CN108410895A - A method of it improving recombinant dna fragment and converts Escherichia coli efficiency - Google Patents
A method of it improving recombinant dna fragment and converts Escherichia coli efficiency Download PDFInfo
- Publication number
- CN108410895A CN108410895A CN201810065431.4A CN201810065431A CN108410895A CN 108410895 A CN108410895 A CN 108410895A CN 201810065431 A CN201810065431 A CN 201810065431A CN 108410895 A CN108410895 A CN 108410895A
- Authority
- CN
- China
- Prior art keywords
- dna
- escherichia coli
- connection
- added
- recombinant dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention belongs to gene engineering technology fields, disclose a kind of method of raising DNA recombinant fragments conversion Escherichia coli efficiency, the EGFP segments that PCR amplification obtains are subjected to double digestion respectively with pUC18 plasmids, with T4DNA ligases to after digestion EGFP segments and pUC18 plasmids be attached, obtain connection product；The 10M ammonium acetates of 1/5DNA connection product volumes are first added in DNA connection products；Then the absolute ethyl alcohol of said mixture two volumes is added, is stored at room temperature 25min 1hr, 10000g centrifuges 25min 1hr；Supernatant is abandoned, 5 10 μ L 0.1M CaCl are added2, dissolve the precipitation of tube bottom.The Escherichia coli clones number that the present invention converts is approximately 2 10 times of untreated fish group；The present invention reduces the usage amounts of competent E.coli when conversion.
Description
Technical field
The invention belongs to gene engineering technology field more particularly to a kind of raising recombinant dna fragment conversion Escherichia coli effects
The method of rate.
Background technology
Currently, the prior art commonly used in the trade is such：DNA recombinant vector structure is the conventional hand of modern biology research
One of section.In DNA recombinant vector structure, the DNA connection products after target DNA fragment is connect with carrier need to convert entrance
Escherichia coli and screen obtain the monoclonal containing recombinant DNA.CaCl2Method be DNA conversion enter Escherichia coli common method it
One, but the efficiency of DNA connection products conversion Escherichia coli is often relatively low.In DNA connection products, in addition to nucleic acid, also contains DNA and connect
Enzyme and other non-recombinant carrier components (including Tris, MgCl2, ATP, DTT etc.) are connect, when DNA connection products and competence are big
When enterobacteria mixes, DNA ligase and other ion components, such as Tris, Mg2+Deng, it may be possible to it is thin to influence E. coli competent
An important factor for cytoactive.If before DNA connection products are converted Escherichia coli, DNA connection products are carried out appropriate
Processing can remove or reduce DNA ligases and other non-recombinant carrier components such as ethanol precipitation DNA, be then advantageously possible for
Recombinant DNA conversion enters Escherichia coli, and then improves the efficiency of DNA connection products conversion Escherichia coli.
Traditional DNA ethanol precipitations are usually used in the experiments such as plasmid extraction, but some steps in its method, such as 70% wash
Precipitation is washed, TE buffer solutions (pH8.0) dissolving precipitation etc. is not too much suitble to carry out precipitation process to DNA connection products.Generally for
Minim DNA sample, traditional ethyl alcohol DNA precipitation method be easy to cause the loss of DNA samples.
In conclusion problem of the existing technology is：The efficiency of existing DNA connection products conversion Escherichia coli is low,
And traditional DNA ethanol precipitations cannot effectively purify DNA connection products.
Invention content
In view of the problems of the existing technology, the present invention provides a kind of raising DNA by improving DNA ethanol precipitations
The method that recombinant fragment converts Escherichia coli efficiency.
The invention is realized in this way a method of it improving recombinant dna fragment and converts Escherichia coli efficiency, the raising
The method of recombinant dna fragment conversion Escherichia coli efficiency be the EGFP segments that obtain PCR amplification with pUC18 plasmids respectively into
Row double digestion, with T4DNA ligases to after digestion EGFP segments and pUC18 plasmids be attached, obtain DNA connection products；
2 μ L 10M ammonium acetates are added in 10 μ L connection products；Then 24 μ L absolute ethyl alcohols are added, are stored at room temperature 25min, 10000g from
Heart 25min；Supernatant is abandoned, 10 μ L 0.1M CaCl are added2, the precipitation of tube bottom is dissolved, by the precipitation process to DNA, can be gone
Except remaining DNA ligase and other non-recombinant carrier components, the interference that they convert recombinant DNA Escherichia coli is reduced, from
And be conducive to improve the efficiency of DNA connection products conversion Escherichia coli.
