CN108387621A - Cadmium ion aptamer and screen printing electrode electrochemica biological sensor - Google Patents
Cadmium ion aptamer and screen printing electrode electrochemica biological sensor Download PDFInfo
- Publication number
- CN108387621A CN108387621A CN201810022756.4A CN201810022756A CN108387621A CN 108387621 A CN108387621 A CN 108387621A CN 201810022756 A CN201810022756 A CN 201810022756A CN 108387621 A CN108387621 A CN 108387621A
- Authority
- CN
- China
- Prior art keywords
- cadmium ion
- screen printing
- aptamers
- electrode
- electrochemica biological
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
- G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
- G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
Abstract
The present invention relates to cadmium ion aptamer and relevant screen printing electrode electrochemica biological sensors.The length of cadmium ion aptamer of the present invention is 22 28 bases, and contains nucleic acid sequence GTGATGACCTGC.The present invention also provides the screen printing electrode electrochemica biological sensors containing the cadmium ion aptamer.The present invention is based on aptamers and the specific recognition of cadmium ion to act on, and uses DPV for electrochemical measuring technique, establishes a kind of method of electrochemical aptamer biosensor detection cadmium ion, a kind of new method and approach are provided for the detection of cadmium ion.Aptamers of the present invention and electrochemica biological sensor have high specific, and highly sensitive, easy to operate, testing cost is low, the advantages that being suitable for Site Detection.
Description
Technical field
The invention belongs to detection technique fields, are related to cadmium ion aptamer and relevant screen printing electrode electrochemistry
Biosensor.
Background technology
Cadmium (Cd, Cadmium) is the nonessential heavy metal element of human body, is that a kind of high hypertoxic height endangers environmental contaminants,
Have the characteristics that be not easy to be metabolized, be enriched with by force.International cancer research institution (IARC) is included in cadmium for human carcinogen.Cadmium is as one
Custom catalysts in kind industrial production, the arbitrary discharge of the waste water,waste gas and industrial residue containing cadmium are the weights of heavy metal cadmium in environment
Reason is wanted, the pollution main source of cadmium in foods is that crop root system absorbs simultaneously cadmium from soil, is on the other hand that cadmium exists
Enrichment causes the mankind to be poisoned using the transmission of food chain in the aquatic products such as shellfish.In recent years, cadmium poisoning thing frequently occurs for China
Part, cadmium poisoning are divided into acute poisoning and slow poisoning, and acute poisoning harm is shown as：Nausea,vomiting,diarrhea etc. and food poisoning
Similar, lethal dose is oral 300mg or more；Slow poisoning is to be absorbed by the body and be enriched with, and concentrates on tired out, anaemia,
The symptoms such as skeletal abnormality, injury of kidney, can also carcinogenic teratogenesis.
The pollution main source of heavy metal includes the processes such as environmental pollution and food processing in food at present, and existing weight
Traditional detection method of cadmium metal mainly has ultraviolet spectrophotometry, atomic fluorescence spectrometry, graphite oven atomic absorption, electricity
Feel Coupled Plasma spectroscopy etc., although traditional detection method can accurately detect trace heavy metals,
Equipment is expensive, and personnel is needed could operate after training, and operation is time-consuming, and testing cost is higher, can not it is live, online to food
Monitored in real time, and electrochemical method expense is low, cheap, easy to operate, high sensitivity, is easy to be miniaturized, can scene,
On-line checking is to the trend that heavy metal is future development.
Invention content
For the existing deficiency to cadmium ion detection technique, the purpose of the present invention is to provide a kind of cadmium ion nucleic acid adaptations
Body, the aptamers have affinity height, high specificity, stability is good, be easy to modification, cheap, target range extensively, to environment
The features such as of less demanding.
Cadmium ion aptamer of the present invention is characterized in that the sequence length of the aptamers is 22-28
Base, and contain nucleic acid sequence GTGATGACCTGC.
Preferably, the sequence of the aptamers such as SEQ ID NO:Shown in 1-10.
The further feature of cadmium ion aptamer according to the present invention, the aptamers are 5 ' terminal modified at it
The i.e. 5 '-SH- of sulfydryl (CH2)6-。
Second object of the present invention is to provide a kind of screen printing electrode electrochemica biological sensor, the electrochemica biological
Transducer sensitivity higher, there is good stability and reproducibility, can be used to detect heavy metal cadmium ion.
