CN108410873B

CN108410873B - System and method for constructing LCAT gene knockout hamster model

Info

Publication number: CN108410873B
Application number: CN201810201435.0A
Authority: CN
Inventors: 冼勋德
Original assignee: Hebei Invivo Biotech Inc
Current assignee: Beijing Hfk Bioscience Co ltd
Priority date: 2018-03-12
Filing date: 2018-03-12
Publication date: 2020-05-26
Anticipated expiration: 2038-03-12
Also published as: CN108410873A

Abstract

The invention discloses a system and a method for constructing a hamster model knocked out by Lecithin Cholesterol Acyltransferase (LCAT) gene, wherein the system comprises a hamster LCAT gene specific targeting sequence sgRNA and a PCR primer for amplifying the sgRNA. The method comprises the following steps: designing a targeting sequence specific to the hamster LCAT gene, and preparing the cas9mRNA and sgRNA; collecting and culturing hamster zygotes; microinjection: co-injecting the sgRNA and cas9mRNA into the cytoplasm of hamster zygotes; finally, the fertilized eggs after microinjection are implanted into a surrogate hamster, an F1 surrogate hamster is born, and a hamster model with an LCAT gene knockout is constructed through identification.

Description

System and method for constructing LCAT gene knockout hamster model

Technical Field

The invention relates to the technical field of disease animal models and preparation thereof, in particular to a cardiovascular disease animal model and a construction method thereof, and especially relates to a construction method and a system of a Lecithin Cholesterol Acyltransferase (LCAT) gene knockout hamster.

Background

Lecithin-cholesterol acyltransferase (LCAT) is an esterifying enzyme that catalyzes free cholesterol in High-density lipoprotein (HDL), and receives cholesterol from peripheral tissues including arterial walls, which is transported to the liver for degradation, and is one of the key factors for reverse cholesterol transport. In the lipoprotein metabolic pathway, LCAT plays an important role in regulating the metabolism of cholesterol, triglycerides and phospholipids. The crowd investigation research finds that LCAT increasing has a protective effect on coronary heart disease; however, studies in mice have shown that overexpression of LCAT transgene promotes arteriosclerosis (As), and that knocking out LCAT reduces As, which is clearly contrary to LCAT's role in reverse cholesterol transport and the results of studies in the population. Therefore, it is necessary to use a humanized animal model to elucidate the important scientific question of delaying or promoting the development of coronary heart disease.

After the establishment of the genetically engineered mouse technology, although mice became the major model animal of animal models of disease, researchers increasingly recognized the difference between mouse disease and human disease. Therefore, the development and construction of humanized and humanized-like animal models for the development of transformation medicine research is also a direction for the development of biomedical fields in recent years. With the progress of the research of genetically engineered hamsters in recent years, the advantages of the genetically engineered hamsters in the research of metabolic cardiovascular diseases are gradually and widely re-recognized. Compared with mice and rabbits, the glycolipid metabolic mechanism of hamsters is more similar to that of human beings, including reactivity to high-fat diet, high-density lipoprotein (LDL) component in plasma lipid profile, Cholesterol Ester Transfer Protein (CETP), HL and ApoAII expression, ApoB100 edited by liver, and high-fructose feed can induce type 2 diabetes, so that the advantages of the hamsters in the research of metabolic cardiovascular diseases are very clear.

Based on hamster anthropomorphic characteristics, LCAT gene knockout (LCAT-/-) and transgenosis of hamsters can provide a relatively clear answer for the influence of LCAT on As in disputes and provide a theoretical basis for further intervention method research.

Disclosure of Invention

The invention aims to provide a system and a method for constructing an LCAT gene knockout hamster model. The embodiment of the invention applies a high-efficiency genome editing CRISPR/Cas9 technology to construct an LCAT gene knockout anthropomorphic hamster animal model for solving the problem of the controversial relationship between LCAT and atherosclerosis in clinical and basic researches.