Further, the EGFP segments molal quantity：PUC18 plasmid molal quantitys ≈ 8:1.To ensure pUC18 as much as possible
Plasmid can be connected to become recombinant vector with EGFP segments.
Further, it is needed before the connection：With PCR method, the EGFP segments on pEGFP-C3 carriers are amplified；With
I two kinds of restriction endonucleases of Hind III and EcoR, double digestion is carried out to EGFP segments and pUC18 plasmids respectively, obtains carrying identical viscosity
The EGFP segments and pUC18 plasmids of end.
Further, the connection connection product obtained by the reaction needs：With ammonium acetate and ethanol precipitation DNA, 5- is then used
10μL 0.1M CaCl2The DNA connection products of dissolving, and mixed with 10-100 μ L competent escherichia coli cells；It places on ice
30min, 42 DEG C of water-bath heat shock 45-90sec, places 2min on ice；0.4mL fluid nutrient mediums are taken to be added in said mixture, 37
DEG C, 250rpm shaken cultivations 1hr；Bacterium is uniformly coated on containing 0.125mg/mL IPTG, 0.1mg/mL X-gal, 0.1mg/
On the LB solid mediums of mL Ampicillin；37 DEG C of culture 12-16hr.
Improved DNA ethanol precipitations of the present invention are more easy compared with conventional method, and DNA companies can be improved in improved method
It practices midwifery the transformation efficiency of object, the DNA connection products handled through this method, the monoclonal number that conversion Escherichia coli obtain is approximately not
10 times of processing group；Present invention also reduces the dosages of competent E.coli when conversion.For converting 10 μ L connection products, quotient
The E. coli competent suggestion of product is 50 μ L (Quan Shi King Companies, article No.s using volume：) or 100 μ L (Suo Laibao CD201
Company, article No.：C1100), i.e., the dosage of 10 times DNA connection products, and the method for the invention treated DNA connection products,
10 μ L competent E.colis need to be only used, a large amount of recombinant DNA monoclonals can be obtained.The competence large intestine that comparison company is sold
Bacillus dosage, for the present invention by conversion process, the dosage of E. coli competent reduces 5-10 times.
Description of the drawings
Fig. 1 is the method flow diagram of raising recombinant dna fragment conversion Escherichia coli efficiency provided in an embodiment of the present invention.
Fig. 2 is after the DNA precipitation method (the method for the invention) provided in an embodiment of the present invention handle connection product, and conversion is big
The schematic diagram of enterobacteria.
Fig. 3 is the DNA precipitation method (the method for the invention) provided in an embodiment of the present invention treated connection product, conversion
The obtained monoclonal quantity of Escherichia coli is significantly more than the schematic diagram of untreated fish group.
Fig. 4 is conversion Escherichia coli after the DNA connection products provided in an embodiment of the present invention for washing precipitation with 70% ethyl alcohol
Schematic diagram.
Fig. 5 is the DNA connection products of 70% ethyl alcohol washing precipitation provided in an embodiment of the present invention, conversion Escherichia coli gained
Schematic diagram of the monoclonal quantity arrived considerably less than the method for the invention.
Fig. 6 is conversion large intestine bar after use TE (pH8.0) buffer solution DNA connection products provided in an embodiment of the present invention
The schematic diagram of bacterium.
Fig. 7 is the DNA connection products provided in an embodiment of the present invention with TE (pH8.0) buffer solution, converts large intestine bar
Schematic diagram of the obtained monoclonal quantity of bacterium considerably less than the method for the invention.
Fig. 8 is conversion large intestine bar after the precipitation DNA connection products provided in an embodiment of the present invention with 3M sodium acetates (pH5.2)
The schematic diagram of bacterium.
Fig. 9 is 3M sodium acetates (pH5.2) precipitation DNA connection products provided in an embodiment of the present invention, converts Escherichia coli
Obtained monoclonal quantity is considerably less than processing group (10M ammonium acetates precipitate DNA connection products, i.e. the method for the invention)
Schematic diagram.
