CN108410954A - The compounding method of reaction buffer in a kind of room temperature amplification reaction system - Google Patents
The compounding method of reaction buffer in a kind of room temperature amplification reaction system Download PDFInfo
- Publication number
- CN108410954A CN108410954A CN201810747938.8A CN201810747938A CN108410954A CN 108410954 A CN108410954 A CN 108410954A CN 201810747938 A CN201810747938 A CN 201810747938A CN 108410954 A CN108410954 A CN 108410954A
- Authority
- CN
- China
- Prior art keywords
- concentration range
- room temperature
- reaction system
- atp
- temperature amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of compounding method of reaction buffer in room temperature amplification reaction system, including：Salt buffer, crowding agent, ATP, ATP catalytic reagent, dNTPs, reducing agent and high from saline solution.The salt buffer is MgCl2, KCl, NaCl, MgAc solution or two of which or several combinations, and concentration range is in 50 200mM, preferably 50 100mM.The crowding agent is polyethylene glycol, the balance for stablizing strand replacement reaction, is PEG20000 Carbowax 20M, concentration range 1% 20%, preferably 5% 9%.The concentration range of the ATP is in 1mM 10mM, preferably 1mM 5mM.The present invention has the advantages that：Above-mentioned reaction system reduces concentration range compared with existing isothermal amplification reactions system, keeps whole system more stable, and by the ratio optimization of recombinase and determination of activity, greatly increases the activity of enzyme in the reaction.
Description
Technical field
The invention belongs to molecular biological arts, the side of preparing about reaction buffer in a kind of room temperature amplification reaction system
Method.
Background technology
In the prior art, PCR is the most basic and universal technology of current biotechnology, work(
All biotechnologies can almost be can apply to.But the defects of its long operational time, temperature requirement is high, and step is more, for grinding
The efficiency studied carefully or examined has a great impact.
The recombinase polymeric enzymatic amplification technology developed in recent years solves defect all in PCR, should
Technology is to participate in the duplicating process of Imitating DNA in vivo in recombinase, the technology dependent on recombinase, single strand binding protein and
Polymerase carries out analoging reproduction.Recombinase can not by high temperature by double-stranded DNA untwisted and with single-stranded combination, then with single-stranded knot
Hop protein carries out strand replacement reaction, and polymerase can extend at 3 ' ends at this time, to form new complementary double-strand.The technical efficiency
It is higher, a large amount of DNA target fragments can be can be obtained in 40 to 60min under 37 DEG C -42 DEG C of temperature condition.
Recombinase polymeric enzymatic amplification technology only has Twist DX at presentTMThere are rounded system, the RPA of domestic maturation not yet
Kit.In addition, Twist DXTMBasic kit reaction time 3-10min after reach and can examine level, subsequent experimental is wanted
The fragment amount asked then needs that 20-40min experiment demand can be met.The reaction time is slightly longer, and participates in the reaction
Albumen causes the reaction to have certain uncertainty, the uncertainty is in patent without active specific requirement：Recombinase is poly-
Recombinase and albumen concentration when active level method in synthase amplification（The number of accepting：201711220953.9）In be resolved.
Invention content
The object of the present invention is to provide a kind of compounding methods of reaction buffer in room temperature amplification reaction system, solve existing
In room temperature amplification technique, in the case where the reaction time is short, output fragment amount small the problem of being difficult to reach experimental level, and contract
The range of small reaction system and component reaches more accurate experimental result.
The present invention solves technical problem and adopts the following technical scheme that：
The present invention will without high temperature by the homologous recombination performance of recombinase, single strand binding protein and polymerase
Double-stranded DNA is untwisted and carries out strand replacement reaction with single strand binding protein, and new complementary double-strand is consequently formed.By to recombination
The ratio optimization of enzyme and optimization to reaction system, reaching when shortening the system amplification of nucleic acid to reach can test level
Time.Wherein, the proportioning of recombinase is in patent：Recombinase and albumen concentration when active level side in recombinase polymeric enzymatic amplification
Method（The number of accepting：201711220953.9）In have a specific elaboration, the present invention focuses on to illustrate the optimization of reaction system.
The compounding method of reaction system, including：Reaction buffer, single strand binding protein, recombinase, archaeal dna polymerase.