In order to achieve the purpose, the embodiment of the invention adopts the technical scheme that:

a system for constructing a LCAT gene knockout hamster model, the system comprising hamster LCAT gene specific targeting sequences and sgrnas:

the hamster LCAT gene specific targeting sequence is shown as SEQ ID NO. 1;

preparation of the sgRNA: adopting artificial sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3, carrying out PCR amplification, taking a 124bp DNA fragment in an amplification product as a DNA template of the sgRNA, and carrying out in-vitro transcription on the obtained DNA template of the sgRNA to obtain a sgRNA crude product.

Optionally, the system further comprises cas9mRNA prepared by the steps of: the DNA template of cas9mRNA is obtained by adopting PXT7 plasmid containing humanized cas9 cDNA and purifying through XbaI restriction endonuclease action, and the obtained DNA template of cas9mRNA is obtained through in vitro transcription to obtain cas9mRNA crude product.

Alternatively, in the preparation of cas9 mRNA:

the DNA template purification method of cas9mRNA comprises the following steps: treating PXT7 plasmid with XbaI restriction endonuclease, treating with proteinase K for 20-50min, extracting with phenol-chloroform, and precipitating with ethanol;

and/or the purification method of the obtained cas9mRNA crude product comprises the following steps: the cas9mRNA crude product is extracted by phenol-chloroform, precipitated by isopropanol and dissolved by water without RNA enzyme, thus obtaining cas9mRNA with the concentration of 200 and 800 ng/mul.

Alternatively, the conditions for DNA template transcription of cas9mRNA are: using the mMESSAGE mMACHINE T7 kit, the reaction was carried out at 37 ℃ for 1 to 3 hours.

Optionally, the reaction conditions for PCR amplification are:

98℃30s；

35 cycles of 98 ℃ for 10s,56 ℃ for 30s and 72 ℃ for 15 s;

72℃10min。

alternatively, the conditions for DNA template transcription of sgrnas are: the reaction was carried out at 37 ℃ for 3-5h using Megascript T7 Kit.

Alternatively, in the preparation of sgrnas:

the method for selecting and purifying the DNA template of the obtained sgRNA comprises the following steps: subjecting the PCR product to agarose gel electrophoresis, recovering a 124bp DNA band by using a gel recovery kit, treating for 20-50min by using proteinase K, extracting by using phenol-chloroform, and precipitating by using ethanol to obtain a DNA template of the sgRNA; and/or

The purification method of the obtained sgRNA crude product comprises the following steps: purification was performed using the MEGAclear Kit, with no RNase water dissolved to a concentration of 100-500 ng/. mu.l sgRNA.

The embodiment of the invention also provides a method for constructing the LCAT gene knockout hamster model, which comprises the following steps:

step one, designing a hamster LCAT receptor gene specific targeting sequence shown as SEQ ID NO. 1; preparing cas9mRNA from PXT7 plasmid containing humanized cas9 cDNA, and preparing sgRNA by PCR reaction and transcription by adopting artificial sequences shown as SEQ ID NO:2 and SEQ ID NO: 3;

step two, collecting and culturing hamster zygotes;

step three, microinjection: injecting the sgRNA and cas9mRNA prepared in the first step into cytoplasm of hamster fertilized eggs;

and step four, implanting the fertilized eggs subjected to microinjection into surrogate pregnant hamsters, and identifying the F1 surrogate hamsters after birth.

The beneficial effect that adopts above-mentioned technical scheme to produce lies in: the sgRNA sequence adopted in the embodiment of the invention is efficient and is not easy to miss; the operation is simple, the efficiency is high, and the fatality rate is low; the personified LCAT-/-hamster model provided by the embodiment of the invention has important significance for determining the relation between LCAT and atherosclerosis, especially coronary arteriosclerosis.