It is suitable that screen printing electrode electrochemica biological sensor of the present invention contains cadmium ion nucleic acid of the present invention
Ligand.
Third object of the present invention is to provide the preparation methods of the aptamer electrochemica biological sensor.
The preparation method of screen printing electrode electrochemica biological sensor of the present invention, includes the following steps：
A. screen printing electrode pre-processes：Screen printing electrode, which immerses in the 0.5M concentrated sulfuric acids, to be scanned with cyclic voltammetry to steady
Fixed (cleaning and activated electrode surface), for screen printing electrode with gold for working electrode and auxiliary electrode, silver is reference electrode；Setting
Parameter：Scanning range：- 0.3V-1.3V, sweep speed 0.1V/s；
B. the aptamers modification of electrode after pre-processing：Cadmium ion aptamer described in claim 1 is synthesized, is added
1mol/L NaCl are configured to the aptamers assembles concentration containing 5 μm of ol/L, and aptamers assembles concentration is added dropwise to the pretreated silks of step A
Wire mark brush electrode working electrode surface assembles 20 hours at 4 DEG C of sealing, obtains the screen printing electrode electrochemica biological and passes
Sensor.
Fourth object of the present invention be to provide the screen printing electrode electrochemica biological sensor detection cadmium from
The application of sub- aspect.
Fifth object of the present invention is to provide a kind of detection cadmiums based on screen printing electrode electrochemica biological sensor
The method of ion.
The method of detection cadmium ion of the present invention based on screen printing electrode electrochemica biological sensor include with
Lower step：
A. use screen printing electrode electrochemica biological sensor as claimed in claim 3 to cadmium ion standard solution into
Row detection, establishes standard curve；
B. the solution that cadmium ion titer is configured to various concentration is added in sample, DPV analyses are carried out, by establishing standard
Curve calculates the concentration of corresponding cadmium ion, the as concentration of actual sample cadmium ion.
The further feature of the method according to claim 11, the step A include the following steps：
By it is described be aptamers electrochemica biological sensor ultrapure water, remove unbonded aptamers, then
Silk-screen printing gold electrode is placed in the K of dense 5mmol/L3[Fe(CN)6], difference arteries and veins is carried out in the electrolyte of the KCl containing 0.1mol/L
Rush voltammetry analysis, the DPV figures and peak point current Ipo of record aptamer sensor, electrochemical parameter：Operating potential
300mV-700mV, it is 100mV/s to sweep speed；
The aptamers electrochemica biological sensor is sequentially placed into a concentration of：0.1、0.5、1、5、10、50、100ng/ml
Cadmium ion standard solution in, react 30min at 25 DEG C, impregnating 5min with ultra-pure water after reaction removes non-specific adsorption
Cadmium ion：In the K of 5mmol/L3[Fe(CN)6], differential pulse voltammetry voltammetry is carried out in the electrolyte of the KCl containing 0.1mol/L
DPV is scanned.Electrochemical parameter：Operating potential 300mV-700mV, it is 100mV/s to sweep speed；
Corresponding DPV figures and its peak point current Ipn, wherein n=1,2...7 under each concentration of cadmium ion are recorded, is calculated each
The peak current changing value △ Ip of the relatively initial aptamer sensor of standard items, and be with the logarithm of each cadmium ion concentration of standard solution
Abscissa, corresponding △ Ip map for ordinate, establish standard curve.
Aptamers electrochemica biological sensor of the present invention is using aptamers of the present invention as recognition component
Cadmium ion is detected, principle is：In the presence of cadmium ion, aptamers of the present invention are sent out with cadmium ion specificity
Raw specific binding, causes the aptamers space conformation to change, cause in electrolyte the potassium ferricyanide and electrode interface it
Between electron transfer rate change.By establishing the linear relationship between the logarithm of concentration of cadmium ions and △ Ip, so that it may with
Have the function that detect cadmium ion.
The beneficial effects of the invention are as follows：The present invention is based on aptamers and the specific recognitions of cadmium ion to act on, use DPV for
Electrochemical measuring technique establishes a kind of method of electrochemical aptamer biosensor detection cadmium ion, is the inspection of cadmium ion
Survey provides a kind of new method and approach.
Compared with current a example detection method, the invention has the advantages that：
(1) preparation of the sensor is constructed based on aptamers and the effect of the specific recognition of cadmium ion, compares egg
For white matter, aptamers have affinity high, and high specificity, stability is good, is easy to modify, cheap, and target range is wide, right
The features such as environmental requirement is not high.