The present invention provides a kind of compounding method of reaction buffer in room temperature amplification reaction system, the reaction buffer group
Divide and includes：Salt buffer, crowding agent, ATP, ATP catalytic reagent, dNTPs, reducing agent and high from saline solution.
Preferably, the salt buffer is MgCl2, KCl, NaCl, MgAc solution or two of which or several groups
It closes, concentration range is in 50-200mM, preferably 50-100mM.
Preferably, the crowding agent be polyethylene glycol, the balance for stablizing strand replacement reaction, be PEG20000 or
Carbowax 20M, concentration range is in 1%-20%, preferably 5%-9%.
The concentration range of the ATP is in 1mM-10mM, preferably 1mM-5mM.
The ATP catalytic reagents include：Phosphocreatine and creatine kinase, the content for stablizing ATP in reaction, phosphoric acid flesh
Acid concentration range is in 20mM-100mM, preferably 30mM-60mM；Phosphokinase concentration range is excellent in 50ng/ul-200ng/ul
It is selected as 70-150ng/ul.
The dNTPs concentration ranges are in 100uM-300uM, preferably 100uM-200uM.
The reducing agent is DTT（Dithiothreitol (DTT)）, for reducing the dimerization of DNA, concentration range 1mM-10mM is excellent
It is selected as 2mM-7mM.
It is described high from the combination that saline solution is Tris-HCl, Tris-Ac, guanidine hydrochloride or two kinds therein or more, concentration
Ranging from 30mM-200mM, preferably 40mM-85mM.
The single strand binding protein be ET-SSB, gp32, concentration range 100ng/ul-500ng/ul, preferably
150ng/ul-400ng/ul。
The recombinase is the combination of UvsX and UvsY, and the concentration range of UvsX is 100ng/ul-500ng/ul, preferably
100ng/ul-400ng/ul.UvsY concentration ranges are 1ng/ul-100ng/ul, preferably 10ng/ul-60ng/ul.The two
Portfolio ratio ranging from 1:1-6:1.
The archaeal dna polymerase is Bsu, concentration range 10ng/ul-100ng/ul, preferably 20ng/ul-50ng/ul.
The present invention has the advantages that：Above-mentioned reaction system reduces compared with existing isothermal amplification reactions system
Concentration range, keeps whole system more stable, and by the ratio optimization of recombinase and determination of activity, greatly increase
The activity of enzyme in the reaction.
Description of the drawings
Fig. 1 is Sry gene isothermal amplification electrophoretograms；
Fig. 2 is in conjunction with mycobacterium mtp40 constant-temperature amplification electrophoretograms；
Fig. 3 is GADPH reference gene constant-temperature amplification electrophoretograms；
Fig. 4 is Beta-Actin reference gene constant-temperature amplification electrophoretograms；
Fig. 5 is Beta-Actin reference gene constant-temperature amplification product qpcr fluorescence signal curve graphs.
Specific implementation mode
Following will be combined with the drawings in the embodiments of the present invention, and technical solution in the embodiment of the present invention carries out clear, complete
Site preparation describes, it is clear that described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.
Conventional method includes the following steps：
1) whether detection UvsX has strand displacement capability
The 100 μ g/ μ μ g/ μ l of l-200 UvsX are added in reaction buffer, 10-100 μ g/ μ l λ DNA profilings buffering is added
Solution, mixing, 37 DEG C are incubated progress running gel imaging test after ten minutes, and 1-9mM ATP are then added, and continue to be incubated 20 points
Zhong Houzai carries out running gel imaging test；
2) required UvsX and UvsY primary activities in RPA reactions are calculated
A. 100-200 μ g/ μ l μ g/ μ l UvsY of UvsX and 10-100 are added with gradient concentration respectively on two pieces of ELISA Plates,
0.5 μM -100 μM substrate A TP are added in each hole, is read in microplate reader after reacting 1h under room temperature and draws enzyme concentration curve；
B. it show that UvsX and UvsY generates the relation curve of ADP from two parts of enzyme concentration curve graphs, and obtains ratio between two；
3) ratio that two kinds of enzymes are made of RPA detects, and sees whether the ratio is feasible.
Above-mentioned to be made in the ratio detection of two kinds of enzymes of RPA, various concentration ratio uses the same reaction time in RPA reactions,
Detect its efficiency in system.
First, the present invention detects whether UvsX has strand displacement capability in RPA according to the following mechanism of action of UvsX.