Drawings

Fig. 1 is a hamster gene sequence, wherein the sgRNA recognition sites on the second exon of the LCAT gene are shown in italic font, the PAM sequence is in italic bold font and the mutated portion is underlined;

FIGS. 2A-2C are LCAT genotypes after successful hamster model construction, respectively, and compared to normal hamster genotypes, wherein italic fonts are sgRNA positions, italic bold fonts are PAM sequences, and- -are missing portions;

FIG. 3 is a DNA gel electrophoresis of LCAT deleted Δ 12bp hamster tissue after PCR amplification, the length of the deleted fragment DNA is 108bp, and the three genotypes of wild type (wt), heterozygote (+/-), and homozygote (-/-);

FIG. 4 shows a graph of total cholesterol and triglyceride levels in plasma and HDL-C levels in homozygotes of the LCAT gene lacking bases Δ 6bp, Δ 12bp, and Δ 56bp, and a wild-type control hamster, respectively;

FIGS. 5A-C are phenotyping hamsters lacking Δ 56 homozygous for testing plasma cholesterol levels;

FIGS. 6A and 6B are lipoprotein maps in LCAT gene-deleted hamsters and wild-type hamsters TC and TG, respectively, wherein the LCAT knockout hamster is (-/-), and the wild-type hamster is (WT);

FIGS. 7A-C are western blot analysis of hamster plasma apolipoproteins ApoB100, ApoE, ApoAI and LCAT activity profiles in LCAT gene-deleted hamster and wild-type hamster plasma, respectively;

FIG. 8 is a graph of atherosclerotic lesions, wherein A is a representative graph representing an atherosclerotic lesion; and B, quantitatively detecting the arteriosclerosis lesion area.

Detailed Description

In order to make the technical problems, technical solutions and advantageous effects to be solved by the present invention more clearly apparent, the present invention is further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

The basic concept of the embodiment of the invention is as follows: based on hamster LCAT Gene information (Gene ID:101823034), cas9mRNA and sgRNA were constructed based on the design of guide RNA targeting atctcaatatgtttctacccctgg sequence in its second exon as sgRNA sequence.

Example 1

A system for constructing a LCAT gene knockout hamster model comprising hamster LCAT gene specific targeting sequences, cas9mRNA and sgRNA:

the hamster LCAT gene specific targeting sequence is shown as SEQ ID NO. 1;

preparation of the cas9 mRNA:

adopting a PXT7 plasmid containing humanized cas9 cDNA, performing XbaI restriction endonuclease action, and purifying to obtain a DNA template of cas9mRNA, wherein the DNA template of cas9mRNA is subjected to in vitro transcription to obtain a cas9mRNA crude product;

preparation of the sgRNA: adopting artificial sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3 as primers and templates, performing PCR amplification, taking a 124bp DNA fragment in an amplification product as a DNA template of the sgRNA, and performing in-vitro transcription on the DNA template of the sgRNA to obtain a sgRNA crude product.

In NCBI (National Center for Biotechnology Information ), hamster whole genome sequencing and splicing work has been very completed, databases have been established, and the gene modification model preparation and identification work of this example was basically completed based on the databases. The LCAT Gene information (Gene ID:101823034) in the database was found to design the target sequence position of the sgRNA in its second exon, see FIG. 1 and SEQ ID NO: 1.

In this example, cas9DNA template used in the preparation of cas9mRNA was PXT7 plasmid containing humanized cas9 cDNA. Before transcription, the PXT7 plasmid was fully linearized by the action of XbaI restriction enzymes. After the reaction was terminated, the sample was treated with proteinase K for 30min to remove RNase as much as possible. Further phenol-chloroform extraction and ethanol precipitation are carried out to obtain the DNA template of cas9 mRNA.

The DNA template of cas9mRNA was in vitro transcribed to obtain cas9 mRNA. Wherein the kit for in vitro transcription is the mMESSAGE mMACHINE T7 kit (Ambion) kit. The transcription system was fully reacted at 37 ℃ for 2 hours. Cas9mRNA obtained by the reaction was purified by phenol-chloroform extraction, precipitated with isopropanol, and dissolved in RNase-free water to a concentration of 500 ng/. mu.l. Stored in a-80 ℃ freezer for use in constructing microinjection molds.

