac agtggccctg 780

ggcagcaatg tggagttcat gtgtaaggtg tacagcgatc cgcagcctca cattcagtgg 840

ctgaagcaca tcgaggtgaa cgggagtaag atcgggccag acaacttgcc gtatgtccag 900

atcctgaaga ctgctggagt taataccacc gacaaggaaa tggaggtgct tcatctacgg 960

aatgtctcct ttgaggatgc gggggagtat acgtgcttgg cgggtaactc tatcggactc 1020

tcccatcact ctgcatggtt gaccgttctg gaagccctgg aagagagacc agctgtgatg 1080

acctcaccgc tctacctgga 1100

<210> 4

<211> 697

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cagagggccc acaatcaagc cctgtcctcc atgcaaatgc ccagcaccta acctcttggg 60

tggaccatcc gtcttcatct tccctccaaa gatcaaggat gtactcatga tctccctgag 120

ccccatagtc acatgtgtgg tggtggatgt gagcgaggat gacccagatg tccagatcag 180

ctggtttgtg aacaacgtgg aagtacacac agctcagaca caaacccata gagaggatta 240

caacagtact ctccgggtgg tcagtgccct ccccatccag caccaggact ggatgagtgg 300

caaggagttc aaatgcaagg tcaacaacaa agacctccca gcgcccatcg agagaaccat 360

ctcaaaaccc aaagggtcag taagagctcc acaggtatat gtcttgcctc caccagaaga 420

agagatgact aagaaacagg tcactctgac ctgcatggtc acagacttca tgcctgaaga 480

catttacgtg gagtggacca acaacgggaa aacagagcta aactacaaga acactgaacc 540

agtcctggac tctgatggtt cttacttcat gtacagcaag ctgagagtgg aaaagaagaa 600

ctgggtggaa agaaatagct actcctgttc agtggtccac gagggtctgc acaatcacca 660

cacgactaag agcttctccc ggactccggg taaatga 697

<210> 5

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aaggccggtt tcaaggcatg ggtggaggtt cgggtggagg ttcaggtgga ggttctag 58

<210> 6

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gcttgattgt gggccctctg ggatcctcca ggtagagcgg tgaggt 46

<210> 7

<211> 743

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Glu Val Pro Asn Gly Pro Trp Arg Ser Leu Thr Phe Tyr Pro Ala Trp