Figure 10 is that DNA adsorption column methods provided in an embodiment of the present invention are purified after DNA connection products, converts Escherichia coli
Schematic diagram.
Figure 11 is that DNA adsorption column methods provided in an embodiment of the present invention purify DNA connection products, obtained by conversion Escherichia coli
Schematic diagram of the monoclonal quantity arrived considerably less than the method for the invention.
Specific implementation mode
In order to make the purpose , technical scheme and advantage of the present invention be clearer, with reference to embodiments, to the present invention
It is further elaborated.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, it is not used to
Limit the present invention.
The application principle of the present invention is explained in detail below in conjunction with the accompanying drawings.
As shown in Figure 1, the method provided in an embodiment of the present invention for improving recombinant dna fragment conversion Escherichia coli efficiency includes
Following steps：
S101：With PCR method, the EGFP segments on pEGFP-C3 carriers are amplified；
S102：With I two kinds of restriction endonucleases of Hind III and EcoR, double digestion pUC18 plasmids and EGFP segments, obtain band respectively
There are the pUC18 plasmids and EGFP segments of identical cohesive end；
S103：The obtained EGFP segments of double digestion are mixed with the pUC18 plasmids that double digestion obtains, are connected with T4DNA
Enzyme is attached (EGFP segment molal quantitys：PUC18 plasmid molal quantitys ≈ 8:1) connection product, is obtained；DNA connection products are added
The 10M ammonium acetates of 1/5 volume DNA connection products；Then the absolute ethyl alcohol of 2 times of volumes of mixture is added, is stored at room temperature 25min-
1hr, 10000g centrifuge 25min-1hr；Supernatant is abandoned, 10 μ L 0.1M CaCl are added2, dissolve the precipitation of tube bottom.
S104：The DNA connection products and 10 μ L competent escherichia coli cells that 10 μ L are handled through reagents such as ammonium acetates
(CaCl2It is prepared by method) mixing；30min is placed on ice, and 42 DEG C of water-bath heat shock 45sec place 2min on ice；0.4mL liquid is taken to train
It supports base to be added in said mixture, 37 DEG C, 250rpm shaken cultivations 1hr.By bacterium be coated on containing 0.125mg/mL IPTG,
0.1mg/mL X-gal, 0.1mg/mLAmpicillin LB solid mediums on.37 DEG C are inverted tablet culture 12-16hr.
The application effect of the present invention is explained in detail with reference to experiment.
1. experimental method
1.1 untreated fish group experimental methods (conventional method)
(1) DNA Insert Fragments are obtained.
With PCR method, the EGFP segments on pEGFP-C3 carriers are amplified, the primer sequence used is as follows：
SEQ ID NO：1 sense primer：5’-CAGAAGCTTGCATGGTGAGCAAGGGCG-3’ (HindⅢ)
SEQ ID NO：2 downstream primers：5’-GGAATTCTCACTTGTACAGCTCGTCCATGC-3’ (EcoRⅠ)
SEQ ID NO：The sequence dna fragment that 3 amplifications obtain is as follows：
5’-CAGAAGCTTGCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGG
TGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTC
AGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCT
GAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCG
TGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCAC
ATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCA
GGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCG
AGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGG
CATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACA
ACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGC
ATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCA
GCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGC
TGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGAC
CCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGC
CGGGATCACTCTCGGCATGGACGAGCTGTACAAGTGAGAATTCC-3’
(2) the EGFP segments that pUC18 plasmids and amplification obtain carry out double digestion respectively.
With Hind III (Quan Shi King Companies, article No.：) and EcoR I (Quan Shi King Companies, article No. JH101：JE201) in two kinds
Enzyme cutting, double digestion pUC18 plasmid (Suo Laibao companies, article No.：P3518), the pUC18 plasmids with cohesive end are obtained.
1 double digestion pUC18 plasmid reaction systems of table
37 DEG C of digestion 30min
The EGFP segment reaction systems that 2 double digestion PCR amplification of table obtains
37 DEG C of digestion 30min
(3) it connects.