The primers shown in SEQ ID NO. 2 and SEQ ID NO. 3 are mutually taken as templates, and the method for carrying out PCR amplification comprises the following steps: the reaction is carried out in a 50 mu l system under the reaction condition of 98 ℃ for 30 s; 35 cycles of 98 ℃, 10s,56 ℃, 30s,72 ℃ and 15 s; 10min at 72 ℃. The PCR product is subjected to agarose gel electrophoresis, and a 124bp DNA band is recovered using a gel recovery kit, such as TAKARA kit. Then treated with proteinase K for 30min to remove RNase from the sample as much as possible. Further, phenol-chloroform extraction and ethanol precipitation are carried out to obtain the DNA template of the sgRNA.

The DNA template of the resulting sgRNA is transcribed using an in vitro transcription kit, such as Megascript T7 kit (ambion) kit. The transcription system was fully reacted at 37 ℃ for 4 hours. The sgRNA obtained from the reaction was purified using the MEGAclear Kit (ambion). RNase-free water was dissolved to a concentration of 200 ng/. mu.l. Stored in a-80 ℃ freezer for use in constructing microinjection molds.

The system of the embodiment can be used for constructing hamster models of LCAT gene knockout.

Example 2

In this example, a method for constructing a hamster knockout LCAT gene model using the system of example 1 will be described by taking a wild hamster obtained from experimental animal technologies of viton, beijing as an example. In this example, experimental plans and procedures such as preparation and analysis of hamster models were examined by ethical committee experimental animal ethics.

The wild type hamsters were raised to clean grade standards. Keeping the humidity at 50-60% and the temperature at 22-24 ℃. The illumination period is 6:00-20:00 illumination and 20:00-6:00 darkness.

The specific method for preparing hamster model from wild hamster comprises the following steps:

step one, according to the system of example 1, the hamster LCAT gene specific target sequence was designed, and the cas9mRNA and sgRNA were prepared.

Step two, collecting and culturing hamster zygotes

Selecting 8-12 weeks old female mice to induce superovulation. The estrus cycle of hamsters was four days, and on the second day of the cycle, i.e., after disappearance of oestrus, Pregnant Mare Serum Gonadotropin (PMSG) was intraperitoneally injected at a concentration of 125U/kg. The first night of the next estrus cycle 19 points were mated overnight with male mice in cages. The female mice were sacrificed by intraperitoneal injection of excess pentobarbital sodium at 14 pm the next day after cage combination. The oviduct was dissected and placed in M2 medium (Sigma-Aldrich, St. Louis, MO, USA) preheated at 37 ℃. Under a dissecting microscope, tearing the ampulla of the expanded oviduct, allowing the deposit containing the fertilized eggs to flow out, and collecting the fertilized eggs.

The in vitro culture medium for hamster zygotes was HECM-10(NaCl 113.8mM, KCl 3mM, NaHCO)₃25mM sodium lactate 4.5mM CaCl₂1mM，MgCl₂2mM, 0.01mM of glutamic acid, 0.2mM of glutamine, 0.01mM of glycine, 0.01mM of histidine, 0.01mM of lysine, 0.01mM of proline, 0.01mM of serine, 0.01mM of asparagine, 0.01mM of aspartic acid (aspartic acid), 0.01mM of cysteine (cysteine), 0.5mM of taurine (taurine), 0.003mM of pantothenate, 0.1mg/ml of polyvinyl alcohol). The HECM-10 culture drops were overlaid with paraffin oil. The culture temperature of fertilized eggs is 37.5 ℃, and CO is₂The concentration was 10% for culture.

Step three, microinjection: co-injecting the sgRNA and cas9mRNA of step one into the cytoplasm of hamster zygotes.

Injection drops were prepared and a drop of 100 μ l M2 medium was added to the injection dish, sealed in mineral oil. All fertilized eggs leave the incubator for less than 15 minutes. sgRNA and cas9mRNA were co-injected into the cytoplasm at injection concentrations of 10 ng/. mu.l and 20 ng/. mu.l. The fertilized eggs after injection are cultured in an incubator for 1-2 hours and then are used for retransfusion to surrogate mother rats.