In strand replacement reaction, UvsX untwists DNA profiling, and to be attached on single-stranded, by promoting ATP hydrolysis, UvsX is from single-stranded
On fall off so that single strand binding protein gp32 is attached on single-stranded.Using UvsX can with the property of single-stranded combination, it is single-stranded being not added with
In the case of connecing with albumen, whether fallen off from single-stranded using UvsX after the completion of the observation ATP hydrolysis of running gel imaging technique, from
And detect whether UvsX plays the role of to have in RPA reactions.
Wherein, λ DNA concentrations ranging from 10-100 μ g/ μ l, UvsX concentration ranges are the 100 μ g/ μ μ g/ μ of l-200 l, ATP
Concentration range is 1-9mM.
Then, two kinds of required primary activities of albumen calculate in being reacted for RPA.
UvsX recombinases can promote the hydrolysis of ATP, and UvsY is in the presence of UvsX, can be in original basis
More the hydrolysis of ATP is promoted when UvsX reaches a certain concentration to start that ATP is made to hydrolyze, ADP concentration is caused to rise.The ADP used
The ADP amounts that the detection of FI Assay kits generates, to obtain enzyme concentration curve.Based in RPA reactive components UvsX and
The concentration of UvsY and the effect of UvsX strand replacement reactions obtain the enzyme activity that required UvsX and UvsY is most basic in RPA reactions.
Wherein, substrate A TP concentration ranges used are 0.5 μM -100 μM when detecting ADP, UvsX recombinant protein enzyme concentrations
Ranging from 100-200 μ g/ μ l, UvsY protease concentrations are 10-100 μ g/ μ l.
The reaction buffer used in the method for the present invention includes 20mM Tris-Ac, 100mM KAc, 10mM MgAc and 1mM
DTT。
In the method for the present invention, the preparation method of λ DNA profiling buffer solutions is：By the 1000bp λ DNA of 100 μ g/ μ l of concentration
10 μ l reaction buffers are added, in metal heater 95 DEG C be incubated be placed within 3 minutes it is spare in ice bath.
In the method for the present invention, in RPA the use concentration of UvsX in the use concentration of 100-200 μ g/ μ l, UvsY in 10-100
μ g/ μ l choose the concentration in the section, and concentration gradient is arranged：10 μ g/ μ l are a gradient, the ADP FI Assay examinations used
Agent box makes UvsX and substrate A TP reaction hydrolysis generate ADP, the production quantity of ADP is then detected with microplate reader, is obtained using ELISA Plate
To enzyme concentration curve.It uses the mixture of UvsX and ATP as substrate again, UvsY hydrolysis is added and generates ADP, detects its production quantity,
Obtain the enzyme concentration curve of UvsY.The usage amount of enzyme is recorded, then is tested with RPA, sees whether target fragment expands, is come
Determine the optimal proportion of enzyme activity range and two enzymes.
Embodiment 1
1, reaction system
2, template：Normal human subject genomic DNA, target fragment：Sex determining gene Sry
Sequence（110bp）
GGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACAATGCAAT
CATATGCTTCTGCTATGTTAAGCGTAT TCAACAGCGA
3, it by reactant mixing, is put into 37 DEG C of metal heater and is incubated 15 minutes, running gel imaging experiment observes band（Figure
1）, it was demonstrated that the reaction system experimental program is feasible.
4, nucleotide and amino acid sequence are shown in sequence table<210>1-<400>1：
Embodiment 2
In conjunction with mycobacterium mtp40；
1, reaction system
2, template：Mycobacterium tuberculosis standard DNA, target fragment：In conjunction with mycobacterium mtp40
Sequence（338bp）
AACACCACGTTCGGGATGCACTGCGGCAGCTTCGGCAGCGCTCCCAGCAACGGGTGGCTCAAGTTGGGTCTGG
TCGAATTCGGTGGAGTCGCAAAGTTGAACGCTGAGGTCATGTCGCCAACCACGCCGTCGCGCCAGGCGGTCATGTTG
GGAACCGGCACGCCGAACCGGGCGCGAATCAACTTCAATTGCGAGGTGTGGTCGAACGTGTCGGAGACCATCAGCGG
GCCGCGGCTGTACGGCGAAATGACAATGCAGGGAACGCGAAAACCCAGACCGAGCGGACCACGAATGCCACCGGACC
CGGGTACTGCGTCGATGTTGGGCACCGTGACGAA
3, it by reactant mixing, is put into 37 DEG C of metal heater and is incubated 40 minutes, running gel imaging experiment observes band（Figure
2）, it was demonstrated that the reaction system experimental program is feasible.
