CN108359726B - Application of CORO2B as molecular diagnosis and treatment marker - Google Patents

Application of CORO2B as molecular diagnosis and treatment marker Download PDF

Info

Publication number
CN108359726B
CN108359726B CN201810167669.8A CN201810167669A CN108359726B CN 108359726 B CN108359726 B CN 108359726B CN 201810167669 A CN201810167669 A CN 201810167669A CN 108359726 B CN108359726 B CN 108359726B
Authority
CN
China
Prior art keywords
coro2b
gene
rheumatoid arthritis
osteoarthritis
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201810167669.8A
Other languages
Chinese (zh)
Other versions
CN108359726A (en
Inventor
肖枫
李曙光
孙耀兰
常鹏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
GU'AN BOJIAN BIOTECHNOLOGY Co.,Ltd.
Original Assignee
Gu'an Bojian Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gu'an Bojian Biotechnology Co ltd filed Critical Gu'an Bojian Biotechnology Co ltd
Priority to CN201810167669.8A priority Critical patent/CN108359726B/en
Publication of CN108359726A publication Critical patent/CN108359726A/en
Application granted granted Critical
Publication of CN108359726B publication Critical patent/CN108359726B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/10Musculoskeletal or connective tissue disorders
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/10Musculoskeletal or connective tissue disorders
    • G01N2800/105Osteoarthritis, e.g. cartilage alteration, hypertrophy of bone

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Genetics & Genomics (AREA)
  • Pathology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Rheumatology (AREA)
  • Physics & Mathematics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Epidemiology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Pain & Pain Management (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)

Abstract

The invention discloses an application of CORO2B gene and its expression product in diagnosis and treatment of rheumatoid arthritis and/or osteoarthritis. Experiments prove that the CORO2B gene and the expression product thereof have differential expression in normal tissues and rheumatoid arthritis and/or osteoarthritis tissues, so that the CORO2B gene and the expression product thereof can be used as biomarkers for diagnosing rheumatoid arthritis and/or osteoarthritis. In addition, in vitro cell experiments prove that the CORO2B gene is over-expressed to inhibit cell proliferation, so that the medicine for treating rheumatoid arthritis and/or osteoarthritis can be developed.