(2) use silk-screen printing gold electrode for working electrode, the effect for the Au-SH keys that can be connected with covalent bond using Au and SH
The step modification to aptamers is realized, the modification of aptamers is enormously simplified.
(3) actual amount needed for the preparation of aptamers electrochemica biological sensor is few, and screen printing electrode can be directly connected to
Portable electrochemical detecting instrument, easy to carry, compared with traditional detection method, this method has high specificity, easy spirit
Living, analyze speed is fast, and testing cost is low, it can be achieved that the advantages that field quick detection.
Description of the drawings
Fig. 1 is that screen printing electrode electrochemica biological sensor of the present invention is molten in the cadmium ion standard of various concentration
The DPV collection of illustrative plates detected in liquid.
Fig. 2 is that screen printing electrode electrochemica biological sensor of the present invention is molten in the cadmium ion standard of various concentration
The signal intensity tendency chart detected in liquid.
Fig. 3 is the canonical plotting that cadmium ion standard solution detects.
Specific implementation mode
Embodiment one：The structure of screen printing electrode electrochemica biological sensor of the present invention
(1) reagent and instrument
Four hydrate of cadmium nitrate (Cd (NO3)2·4H2O) purchase is in Sigma, purity 99%, cadmium ion described herein
Aptamer is synthesized by Shanghai bioengineering Co., Ltd.Na2HPO4·12H2O、NaH2PO4·2H2O、NaCl、KCl、K4
[Fe(CN)6]·3H2O、K3[Fe(CN)6], the concentrated sulfuric acid, nitric acid be that analysis is pure, be purchased from Guangzhou Chemical Reagent Factory.Experimental water
For ultra-pure water (resistivity：18.2MΩ/cm).
CHI660C electrochemical workstations (Shanghai Chen Hua Instrument Ltd.), silk-screen printing gold electrode (DROPSENS) with
Gold is working electrode (diameter 4mm) and auxiliary electrode, and silver is reference electrode.
Cadmium ion nucleic acid aptamer sequence is：CTTTGTGCAGTGATGACCTGCTGCCG.The aptamer is 26
The ssDNA probe of bases longs.Sulfydryl-SH- (CH are carried out in 5 ' starting ends of DNA single nucleic acid strands2)6It modifies and is：-5’-SH-
(CH2)6-CTTTGTGCAGTGATGACCTGCTGCCG。
The preparation of cadmium ion aptamer assembles concentration：5 ' containing 5 μm of ol/L aptamers assembles concentrations terminal modified amino
I.e.：-5’-SH-(CH2)6The single stranded DNA of-CTTTGTGCAGTGATGACCTGCTGCCG is adapted to liquid solution, with the NaCl of 1mol/l
Solution dissolving is prepared.
(2) structure of aptamers electrochemica biological sensor
1. screen printing electrode pre-processes
Screen printing electrode pre-processes：Screen printing electrode, which immerses in the 0.5M concentrated sulfuric acids, to be scanned with cyclic voltammetry to steady
Fixed, for screen printing electrode with gold for working electrode and auxiliary electrode, silver is reference electrode.Arrange parameter：Scanning range：-0.3V-
1.3V, sweep speed 0.1V/s；
2. electrode modification
Treated electrode ultrapure water, is immersed in the aptamers assembles concentration of 5 μm of ol/l, and assembling is sealed at 4 DEG C
20h obtains the aptamers electrochemica biological sensor.
Nucleic acid sequence of the cadmium ion nucleic acid aptamer sequence from 5 ' ends to 3 ' ends is such as：(SEQ ID NO.1), 5 ' is terminal modified
Sulfydryl is -5 '-SH- (CH2)6-CTTTGTGCAGTGATGACCTGCTGCCG。
The cadmium ion aptamer solution of 100 μm of ol/L of concentration is 5 ' terminal modified sulfydryl i.e. -5 '-SH- (CH2)6-
CTTTGTGCAGTGATGACCTGCTGCCG aptamers probe solutions.