4, nucleotide and amino acid sequence are shown in sequence table<210>2-<400>2.
Embodiment 3
House-keeping gene GADPH；
1, reaction system
2, template：Normal human subject genomic DNA, target fragment：GADPH reference gene sequences（381bp）
CTGCCGCCGCGCCCCCGGTTTCTATAAATTGAGCCCGCAGCCTCCCGCTTCGCTCTCTGCTCCTCCTGTTCGA
CAGTCAGCCGCATCTTCTTTTGCGTCGCCAGGTGAAGACGGGCGGAGAGAAACCCGGGAGGCTAGGGACGGCCTGAA
GGCGGCAGGGGCGGGCGCAGGCCGGATGTGTTCGCGCCGCTGCGGGGTGGGCCCGGGCGGCCTCCGCATTGCAGGGG
CGGGCGGAGGACGTGATGCGGCGCGGGCTGGGCATGGAGGCCTGGTGGGGGAGGGGAGGGGAGGCGTGTGTGTCGGC
CGGGGCCACTAGGCGCTCACTGTTCTCTCCCTCCGCGCAGCCGAGCCACATCGCTCAGACACCATGGGGAAGGTGAA
3, it by reactant mixing, is put into 37 DEG C of metal heater and is incubated 20 minutes, running gel imaging experiment observes band（Figure
3）, it was demonstrated that the reaction system experimental program is feasible.
4, nucleotide and amino acid sequence are shown in sequence table<210>3-<400>3.
Embodiment 4
Beta-Actin reference genes are analyzed in conjunction with Fig. 4 and Fig. 5；
1, reaction system
2, template：Normal human subject genomic DNA, target fragment：Beta-Actin reference gene sequences（171bp）
CATGGCTTTATTTGTTTTTTTTGTTTTGTTTTGGTTTTTTTTTTTTTTTTGGCTTGACTCAGGATTTAAAAAC
TGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTTCACAATGTGGCCGAGGACTTTGATTG
CACATTGTTGTTTTTTTAATA
3, it by reactant mixing, is put into 37 DEG C of metal heater and is incubated 15 minutes, running gel imaging experiment observes band（Figure
4）Although band is fainter, prove that the reaction system experimental program is feasible.
4, the product after amplification is subjected to quantitative fluorescence analysis, can be obtained according to qpcr results, divided carrying out constant-temperature amplification 10
Zhong Hou, product can reach can test level.
5, nucleotide and amino acid sequence are shown in sequence table<210>4-<400>4.
The sequencing of above example is only for ease of description, can not represent the quality of embodiment.
Finally it should be noted that：The above embodiments are merely illustrative of the technical solutions of the present invention, rather than its limitations；Although
Present invention has been described in detail with reference to the aforementioned embodiments, it will be understood by those of ordinary skill in the art that：It still may be used
With technical scheme described in the above embodiments is modified or equivalent replacement of some of the technical features；
And these modifications or replacements, various embodiments of the present invention technical solution that it does not separate the essence of the corresponding technical solution spirit and
Range.