The pUC18 plasmids of double digestion and EGFP segments carry out electrophoresis, and gel extraction with 1% Ago-Gel, will return
The EGFP segments and pUC18 plasmids with identical cohesive terminus,cohesive termini received, with T4DNA ligases (Quan Shi King Companies, article No.：
FL101 (EGFP segment molal quantitys) are attached：PUC18 plasmid molal quantitys ≈ 8:1, the pUC18 plasmid quality after digestion is about
24ng), connection product is obtained.
3 DNA coupled reaction systems of table
25 DEG C of connection 1h
(4) conversion and coated plate.
10 μ L connection products and 10 μ L or 100 μ L competent escherichia coli cells (CaCl2Prepared by method, Escherichia coli are thin
Born of the same parents are purchased from Quan Shi King Companies, article No.：CD201 it) mixes；30min is placed on ice.42 DEG C of water-bath heat shock 45sec, are placed on ice
2min；0.4mL fluid nutrient mediums are taken to be added in said mixture, 37 DEG C, 250rpm shaken cultivations 1hr.Be coated on containing
0.125mg/mL IPTG, 0.1mg/mL X-gal, 0.1 mg/mLAmpicillin LB solid mediums on, 37 DEG C culture
12hr。
1.2 processing group experimental methods (the method for the invention)
The same operation for carrying out " 1.1 (1), (2), (3) ".Then, the 10 μ L connection products obtained by " 1.1 (3) " step
Do following processing：
A.10 2 μ L 10M ammonium acetates are added in μ L connection products.
B. 24 μ L absolute ethyl alcohols are added to above-mentioned mixed liquor, are stored at room temperature 25min, 10000g centrifuges 25min.
C. supernatant is abandoned, 10 μ L 0.1M CaCl are added2, dissolve the precipitation of tube bottom.
Connection product solution after 10 μ L processing obtained by the above method (is grasped for conversion and coated plate with " 1.1 (4) "
Make identical).
1.3 70% ethyl alcohol washing group experimental methods
In " 1.2 processing group experimental method " described experimental procedure, " 24 μ L absolute ethyl alcohols are added to above-mentioned mixed liquor, room temperature in b.
25min is stood, after 10000g centrifuges 25min ", washs DNA precipitations once with 70% ethyl alcohol, 10000g centrifuges 25min, then
Supernatant is abandoned, 10 μ L 0.1M CaCl are added2, dissolve the precipitation of tube bottom.
1.4 TE (pH8.0) buffer solution DNA connection product group experimental methods
Substantially with " 1.2 processing group experimental method ", but by " c. abandons supernatant, and 10 μ L 0.1M CaCl are added2, dissolve tube bottom
Precipitation." " 10 μ L TE buffer solutions (pH8.0) are added in c. to use, dissolve the precipitation of tube bottom." step replacement.
The agent precipitates DNA connection product experimental methods such as 1.5 sodium acetates
Substantially with " 1.2 processing group experimental method ", but will " a.10 2 μ L 10M ammonium acetates of μ L connection products addition." use
" a.10 2 μ L 3M sodium acetates (pH5.2) are added in μ L connection products " step replaces.
2. experimental result
The DNA connection products of the reagents such as 2.1 ammonium acetates processing can effectively improve Escherichia coli transformation efficiency
The DNA connection products and untreated DNA connection products of the reagents processing such as conversion ammonium acetate enter large intestine bar respectively
Bacterium (competent E.coli dosage is 10 μ L or 100 μ L), counts the monoclonal number grown in LB solid medium tablets.
It was found that DNA connection products convert the obtained monoclonal quantity of Escherichia coli after the method for the invention handles (processing group)
Significantly more than untreated fish group (Fig. 2).Independent samples t test analysis is carried out to data, is existed between untreated fish group and processing group aobvious
Write sex differernce (Fig. 3).
DNA connection products convert Escherichia coli (processing group) after the method for the invention is handled, on LB solid plates
The monoclonal number grown is significantly more than untreated fish group.Further statistical analysis DNA connection products conversion Escherichia coli impression
The otherness of monoclonal number is obtained after state, either converts 10 μ L competent E.colis or 100 μ L competence large intestine bars
Bacterium, processing group connection product are converted to exist between the obtained monoclonal number of Escherichia coli and the monoclonal number of untreated fish group and be shown
Write sex differernce (statistical method：Independent sample t is examined, and * * indicate that P≤0.01, * indicate P≤0.05).At the method for the invention
DNA connection products after reason are converted with 10 μ L competent E.colis, can obtain more monoclonal；If not making
DNA connection products are handled with the method for the invention, it is necessary to convert DNA connection product ability with 100 μ L competent E.colis
Obtain more monoclonal.Illustrate, through the invention the DNA connection products after the method processing, it can be largely
The dosage of competent E.coli when reducing conversion.