Embodiment two：Aptamer sensor is to the detection of cadmium ion standard items and its drafting of standard curve
By the aptamers screen-printing electrochemical Biosensors ultrapure water, unbonded adaptation is removed
Body, for screen printing electrode with gold for working electrode and auxiliary electrode, silver is reference electrode., in the K of 5mmol/L3[Fe(CN)]6,
K containing 5mmol/L3[Fe(CN)]6Electrolyte in carry out differential pulse voltammetry analysis, record aptamer sensor DPV figure and
Its peak point current Ipo.Electrochemical parameter is：Operating potential 300mV-700mV, it is 100mV/s, settling time 2s to sweep speed；
By the aptamers electrochemica biological sensor successively with a concentration of 0.1,0.5,1,5,10,50,100ng/ml totally 7
A cadmium ion titer is incubated, and reacts 30min at 25 DEG C, impregnates the cadmium that 5min removes non-specific adsorption with ultra-pure water after reaction
Ion, in the K of 5mmol/L3[Fe(CN)]6, K containing 5mmol/L3[Fe(CN)]6Electrolyte in carry out differentiated pulse volt-ampere point
Analysis, electrochemical parameter：Operating potential 300mV-700mV, it is 100mV/s, settling time 2s to sweep speed；.
DPV collection of illustrative plates corresponding under different concentration of cadmium ions and peak point current Ipn (n=1,2...7) are recorded, is calculated each
The peak current changing value △ Ipo of the relatively initial aptamer sensor of standard items are cross with the logarithm of each cadmium ion concentration of standard solution
Coordinate maps by ordinate of corresponding △ Ip, standard curve is established, as depicted in figs. 1 and 2, with concentration of cadmium ions
It is continuously increased, the peak point current Ip of response gradually increases, and in 0.1ng/ml-100ng/ml concentration ranges, △ Ip are with cadmium ion
The increase of concentration and increase, good linear relationship (R is presented in the logarithm of △ Ip and concentration of cadmium ions2=0.9776) ,-△ Ip=
13.533lgC (ng/ml)+24.276, detection are limited to 0.1ng/ml (S/N=3) (S/N=3).
Embodiment three：Actual sample detects
Aptamer sensor of the present invention is measured for actual sample and the rate of recovery detects, is selected in the present embodiment
Happy treasured pure water carries out mark-on reclaims detection as sample, is separately added into containing 1ng/ml, 5ng/ml, 10ng/ml, 50ng/ml cadmiums
Ion standard items carry out DPV analyses, the standard curve established by embodiment two, and the concentration for calculating corresponding a example is
The sample concentration of cadmium ion in happy treasured pure water.Measurement result is as shown in table 1, and sample recovery rate measured by electrochemical process exists
Between 85.3%-107.5%, the average sample rate of recovery is 97.9%.
Table 1：The measurement result of cadmium ion content in sample
| Sample number into spectrum | Additive amount (ng/ml) | Detected level (ng/ml) | The rate of recovery (%) | RSD (%) |
| 1 | 1 | 1.075 | 107.5 | 5.11 |
| 2 | 5 | 4.675 | 93.5 | 4.75 |
| 3 | 10 | 8.532 | 85.3 | 11.20 |
| 4 | 50 | 52.650 | 105.3 | 3.65 |
Example IV:The electrochemica biological sensor built based on different aptamers
It is suitable based on the cadmium ion nucleic acid that sequence is SEQ ID NO.1 by experimental verification in above-described embodiment 1 to 3
The effect of the electrochemistry detection actual sample of ligand structure.
In further experiment, in SEQ ID NO.1Z, core sequence GTGATGACCTGC, and other bases can be certainly
By arranging in pairs or groups, meet length 22-28 bases, table 2 is a series of aptamers and its experimental result designed in experiment：
Table 2：Cadmium ion aptamer
In upper table, SEQ ID NO.2 to 10 are the extreme sequences specially designed, are added at the both ends of sequence GTGATGACCTGC
Arbitrary continuation base in upper A, G, C, T base shows the SEQ of the detection sensitivity and Random Design of these sequences by experiment
ID NO.1's is suitable, it was demonstrated that with sequence GTGATGACCTGC is critical sequences, other bases can arbitrarily mix into cadmium ion core
Sour aptamers, sequence length meet 22-28 base.