Sequence table
<110>Silent standing grain medical science and technology（Shanghai）Co., Ltd
<120>The compounding method of reaction buffer in a kind of room temperature amplification reaction system
<130> 20180527
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 110
<212> DNA
<213> Homo sapiens
<400> 1
ggatagtaaa ataagtttcg aactctggca cctttcaatt ttgtcgcact ctccttgttt 60
ttgacaatgc aatcatatgc ttctgctatg ttaagcgtat tcaacagcga 110
<210> 2
<211> 338
<212> DNA
<213> Mycobacterium tuberculosis
<400> 2
aacaccacgt tcgggatgca ctgcggcagc ttcggcagcg ctcccagcaa cgggtggctc 60
aagttgggtc tggtcgaatt cggtggagtc gcaaagttga acgctgaggt catgtcgcca 120
accacgccgt cgcgccaggc ggtcatgttg ggaaccggca cgccgaaccg ggcgcgaatc 180
aacttcaatt gcgaggtgtg gtcgaacgtg tcggagacca tcagcgggcc gcggctgtac 240
ggcgaaatga caatgcaggg aacgcgaaaa cccagaccga gcggaccacg aatgccaccg 300
gacccgggta ctgcgtcgat gttgggcacc gtgacgaa 338
<210> 3
<211> 381
<212> DNA
<213> Homo sapiens
<400> 3
ctgccgccgc gcccccggtt tctataaatt gagcccgcag cctcccgctt cgctctctgc 60
tcctcctgtt cgacagtcag ccgcatcttc ttttgcgtcg ccaggtgaag acgggcggag 120
agaaacccgg gaggctaggg acggcctgaa ggcggcaggg gcgggcgcag gccggatgtg 180
ttcgcgccgc tgcggggtgg gcccgggcgg cctccgcatt gcaggggcgg gcggaggacg 240
tgatgcggcg cgggctgggc atggaggcct ggtgggggag gggaggggag gcgtgtgtgt 300
cggccggggc cactaggcgc tcactgttct ctccctccgc gcagccgagc cacatcgctc 360
agacaccatg gggaaggtga a 381
<210> 4
<211> 171
<212> DNA
<213> Homo sapiens
<400> 4
catggcttta tttgtttttt ttgttttgtt ttggtttttt tttttttttt ggcttgactc 60
aggatttaaa aactggaacg gtgaaggtga cagcagtcgg ttggagcgag catcccccaa 120
agttcacaat gtggccgagg actttgattg cacattgttg tttttttaat a 171
Claims (6)
1. the compounding method of reaction buffer in a kind of room temperature amplification reaction system, which is characterized in that including：Salt buffer is gathered around
Squeeze reagent, ATP, ATP catalytic reagent, dNTPs, reducing agent and high from saline solution；
The salt buffer is that MgCl2, KCl, NaCl, MgAc solution or two of which or several combinations, concentration range exist
50-200mM, preferably 50-100mM；
The crowding agent be polyethylene glycol, be PEG20000 Carbowax 20M, concentration range 1%-20%, preferably
5%-9%；
The concentration range of the ATP is in 1mM-10mM, preferably 1mM-5mM；
The ATP catalytic reagents include：Phosphocreatine and creatine kinase, phosphocreatine concentration range is in 20mM-100mM, preferably
For 30mM-60mM；Phosphokinase concentration range is in 50ng/ul-200ng/ul, preferably 70-150ng/ul；
The dNTPs concentration ranges are in 100uM-300uM, preferably 100uM-200uM.
2. the compounding method of reaction buffer, feature exist in a kind of room temperature amplification reaction system according to claim 1
In the reducing agent is DTT（Dithiothreitol (DTT)）, for reducing the dimerization of DNA, concentration range 1mM-10mM, preferably
2mM-6mM。
3. the compounding method of reaction buffer, feature exist in a kind of room temperature amplification reaction system according to claim 1
In described high from the combination that saline solution is Tris-HCl, Tris-Ac, guanidine hydrochloride or two kinds therein or more, concentration range
For 30mM-200mM, preferably 40mM-85mM.
4. the compounding method of reaction buffer, feature exist in a kind of room temperature amplification reaction system according to claim 1
In the single strand binding protein is ET-SSB, gp32, concentration range 100ng/ul-500ng/ul, preferably 150ng/ul-
400ng/ul。
5. the compounding method of reaction buffer, feature exist in a kind of room temperature amplification reaction system according to claim 1
In the recombinase is the combination of UvsX and UvsY, and the concentration range of UvsX is 100ng/ul-500ng/ul, preferably
100ng/ul-400ng/ul, UvsY concentration range be 1ng/ul-100ng/ul, preferably 10ng/ul-60ng/ul, the two
Portfolio ratio ranging from 1:1-6:1.