2.2 wash the DNA connection products of precipitation with 70% ethyl alcohol, can influence the transformation efficiency of DNA connection products
In a large amount of extraction process of plasmid (prior art), in order to ensure the purity (matter of high-purity of extracted Plasmid DNA
Grain DNA is conducive to the experiments such as digestion, connection), it is desirable that the Plasmid DNA obtained to precipitation using 70% ethyl alcohol is washed.The present invention
With the agent precipitates DNA such as ammonium acetate connection products (unused 70% ethyl alcohol washs precipitation), recombinant DNA connection can be improved well
Product converts Escherichia coli efficiency, and the recombinant DNA connection product of 70% ethyl alcohol washing precipitation is added, and can influence DNA companies instead
It practices midwifery the transformation efficiency (Fig. 4) of object.Statistical analysis shows the list that the reagents processing group such as ammonium acetate conversion Escherichia coli obtain
Colony counts are significantly higher than the monoclonal number (statistical method of 70% ethyl alcohol washing group：Independent samples t test, * * expressions P≤
0.01, N.S. indicates no difference of science of statistics) (Fig. 5).Therefore, unused 70% ethyl alcohol washing is heavy in experimental method flow of the present invention
It forms sediment.
2.3TE (pH8.0) buffer solution connection product precipitates, and can influence connection product transformation efficiency
TE (pH8.0) buffer solution is commonly used to dissolving DNA, in a large amount of extraction process of plasmid (prior art), it is desirable that uses
The solution dissolving DNA, to reach the optimum condition for preserving DNA.Experiment ammonium acetate and absolute ethyl alcohol precipitate DNA connection products
Afterwards, it compares and uses TE (pH8.0) buffer solutions and 0.1M CaCl respectively2The effect (Fig. 6) of Escherichia coli is converted after dissolving precipitation,
It was found that with 0.1M CaCl2The DNA connection products of dissolving, obtained monoclonal number is significantly higher than TE after converting Escherichia coli
(pH8.0) buffer solution group (statistical method：Independent samples t test, * indicate P≤0.05) (Fig. 7).Therefore, experimental method of the present invention
Select 0.1M CaCl2 dissolving DNA connection products.
2.4 sodium acetates substitute ammonium acetate and precipitate DNA connection products, and the efficiency for converting Escherichia coli declines
10M ammonium acetates and 3M sodium acetates (pH5.2) are used equally for precipitation DNA, but with they precipitate DNA connection products and
Effect for transformed competence colibacillus Escherichia coli is unclear.Therefore, experiment compares uses 10M ammonium acetates (institute of the present invention respectively
State method content) and 3M sodium acetates (pH5.2) precipitation DNA connection product transformed competence colibacillus Escherichia coli effect (Fig. 8),
It was found that the DNA connection products conversion large intestine efficiency precipitated with 10M ammonium acetates (the method for the present invention) is significantly higher than 3M sodium acetates
(pH5.2) precipitation group (statistical method：Independent samples t test, * * indicate that P≤0.01, * indicate P≤0.05) (Fig. 9).Therefore,
Experimental method selection 10M ammonium acetates of the present invention handle DNA connection products.
2.5 are better than pure with DNA with the method for the invention treated DNA connection products, conversion Escherichia coli efficiency
Change the purified DNA connection products of column
In molecular cloning protocols, the DNA precipitation method or DNA adsorption columns method can purify DNA.Then, ratio is tested
Compared with the efficiency of the DNA connection product transformed competence colibacillus Escherichia coli of both methods processing.The DNA precipitation method are using the present invention
The method, DNA adsorption column rules use DNA product purification kit (Suo Laibao companies, article No.：D1300 it) carries out.It is identical
After DNA connection products are handled with two methods respectively, transformed competence colibacillus Escherichia coli find that treated for the method for the invention
DNA connection product transformation efficiencies are significantly higher than DNA adsorption column method (statistical methods：Independent samples t test, * indicate P≤0.05)
(Figure 10 and Figure 11).