Sequence table
<110>Ji'nan University
<120>Cadmium ion aptamer and screen printing electrode electrochemica biological sensor
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 26
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
ctttgtgcag tgatgacctg ctgccg 26
<210> 2
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
ctgtggagtg atgacctgct tgc 23
<210> 3
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
atgcttgcgt gatgacctgc atgca 25
<210> 4
<211> 28
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
ttgtaccgtt cgtgatgacc tgccgacg 28
<210> 5
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
gttcgtactg tgatgacctg ccg 23
<210> 6
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
aattcccgtg atgacctgcg gc 22
<210> 7
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
ggcttacggt gatgacctgc tgc 23
<210> 8
<211> 24
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
tcgatcgtga tgacctgctt tact 24
<210> 9
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
ttatgtgatg acctgcttcg at 22
<210> 10
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 10
agtcgtcagt gatgacctgc aatgc 25
Claims (8)
1. a kind of cadmium ion aptamer, it is characterised in that：The sequence length of the aptamers is 22-28 base, and is contained
There is nucleic acid sequence GTGATGACCTGC.
2. cadmium ion aptamer according to claim 1, it is characterised in that：The sequence of the aptamers such as SEQ ID
NO:Shown in 1-10.
3. cadmium ion aptamer according to claim 1, it is characterised in that：The aptamers are 5 ' terminal modified at it
The i.e. 5 '-SH- of sulfydryl (CH2)6-。
4. a kind of screen printing electrode electrochemica biological sensor, it is characterised in that：Contain in the electrochemica biological sensor
Just like the cadmium ion aptamer described in one of claims 1 to 3.
5. the preparation method of screen printing electrode electrochemica biological sensor as claimed in claim 4, which is characterized in that including
Following steps：
A. screen printing electrode pre-processes：Screen printing electrode, which immerses in the 0.5M concentrated sulfuric acids, to be scanned with cyclic voltammetry to stabilization,
For screen printing electrode with gold for working electrode and auxiliary electrode, silver is reference electrode；Arrange parameter：Scanning range：-0.3V-
1.3V, sweep speed 0.1V/s；
B. the aptamers modification of electrode after pre-processing：Cadmium ion aptamer described in claim 1 is synthesized, 1mol/L is added
NaCl is configured to the aptamers assembles concentration containing 5 μm of ol/L, and aptamers assembles concentration is added dropwise to the pretreated silk-screen printing electricity of step A
Pole working electrode surface assembles 20 hours at 4 DEG C of sealing, obtains the screen printing electrode electrochemica biological sensor.
6. application of the screen printing electrode electrochemica biological sensor according to claim 4 in terms of detecting cadmium ion.
7. a kind of method of the detection cadmium ion based on screen printing electrode electrochemica biological sensor, which is characterized in that including
Following steps：
A. cadmium ion standard solution is examined using screen printing electrode electrochemica biological sensor as claimed in claim 4
It surveys, establishes standard curve；
B. the solution that cadmium ion titer is configured to various concentration is added in sample, DPV analyses are carried out, by establishing standard curve
Calculate the concentration of corresponding cadmium ion, the as concentration of actual sample cadmium ion.
8. the method according to the description of claim 7 is characterized in that the step A includes the following steps：
By it is described be aptamers electrochemica biological sensor ultrapure water, unbonded aptamers are removed, then silk
Wire mark brush gold electrode is placed in the K of dense 5mmol/L3[Fe(CN)6], differential pulse volt is carried out in the electrolyte of the KCl containing 0.1mol/L
Peace method is analyzed, the DPV figures and peak point current Ipo of record aptamer sensor, electrochemical parameter：Operating potential 300mV-
700mV, it is 100mV/s to sweep speed；
The aptamers electrochemica biological sensor is sequentially placed into a concentration of：0.1,0.5,1,5,10,50, the cadmium of 100ng/ml from
In substandard solution, 30min is reacted at 25 DEG C, after reaction with ultra-pure water impregnate 5min remove non-specific adsorption cadmium from