Female mice with the same age and estrus cycle as the ovine hamster were selected as surrogate hamsters. The surrogate mouse estruses 19 points later in the first day and mates with the male mouse in a cage overnight. The next day, the injected fertilized eggs are implanted into the surrogate mouse from the umbrella mouth of the fallopian tube. 15 fertilized eggs were implanted into each fallopian tube.

After one week of born hamster age, genome DNA extracted from skin tissue, toe tissue or blood cells of the born hamster is taken, a target fragment is amplified by PCR, primers are upstream 5'-CAGACGCCAGTCATAGGGTG-3' (SEQ ID NO:4) and downstream 5'-CCAGAACAAAAGCTGGTGCC-3' (SEQ ID NO:5), a specific band is obtained by electrophoresis detection after PCR, the sequence is divided into a sequence and a chromatographic peak map, the mutation position is determined, the mutant hamster is further subjected to sequence verification, a PCR product is linked to a T vector and transformed into a competent cell, the competent cell is inoculated to an LB culture medium plate added with ampicillin, the LB culture medium plate is incubated at 37 ℃ for 12h, 20 monoclonal colonies are randomly picked and inoculated to an LB liquid culture medium, after 12h incubation at 37 ℃, a bacterial solution is subjected to sequencing, the sequence and the chromatographic peak map are analyzed, the number and the position of base mutation and the mutation type which can be generated are determined, the damaged DNA is directly connected from the tail end or recombined to repair after digestion of the specific site by virtue of cas9 endonuclease, so that LCAT gene mutation types of various different in vivo are generated, after digestion of the specific site enzyme, the damaged DNA is subjected to end direct connection or recombination, the end recombination is repaired, and the LCAT gene mutation types of the mutant strains are obtained, and are subjected to hybridization of wild strain, and the tail strain obtained by a tail clone DNA obtained by a method of a clone strain obtained by a method of PCR amplification method, a target fragment amplification method, a primer, a target fragment amplification primer, a.

The free cholesterol assay kit (priley biotechnology limited) measures the amount of free cholesterol in plasma continuing with the most phenotypically clear △ 56bp strain homozygous hamster, the plasma was tested and found that in the presence of a significant decrease in HDL-C (high density lipoprotein cholesterol) (fig. 5A), the HDL/TC ratio (fig. 5B) also showed almost no HDL component in total plasma cholesterol, in the absence of a significant change in total cholesterol, plasma free cholesterol (free cholesterol) (fig. 5C) was significantly elevated, thus a positive significant decrease in cholesterol esters indicates a t-test statistical test p < 0.001.

Lipid component in plasma lipoprotein is detected by using Fast Protein Liquid Chromatography (FPLC) instrument and hyperse 6HR10/30 chromatographic column to separate plasma lipoprotein component firstly. 200 μ l of plasma was loaded through a 0.22 μm syringe filter and fractions were automatically collected at 0.5 mL/min for a total of 40 fractions, 500 μ l each. The collected 40-tube fractions were measured for cholesterol (TC) and Triglyceride (TG) concentrations, respectively, and plotted as a lipoprotein profile, referring to fig. 6A and 6B, where fig. 6A shows the peaks of the respective fractions as Very Low Density Lipoprotein (VLDL), Low Density Lipoprotein (LDL), and High Density Lipoprotein (HDL), respectively, and the peaks of the respective fractions in fig. 6B are located at the same positions as those in a. The results show a significant increase in VLDL fraction and a significant decrease in HDL fraction in LCAT knockout hamsters.

Western blot analysis of hamster plasma apolipoproteins ApoB100, ApoE, ApoAI, fig. 7A is a protein band displayed by chemiluminescence method after ultracentrifugation and defatting of plasma lipoproteins, SDS-PAGE electrophoresis, hybridization with the corresponding apolipoprotein antibodies, and fig. 7B is a bar graph after scanning quantification. The results showed that LCAT knockout hamster (-/-) plasma ApoB100 was significantly increased, ApoAI was not detectable, and ApoE was not significantly changed. The LCAT activity was measured using a cholesterol acyltransferase activity assay kit (MAK107) from SIGMA, and it was found that LCAT activity in plasma of a knockout homozygous (LCK) hamster was significantly reduced compared to a Wild Type (WT) hamster. Denotes t-test statistical test p < 0.001.