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all essences in the present invention
All any modification, equivalent and improvement etc., should all be included in the protection scope of the present invention made by within refreshing and principle.
Sequence table
<110>University Of Nanhua；
<120>A method of it improving DNA recombinant fragments and converts Escherichia coli efficiency
<141> 2018-01-23
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 27
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
<210> 2
<211> 30
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 738
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
Claims (4)
1. a kind of method improving recombinant dna fragment conversion Escherichia coli efficiency, which is characterized in that the raising recombinant DNA piece
The EGFP segments and pUC18 plasmid double digestions that the method for section conversion Escherichia coli efficiency obtains PCR amplification, are connected with T4DNA
Enzyme to after digestion EGFP segments and pUC18 plasmids be attached, obtain connection product；1/5 connection is added in DNA connection products
The 10M ammonium acetates of bulk product；Then the absolute ethyl alcohol of 2 times of volumes of said mixture is added, is stored at room temperature 25min-1hr,
10000g centrifuges 25min-1hr；Supernatant is abandoned, 5-10 μ L 0.1M CaCl are added2, dissolve the precipitation of tube bottom.
2. the method for improving recombinant dna fragment conversion Escherichia coli efficiency as described in claim 1, which is characterized in that described
EGFP segment molal quantitys for recombinant DNA connection：PUC18 plasmid molal quantitys ≈ 8:1.
3. the method for improving recombinant dna fragment conversion Escherichia coli efficiency as described in claim 1, which is characterized in that described
It is needed before connection：With PCR method, the EGFP segments on pEGFP-C3 carriers are amplified；With I two kinds of inscribes of Hind III and EcoR
Enzyme, double digestion EGFP segments and pUC18 plasmids obtain the pUC18 plasmids and EGFP segments with identical cohesive end.
4. the method for improving recombinant dna fragment conversion Escherichia coli efficiency as described in claim 1, which is characterized in that described
Connect connection product needs obtained by the reaction：With ammonium acetate and ethanol precipitation DNA, 5-10 μ L 0.1M CaCl are then used2Dissolving
DNA connection products, and mixed with 10-100 μ L competent escherichia coli cells；30min, 42 DEG C of water-bath heat shocks are placed on ice
45-90sec places 2min on ice；0.4mL fluid nutrient mediums are taken to be added in said mixture, 37 DEG C, 250rpm shaken cultivations
1hr；Bacterium is uniformly coated on to the LB containing 0.125mg/mL IPTG, 0.1mg/mL X-gal, 0.1mg/mL Ampicillin
On solid medium；37 DEG C of culture 12-16hr.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810065431.4A CN108410895A (en) | 2018-01-23 | 2018-01-23 | A method of it improving recombinant dna fragment and converts Escherichia coli efficiency |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810065431.4A CN108410895A (en) | 2018-01-23 | 2018-01-23 | A method of it improving recombinant dna fragment and converts Escherichia coli efficiency |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108410895A true CN108410895A (en) | 2018-08-17 |
Family
ID=63126270
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810065431.4A Pending CN108410895A (en) | 2018-01-23 | 2018-01-23 | A method of it improving recombinant dna fragment and converts Escherichia coli efficiency |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108410895A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1141366A1 (en) * | 1998-12-23 | 2001-10-10 | Genentech, Inc. | Transfectacons comprising calcium phosphate and a nucleic acid |
| CN1371999A (en) * | 2001-02-28 | 2002-10-02 | 中国科学院上海植物生理研究所 | Double gene coexpression plasmid, construction method and application thereof |
| AU773922B2 (en) * | 1998-12-17 | 2004-06-10 | Yuri Romantchikov | Improved methods for insertion of nucleic acids into circular vectors |