Son：In the K of 5mmol/L3[Fe(CN)6], differential pulse voltammetry voltammetry DPV is carried out in the electrolyte of the KCl containing 0.1mol/L to be swept
It retouches.Electrochemical parameter：Operating potential 300mV-700mV, it is 100mV/s to sweep speed；
Corresponding DPV figures and its peak point current Ipn, wherein n=1,2...7 under each concentration of cadmium ion are recorded, each standard is calculated
Condition is to the peak current changing value △ Ip of initial aptamer sensor, and with the logarithm of each cadmium ion concentration of standard solution for horizontal seat
Mark, corresponding △ Ip map for ordinate, establish standard curve.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810022756.4A CN108387621B (en) | 2018-01-10 | 2018-01-10 | Cadmium ion aptamer and screen printing electrode electrochemica biological sensor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810022756.4A CN108387621B (en) | 2018-01-10 | 2018-01-10 | Cadmium ion aptamer and screen printing electrode electrochemica biological sensor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108387621A true CN108387621A (en) | 2018-08-10 |
| CN108387621B CN108387621B (en) | 2019-11-26 |
Family
ID=63076067
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810022756.4A Active CN108387621B (en) | 2018-01-10 | 2018-01-10 | Cadmium ion aptamer and screen printing electrode electrochemica biological sensor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108387621B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109536505A (en) * | 2018-12-07 | 2019-03-29 | 暨南大学 | The aptamer of podophyllotoxin and its application |
| CN110714011A (en) * | 2019-11-11 | 2020-01-21 | 暨南大学 | Lead ion aptamer, electrochemical sensor and preparation method |
| CN110967386A (en) * | 2019-12-19 | 2020-04-07 | 上海交通大学 | Cadmium ion electrochemical sensing method based on nucleic acid aptamer |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004094636A1 (en) * | 2003-04-24 | 2004-11-04 | Galapagos Genomics N.V. | Effective sirna knock-down constructs |
| WO2004045543A3 (en) * | 2002-11-14 | 2005-04-21 | Dharmacon Inc | Functional and hyperfunctional sirna |
| WO2004044123A9 (en) * | 2002-11-14 | 2010-06-10 | Rosetta Genomics Ltd. | Bioinformatically detectable group of novel regulatory genes and uses thereof |
| CN102010891A (en) * | 2009-09-07 | 2011-04-13 | 中国人民解放军军事医学科学院毒物药物研究所 | Gene chip used for researching action of Alzheimer disease-controlling medicament |
| WO2013012824A3 (en) * | 2011-07-15 | 2013-04-25 | The Johns Hopkins University | Trichoplusia ni piggybac transposases with reduced integration activity |
| CN103114075A (en) * | 2013-01-18 | 2013-05-22 | 内蒙古大学 | Cattle trophoderm stem cell system establishment method |
| CN105256378A (en) * | 2015-04-13 | 2016-01-20 | 卢彦平 | Gene chip for screening primary cilium-related disease causative gene |
| CN105548109A (en) * | 2015-12-22 | 2016-05-04 | 北京农业质量标准与检测技术研究中心 | A fluorescence detecting system for heavy metal cadmium and a fluorescence detecting method |
| CN107389942A (en) * | 2017-06-23 | 2017-11-24 | 江南大学 | A kind of heavy metal cadmium visible detection method based on nano gold mark |
-
2018
- 2018-01-10 CN CN201810022756.4A patent/CN108387621B/en active Active
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004045543A3 (en) * | 2002-11-14 | 2005-04-21 | Dharmacon Inc | Functional and hyperfunctional sirna |
| WO2004044123A9 (en) * | 2002-11-14 | 2010-06-10 | Rosetta Genomics Ltd. | Bioinformatically detectable group of novel regulatory genes and uses thereof |
| WO2004094636A1 (en) * | 2003-04-24 | 2004-11-04 | Galapagos Genomics N.V. | Effective sirna knock-down constructs |
| CN102010891A (en) * | 2009-09-07 | 2011-04-13 | 中国人民解放军军事医学科学院毒物药物研究所 | Gene chip used for researching action of Alzheimer disease-controlling medicament |
| WO2013012824A3 (en) * | 2011-07-15 | 2013-04-25 | The Johns Hopkins University | Trichoplusia ni piggybac transposases with reduced integration activity |
| CN103114075A (en) * | 2013-01-18 | 2013-05-22 | 内蒙古大学 | Cattle trophoderm stem cell system establishment method |
| CN105256378A (en) * | 2015-04-13 | 2016-01-20 | 卢彦平 | Gene chip for screening primary cilium-related disease causative gene |
| CN105548109A (en) * | 2015-12-22 | 2016-05-04 | 北京农业质量标准与检测技术研究中心 | A fluorescence detecting system for heavy metal cadmium and a fluorescence detecting method |