1 5 10 15

Leu Thr Val Ser Glu Gly Ala Asn Ala Thr Phe Thr Cys Ser Leu Ser

20 25 30

Asn Trp Ser Glu Asp Leu Met Leu Asn Trp Asn Arg Leu Ser Pro Ser

35 40 45

Asn Gln Thr Glu Lys Gln Ala Ala Phe Cys Asn Gly Leu Ser Gln Pro

50 55 60

Val Gln Asp Ala Arg Phe Gln Ile Ile Gln Leu Pro Asn Arg His Asp

65 70 75 80

Phe His Met Asn Ile Leu Asp Thr Arg Arg Asn Asp Ser Gly Ile Tyr

85 90 95

Leu Cys Gly Ala Ile Ser Leu His Pro Lys Ala Lys Ile Glu Glu Ser

100 105 110

Pro Gly Ala Glu Leu Val Val Thr Glu Arg Ile Leu Glu Thr Ser Thr

115 120 125

Arg Tyr Pro Ser Pro Ser Pro Lys Pro Glu Gly Arg Phe Gln Gly Met

130 135 140

Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser Arg Pro Ala Pro

145 150 155 160

Thr Leu Pro Glu Gln Ala Gln Pro Trp Gly Val Pro Val Glu Val Glu

165 170 175

Ser Leu Leu Val His Pro Gly Asp Leu Leu Gln Leu Arg Cys Arg Leu

180 185 190

Arg Asp Asp Val Gln Ser Ile Asn Trp Leu Arg Asp Gly Val Gln Leu

195 200 205

Val Glu Ser Asn Arg Thr Arg Ile Thr Gly Glu Glu Val Glu Val Arg

210 215 220

Asp Ser Ile Pro Ala Asp Ser Gly Leu Tyr Ala Cys Val Thr Ser Ser

225 230 235 240

Pro Ser Gly Ser Asp Thr Thr Tyr Phe Ser Val Asn Val Ser Asp Ala

245 250 255

Leu Pro Ser Ser Glu Asp Asp Asp Asp Asp Asp Asp Ser Ser Ser Glu

260 265 270

Glu Lys Glu Thr Asp Asn Thr Lys Pro Asn Arg Arg Pro Val Ala Pro

275 280 285

Tyr Trp Thr Ser Pro Glu Lys Met Glu Lys Lys Leu His Ala Val Pro

290 295 300

Ala Ala Lys Thr Val Lys Phe Lys Cys Pro Ser Ser Gly Thr Pro Asn

305 310 315 320

Pro Thr Leu Arg Trp Leu Lys Asn Gly Lys Glu Phe Lys Pro Asp His

325 330 335

Arg Ile Gly Gly Tyr Lys Val Arg Tyr Ala Thr Trp Ser Ile Ile Met

340 345 350

Asp Ser Val Val Pro Ser Asp Lys Gly Asn Tyr Thr Cys Ile Val Glu

355 360 365

Asn Glu Tyr Gly Ser Ile Asn His Thr Tyr Gln Leu Asp Val Val Glu

370 375 380

Arg Ser Pro His Arg Pro Ile Leu Gln Ala Gly Leu Pro Ala Asn Lys

385 390 395 400

Thr Val Ala Leu Gly Ser Asn Val Glu Phe Met Cys Lys Val Tyr Ser

405 410 415

Asp Pro Gln Pro His Ile Gln Trp Leu Lys His Ile Glu Val Asn Gly

420 425 430

Ser Lys Ile Gly Pro Asp Asn Leu Pro Tyr Val Gln Ile Leu Lys Thr

435 440 445

Ala Gly Val Asn Thr Thr Asp Lys Glu Met Glu Val Leu His Leu Arg

450 455 460

Asn Val Ser Phe Glu Asp Ala Gly Glu Tyr Thr Cys Leu Ala Gly Asn

465 470 475 480

Ser Ile Gly Leu Ser His His Ser Ala Trp Leu Thr Val Leu Glu Ala

485 490 495

Leu Glu Glu Arg Pro Ala Val Met Thr Ser Pro Leu Tyr Leu Glu Asp

500 505 510

Pro Arg Gly Pro Thr Ile Lys Pro Cys Pro Pro Cys Lys Cys Pro Ala

515 520 525

Pro Asn Leu Leu Gly Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Ile

530 535 540

Lys Asp Val Leu Met Ile Ser Leu Ser Pro Ile Val Thr Cys Val Val

545 550 555 560

Val Asp Val Ser Glu Asp Asp Pro Asp Val Gln Ile Ser Trp Phe Val

565 570 575

Asn Asn Val Glu Val His Thr Ala Gln Thr Gln Thr His Arg Glu Asp

580 585 590

Tyr Asn Ser Thr Leu Arg Val Val Ser Ala Leu Pro Ile Gln His Gln

595 600 605

Asp Trp Met Ser Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Asp

610 615 620

Leu Pro Ala Pro Ile Glu Arg Thr Ile Ser Lys Pro Lys Gly Ser Val

625 630 635 640

Arg Ala Pro Gln Val Tyr Val Leu Pro Pro Pro Glu Glu Glu Met Thr

645 650 655

Lys Lys Gln Val Thr Leu Thr Cys Met Val Thr Asp Phe Met Pro Glu

660 665 670

Asp Ile Tyr Val Glu Trp Thr Asn Asn Gly Lys Thr Glu Leu Asn Tyr

675 680 685

Lys Asn Thr Glu Pro Val Leu Asp Ser Asp Gly Ser Tyr Phe Met Tyr

690 695 700

Ser Lys Leu Arg Val Glu Lys Lys Asn Trp Val Glu Arg Asn Ser Tyr

705 710 715 720

Ser Cys Ser Val Val His Glu Gly Leu His Asn His His Thr Thr Lys

725 730 735

Ser Phe Ser Arg Thr Pro Gly

740

Claims

1. An Fc fusion protein PD1/FGFR1 for resisting breast cancer specifically is characterized by being obtained by encoding genes of PD1, FGFR1 and mouse antibody segments;

the sequence of the PD1, FGFR1 and the Fc segment coding genes of the murine antibody is PD1-FGFR1-Fc in sequence from the 5 'end to the 3' end;

the nucleotide sequence of the encoded Fc fusion protein PD1/FGFR1 is shown in SEQ ID NO 1.

2. The Fc fusion protein PD1/FGFR1 of claim 1, wherein the amino acid sequence of the fusion protein is selected from the group consisting of the amino acid sequences shown in SEQ ID NO. 7.

3. A nucleic acid molecule encoding the Fc fusion protein PD1/FGFR1 of any of claims 1 to 2.

4. A recombinant expression vector comprising the nucleic acid molecule of claim 3.

5. An expression cell comprising the recombinant expression vector of claim 4.

6. Use of the Fc fusion protein PD1/FGFR1 of any one of claims 1 to 2, the nucleic acid molecule of claim 3, the recombinant expression vector of claim 4, or the expression cell of claim 5 in the preparation of a specific anti-breast cancer medicament.

7. A specific antitumor drug, which comprises the Fc fusion protein PD1/FGFR1 of any one of claims 1 to 2 and a pharmaceutically acceptable excipient.