The above results show that: the LCAT knockout hamster model was successfully prepared using the method of this example. Using this LCAT gene knockout hamster model, given 12 weeks of high fat diet, aortic atherosclerotic lesions were significantly more elevated in LCAT mutant hamsters than in normal control hamsters, suggesting that LCAT gene deficiency may contribute to atherosclerotic lesions, as shown in fig. 8: a is a representative diagram showing arteriosclerotic lesions; and B, quantitatively detecting the arteriosclerosis lesion area.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

<110> Hebei Yiweiwa Biotech Ltd

<120> System and method for constructing LCAT Gene knockout hamster model

<130>2018.02.27

<160>5

<170>PatentIn version 3.5

<210>1

<211>24

<212>DNA

<213> target sequence

<400>1

atctcaatat gtttctaccc ctgg 24

<210>2

<211>64

<212>DNA

<213>CRISPR-Forward

<400>2

gaaattaata cgactcacta tagatctcaa tatgtttcta ccccgtttta gagctagaaa 60

tagc 64

<210>3

<211>80

<212>DNA

<213>sgRNA-Reverse

<400>3

aaaagcaccg actcggtgcc actttttcaa gttgataacg gactagcctt attttaactt 60

gctatttcta gctctaaaac 80

<210>4

<211>20

<212>DNA

<213> Artificial sequence

<400>4

cagacgccag tcatagggtg 20

<210>5

<211>20

<212>DNA

<213> Artificial sequence

<400>5

ccagaacaaa agctggtgcc 20

Claims

1. A system for constructing a hamster model knockout of the LCAT gene, the system comprising a hamster LCAT gene-specific targeting sequence and sgRNA:

the hamster LCAT gene specific targeting sequence is shown as SEQ ID NO. 1;

2. The system for constructing a LCAT knockout hamster model of claim 1, further comprising cas9mRNA prepared by the steps of: the DNA template of cas9mRNA is obtained by purifying PXT7 plasmid containing humanized cas9 cDNA through XbaI restriction endonuclease action, and the obtained DNA template of cas9mRNA is obtained through in vitro transcription to obtain cas9mRNA crude product.

3. The system for constructing a LCAT knockout hamster model of claim 2, wherein in the preparation of cas9 mRNA:

4. The system of claim 2, wherein the conditions for in vitro transcription of the DNA template for cas9mRNA are: using the mMESSAGE mMACHINE T7 kit, the reaction was carried out at 37 ℃ for 1 to 3 hours.

5. The system for constructing a LCAT knockout hamster model according to claim 1, wherein the reaction conditions for the PCR amplification are:

98℃30s；

35 cycles of 98 ℃ for 10s,56 ℃ for 30s and 72 ℃ for 15 s;

72℃10min。

6. the system of claim 1, wherein the conditions for in vitro transcription of the DNA template of the sgRNA are: the reaction was carried out at 37 ℃ for 3-5h using Megascript T7 Kit.

7. The system for constructing a hamster model knockout LCAT gene of claim 1, wherein in the preparation of sgRNAs,

8. A method for constructing a LCAT knock-out hamster model using the system of any of claims 1 to 7, comprising the steps of:

step one, designing a hamster LCAT receptor gene specific targeting sequence shown as SEQ ID NO. 1; preparing cas9mRNA from PXT7 plasmid containing humanized cas9 cDNA, and preparing sgRNA by PCR reaction and in vitro transcription by adopting artificial sequences shown as SEQ ID NO. 2 and SEQ ID NO. 3;

step two, collecting and culturing hamster zygotes;

9. The method of constructing a LCAT knockout hamster model of claim 8, wherein: in step three, the injection concentration of sgRNA and cas9mRNA was 10 ng/. mu.l and 20 ng/. mu.l, respectively.