| CN107389942A (en) * | 2017-06-23 | 2017-11-24 | 江南大学 | A kind of heavy metal cadmium visible detection method based on nano gold mark |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109536505A (en) * | 2018-12-07 | 2019-03-29 | 暨南大学 | The aptamer of podophyllotoxin and its application |
| CN109536505B (en) * | 2018-12-07 | 2021-11-09 | 暨南大学 | Aptamer of podophyllotoxin and application thereof |
| CN110714011A (en) * | 2019-11-11 | 2020-01-21 | 暨南大学 | Lead ion aptamer, electrochemical sensor and preparation method |
| CN110714011B (en) * | 2019-11-11 | 2023-12-08 | 暨南大学 | Lead ion nucleic acid aptamer, electrochemical sensor and preparation method |
| CN110967386A (en) * | 2019-12-19 | 2020-04-07 | 上海交通大学 | Cadmium ion electrochemical sensing method based on nucleic acid aptamer |
| CN110967386B (en) * | 2019-12-19 | 2022-06-10 | 上海交通大学 | Cadmium ion electrochemical sensing method based on nucleic acid aptamer |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108387621B (en) | 2019-11-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Alahi et al. | Detection methods of nitrate in water: A review | |
| Liao et al. | Development of a new electrochemical sensor for determination of Hg (II) based on Bis (indolyl) methane/Mesoporous carbon nanofiber/Nafion/glassy carbon electrode | |
| CN108387621B (en) | Cadmium ion aptamer and screen printing electrode electrochemica biological sensor | |
| CN106525931B (en) | The detection method of copper ion concentration in a kind of solution | |
| CN104007155B (en) | A kind of for detecting electrochemical sensor of Trace Hg and its preparation method and application in water body | |
| Zhang et al. | High sensitive on-site cadmium sensor based on AuNPs amalgam modified screen-printed carbon electrodes | |
| CN112213368B (en) | Potential microelectrode sensor with universality and preparation and application thereof | |
| Zhou et al. | Sensitive impedimetric biosensor based on duplex-like DNA scaffolds and ordered mesoporous carbon nitride for silver (I) ion detection | |
| CN110714011A (en) | Lead ion aptamer, electrochemical sensor and preparation method | |
| Terbouche et al. | Effectiveness study of sensor based on modified cavity microelectrode by Algerian humic acid–polyaniline composites using square wave voltammetry | |
| CN104914143B (en) | A kind of molecular imprinting functionalization CdS/3DOM TiO in situ2The photoelectric analysis method of/BDD electrode pair BaPs | |
| CN105466989B (en) | The electrochemical detection method of lead in a kind of soy sauce | |
| CN112051312B (en) | Electrochemical sensing detection method for paraquat in food and modified electrode thereof | |
| CN105866211B (en) | A kind of preparation method and application of ampicillin molecular engram sensor | |
| CN104109676B (en) | The electrochemica biological sensor of versicolorin aptamers and correlation | |
| CN107121484A (en) | A kind of electrochemical method of Sensitive Detection glyphosate | |
| CN114324515B (en) | Electrochemical sensor for detecting glyphosate based on copper porphyrin metal organic framework modified carbon paper electrode | |
| CN110376267A (en) | A method of detection p-nitrophenol | |
| CN113552195B (en) | Detection method for detecting zearalenone by electrochemical ratio method | |
| Dimitropoulou et al. | Development of an electrochemical DNA biosensor for the detection of vitamin B12 (cyanocobalamin) at a carbon paste modified electrode with a manganese (II) complex | |
| Liu et al. | Rapid determination of rhodamine B in chilli powder by electrochemical sensor based on graphene oxide quantum dots | |
| CN109358150B (en) | Method for rapidly determining residual content of metalaxyl in tobacco | |
| Cruickshank et al. | Rare elements electrochemistry: The development of a novel electrochemical sensor for the rapid detection of europium in environmental samples using gold electrode modified with 2-pyridinol-1-oxide | |
| CN110308189A (en) | A kind of Screen-printed electrochemical biosensor and its application for mercury ion detecting | |
| CN105466987A (en) | Preparing method for protein molecular imprinting electrochemical sensor based on metal coordination |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220303 Address after: 510640 Room 101, building 22, No. 251, Kehua street, Tianhe District, Guangzhou, Guangdong (floors 1-5) Patentee after: Guangzhou Baibo Biotechnology Co.,Ltd. Address before: 510632 No. 601, Whampoa Avenue, Tianhe District, Guangdong, Guangzhou Patentee before: Jinan University |
|
| TR01 | Transfer of patent right |