| CN101294153A (en) * | 2007-11-22 | 2008-10-29 | 天津科技大学 | Aspergillus niger proline protein endopeptidase and preparation method thereof |
| CN103525796A (en) * | 2013-10-18 | 2014-01-22 | 江苏辉腾生物医药科技有限公司 | Recombinase with activity of glutaryl-7-aminocephalosporanic acid acylase and D-amino acid oxidase as well as preparation method and application thereof |
| CN103834682A (en) * | 2012-11-22 | 2014-06-04 | 中国农业大学 | Transcription factor derived from corn and new use of coding gene thereof |
-
2018
- 2018-01-23 CN CN201810065431.4A patent/CN108410895A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU773922B2 (en) * | 1998-12-17 | 2004-06-10 | Yuri Romantchikov | Improved methods for insertion of nucleic acids into circular vectors |
| EP1141366A1 (en) * | 1998-12-23 | 2001-10-10 | Genentech, Inc. | Transfectacons comprising calcium phosphate and a nucleic acid |
| CN1371999A (en) * | 2001-02-28 | 2002-10-02 | 中国科学院上海植物生理研究所 | Double gene coexpression plasmid, construction method and application thereof |
| CN101294153A (en) * | 2007-11-22 | 2008-10-29 | 天津科技大学 | Aspergillus niger proline protein endopeptidase and preparation method thereof |
| CN103834682A (en) * | 2012-11-22 | 2014-06-04 | 中国农业大学 | Transcription factor derived from corn and new use of coding gene thereof |
| CN103525796A (en) * | 2013-10-18 | 2014-01-22 | 江苏辉腾生物医药科技有限公司 | Recombinase with activity of glutaryl-7-aminocephalosporanic acid acylase and D-amino acid oxidase as well as preparation method and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| BEVERLY C. DELIDOW: "Molecular Cloning of PCR Fragments with Cohesive Ends", 《MOLECULAR BIOTECHNOLOGY》 * |
| 梁建庆等: "转化条件对质粒DNA转化大肠杆菌的影响", 《微生物学杂志》 * |
| 梅运军等: "Ca2+对诱导摄取外源DNA的影响", 《武汉大学学报》 * |
| 谭锬等: "一种改良的DNA沉淀法在重组DNA转化大肠杆菌中的应用", 《北京师范大学学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3910067B1 (en) | Nucleic acid release agent, nucleic acid pcr amplification method and pcr amplification kit | |
| Dhaliwal | DNA extraction and purification | |
| Li et al. | Protocol: a rapid and economical procedure for purification of plasmid or plant DNA with diverse applications in plant biology | |
| US7888006B2 (en) | Method for isolating DNA from biological samples | |
| US20060223071A1 (en) | Methods, compositions, and kits for detecting nucleic acids in a single vessel | |
| JP2008054660A (en) | Filter device for isolating nucleic acid | |
| US20210380966A1 (en) | Method for isolating poly(a) nucleic acids | |
| CN108018271B (en) | Single subunit RNA polymerase, its purification method and application in RNA synthesis | |
| JP2006517225A (en) | Chemical treatment of biological samples for nucleic acid extraction and kits for the treatment | |
| EP1051520A1 (en) | Improved method for the isolation of nucleic acid | |
| JP3979996B2 (en) | Compositions and methods for purifying RNA using solid supports | |
| Clement et al. | Isolating PCR-quality DNA from human feces with a soil DNA kit | |
| EP3135769A1 (en) | Kits and methods for extracting rna | |
| Goh | Phage transduction | |
| JP2023021395A (en) | Methods for isolating nucleic acid from specimens in liquid based cytodiagnosis preservatives containing formaldehyde | |
| De Wyngaert et al. | Involvement of DNA gyrase in replication and transcription of bacteriophage T7 DNA | |
| CN108410895A (en) | A method of it improving recombinant dna fragment and converts Escherichia coli efficiency | |
| CN112063616A (en) | Nucleic acid extraction method and extraction kit | |
| US20060223070A1 (en) | Methods, compositions, and kits for detecting nucleic acids in a single vessel | |
| Harbers et al. | Nucleotide clusters in deoxyribonucleic acids. XI. Comparison of the sequences of the large pyrimidine oligonucleotides of bacteriophages S13 and φX174 deoxyribonucleic acids | |
| WO2021253521A1 (en) | Artificial non-coding rna module for enhancing nitrogen fixation capability of microorganisms | |
| JPH02291266A (en) | Mrthod for isolating nucleic aicd | |
| CN108220317B (en) | Recombinant expression plasmid and preparation method and application thereof | |
| CN106318922A (en) | Preparation method of Pfu DNA polymerase | |
| Haqqi | Direct ligation of PCR products for cloning and sequencing. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180817 |