6. the compounding method of reaction buffer, feature exist in a kind of room temperature amplification reaction system according to claim 1
In the archaeal dna polymerase is Bsu, concentration range 10ng/ul-100ng/ul, preferably 20ng/ul-50ng/ul.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810747938.8A CN108410954A (en) | 2018-07-10 | 2018-07-10 | The compounding method of reaction buffer in a kind of room temperature amplification reaction system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810747938.8A CN108410954A (en) | 2018-07-10 | 2018-07-10 | The compounding method of reaction buffer in a kind of room temperature amplification reaction system |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108410954A true CN108410954A (en) | 2018-08-17 |
Family
ID=63141790
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810747938.8A Pending CN108410954A (en) | 2018-07-10 | 2018-07-10 | The compounding method of reaction buffer in a kind of room temperature amplification reaction system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108410954A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113454237A (en) * | 2018-12-20 | 2021-09-28 | 阿尔韦奥科技公司 | Isothermal amplification with electrical detection |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010141940A1 (en) * | 2009-06-05 | 2010-12-09 | Alere San Diego, Inc. | Recombinase polymerase amplification reagents and kits |
| EP2290096A2 (en) * | 2002-02-21 | 2011-03-02 | ASM Scientific, Inc. | Recombinase polymerase amplification |
| CN107893103A (en) * | 2017-11-29 | 2018-04-10 | 默禾医疗科技（上海）有限公司 | Recombinase and protein concentration when active level method in recombinase polymeric enzymatic amplification |
| CN108179177A (en) * | 2017-12-29 | 2018-06-19 | 博迪泰（厦门）生物科技有限公司 | A kind of kit and detection method of quick detection nucleic acid mutation |
-
2018
- 2018-07-10 CN CN201810747938.8A patent/CN108410954A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2290096A2 (en) * | 2002-02-21 | 2011-03-02 | ASM Scientific, Inc. | Recombinase polymerase amplification |
| WO2010141940A1 (en) * | 2009-06-05 | 2010-12-09 | Alere San Diego, Inc. | Recombinase polymerase amplification reagents and kits |
| CN107893103A (en) * | 2017-11-29 | 2018-04-10 | 默禾医疗科技（上海）有限公司 | Recombinase and protein concentration when active level method in recombinase polymeric enzymatic amplification |
| CN108179177A (en) * | 2017-12-29 | 2018-06-19 | 博迪泰（厦门）生物科技有限公司 | A kind of kit and detection method of quick detection nucleic acid mutation |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113454237A (en) * | 2018-12-20 | 2021-09-28 | 阿尔韦奥科技公司 | Isothermal amplification with electrical detection |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200354773A1 (en) | High multiplex pcr with molecular barcoding | |
| CN110520542B (en) | Method for targeted nucleic acid sequence enrichment and use in error-correcting nucleic acid sequencing | |
| DK3192877T3 (en) | VESICULAR ADAPTERS AND APPLICATIONS THEREOF IN NUCLEIC ACID LIBRARY CONSTRUCTION AND SEQUENCE | |
| US20180142290A1 (en) | Blocking oligonucleotides | |
| US8524448B2 (en) | Method and substances for isolating miRNAs | |
| JP2020521486A (en) | Single cell transcriptome amplification method | |
| JP2022516446A (en) | Methods and kits for preparing complementary DNA | |
| WO2016135300A1 (en) | Efficiency improving methods for gene library generation | |
| CN116497093B (en) | Efficient constant-temperature amplification method | |
| US20210024920A1 (en) | Integrative DNA and RNA Library Preparations and Uses Thereof | |
| CN110446788A (en) | For the standardized novel internal reference oligonucleotides of sequence data | |
| CN112322700B (en) | Construction method, kit and application of short RNA fragment library | |
| JP2021512597A (en) | Preparation of single-stranded circular DNA templates for single molecules | |
| CN113862263B (en) | Sequencing library construction method and application | |
| CN108410954A (en) | The compounding method of reaction buffer in a kind of room temperature amplification reaction system | |
| US20200270684A1 (en) | Method for body fluid identification | |
| US20130171630A1 (en) | Methods of using telomeres as markers for aging | |
| US20200362333A1 (en) | Molecular Sensor Selection | |
| CN113728114A (en) | Digital polymerase chain reaction method for detecting nucleic acid in sample | |
| KR102118180B1 (en) | Method for Detection of Somatic Mutation Using Next Generation Sequencing | |
| JP7090793B2 (en) | Formamide-free target enrichment composition for next-generation sequencing applications | |
| US20220127600A1 (en) | Methods of Detecting Analytes and Compositions Thereof | |
| WO2013090613A1 (en) | Compositions and methods for functional quality control for human blood-based gene expression products | |
| López et al. | AU Content in the MicroRNA sequence influences its stability after heat treatment | |
| JP2016195564A (en) | Method for detecting nitrobacter bacteria and kit therefor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180817 |
|
| RJ01 | Rejection of invention patent application after publication |