Description

Application of CORO2B as molecular diagnosis and treatment marker
Technical Field
The invention relates to the field of biotechnology, in particular to application of CORO2B gene in diagnosis and treatment of rheumatoid arthritis and osteoarthritis.
Background
Rheumatoid arthritis is an autoimmune disease characterized by multiple joint involvement, with progressive joint destruction and deformity, often involving peripheral joints. Unclear etiology, and the involvement of extra-articular organs such as pulmonary interstitial disease and sicca syndrome are also common. Appropriate early treatment can improve joint symptoms and function, reduce mortality, and reduce complications.
A 2010 systematic review study found that the incidence of rheumatoid arthritis in north america and northern europe was estimated at 0.5% to 1.1%. The incidence in developing countries is relatively low (0.1% to 0.5%). Rheumatoid arthritis is more common in women (male and female incidence 1: 3). Onset can occur at any age, and a review cohort study calls a median onset age of 55.6 years; the number of newly diagnosed rheumatoid arthritis cases in the uk is about 20,000 per year. Therefore, each general practitioner can receive 1 new patient every 2 years.
Studies from the uk, europe and usa have all found that there is a delay in the diagnosis of rheumatoid arthritis by general practitioners. The 2009 report of the british national audition reported that before the diagnosis of rheumatoid arthritis was confirmed, patients had an average of 4 visits to their general practitioners, and 18% of patients had to visit 8 visits to confirm the diagnosis. In primary medicine, the diagnosis of early stage rheumatoid arthritis is as difficult as other skeletal muscle problems: clinical characteristic manifestations are not easily identified, inflammatory markers such as blood sedimentation and C-reactive protein have no characteristic significance, and specific marker negatives such as rheumatoid factor (serum negatives occur in 31% of patients) and anti-cyclic citrullinated peptide antibody (serum negatives occur in 33% of patients) have common serum negative manifestations.
Disability from rheumatoid arthritis can cause 28% of patients to lose work within a year. Treatment is initiated within a "window" of 3 months from onset of symptoms, which can slow disease progression. While delaying treatment increases the risk of imagewise joint destruction and death. Moreover, treatment is started after 3-6 months, so that single-drug treatment failure and drug resistance are more likely to occur.
Rheumatoid arthritis is a kind of rheumatoid arthritis in joint diseases, and some symptoms of joint swelling and pain can appear. However, many diseases are very similar to the symptoms of rheumatoid arthritis and are particularly misleading, such as osteoarthritis.
Osteoarthritis is a disease affecting human joints due to degenerative arthritis or hyperosteogeny, and is mainly caused by the fact that cartilage on the joint surface is damaged and bone tissue around the joint is proliferated due to long-term load bearing of the joints, and when osteoarthritis appears on fingers, the osteoarthritis can be misdiagnosed as rheumatoid arthritis.
Therefore, finding a method for effectively and differentially diagnosing rheumatoid arthritis and osteoarthritis in an early stage is an urgent problem to be solved, so as to avoid delaying the condition of the disease due to misdiagnosis and ensure that a patient is treated correctly.
In recent years, the study of markers for diagnosing rheumatoid arthritis or osteoarthritis at a molecular level is emerging, as in the following patent application nos.: 201310596649.X, 201580058686.2, 201380044584.6, 201310483384.2, 200610070393.9, 201510725004.0, 201510627048.X, 201510724747.6, 201510548635.X, 201510548624.1, 201510549564.5, 201510725755.2. There has not been any molecular marker for the differential diagnosis of rheumatoid arthritis and osteoarthritis, and the applicant has conducted the present study in such a context.
Disclosure of Invention
In order to solve the technical problems in the prior art, the invention aims to provide a molecular marker for early diagnosis of rheumatoid arthritis and/or osteoarthritis. The gene marker is used for distinguishing rheumatoid arthritis and osteoarthritis and has timeliness, specificity and sensitivity, so that a patient can be diagnosed in the early stage of the disease, and the cure rate is improved.
According to one aspect of the invention, the invention provides the use of a product for detecting the expression of the CORO2B gene in the preparation of a tool for diagnosing rheumatoid arthritis and/or osteoarthritis.
Further, the product for detecting the expression of the CORO2B gene comprises a product for detecting the mRNA level of the CORO2B gene and/or a product for detecting the protein level of CORO 2B.
Further, the product for detecting the expression of the CORO2B gene comprises: the expression level of the CORO2B gene and the expression product thereof is detected by RT-PCR, real-time quantitative PCR, immunodetection, in-situ hybridization or chip to diagnose the rheumatoid arthritis and/or osteoarthritis products.
Furthermore, the product for diagnosing rheumatoid arthritis and/or osteoarthritis by RT-PCR at least comprises a pair of primers for specifically amplifying CORO2B gene; the product for diagnosing rheumatoid arthritis and/or osteoarthritis by real-time quantitative PCR at least comprises a pair of primers for specifically amplifying CORO2B gene; the product for diagnosing rheumatoid arthritis and/or osteoarthritis by immunoassay comprises: an antibody that specifically binds to CORO2B protein; the product for diagnosing rheumatoid arthritis and/or osteoarthritis by in situ hybridization comprises: a probe that hybridizes to the nucleic acid sequence of the CORO2B gene; the product for diagnosing rheumatoid arthritis and/or osteoarthritis by using the chip comprises: protein chips and gene chips; wherein, the protein chip comprises an antibody which is specifically combined with CORO2B protein, and the gene chip comprises a probe which is hybridized with the nucleic acid sequence of CORO2B gene.
The product for diagnosing rheumatoid arthritis and/or osteoarthritis by real-time quantitative PCR at least comprises a pair of primers for specifically amplifying CORO2B gene, wherein the primers are shown as SEQ ID NO.1 and SEQ ID NO. 2.
The product for detecting CORO2B gene expression can be a reagent for detecting CORO2B gene expression, a kit, a chip, test paper and the like containing the reagent, and can also be a high-throughput sequencing platform using the reagent.
The tool for diagnosing rheumatoid arthritis and/or osteoarthritis includes but is not limited to a chip, a kit, a test strip, or a high-throughput sequencing platform; the high-throughput sequencing platform is a special tool for diagnosing rheumatoid arthritis and/or osteoarthritis, and the construction of a gene expression profile of a person becomes very convenient and fast work with the development of a high-throughput sequencing technology. By comparing the gene expression profiles of patients with diseases and normal people, the abnormality of which gene is related to the disease can be easily analyzed. Therefore, the application of CORO2B gene to the understanding that the abnormality of CORO2B gene is related to rheumatoid arthritis and/or osteoarthritis in high-throughput sequencing is also within the protection scope of the present invention.
The invention also provides a tool for diagnosing rheumatoid arthritis and/or osteoarthritis, which comprises a reagent for detecting CORO2B gene expression; the reagent comprises a primer and/or a probe for detecting CORO2B gene mRNA and an antibody for detecting CORO2B protein.
Such tools include, but are not limited to, chips, kits, test strips, or high throughput sequencing platforms.
Wherein, the chip comprises a gene chip and a protein chip; the gene chip comprises a solid phase carrier and oligonucleotide probes fixed on the solid phase carrier, wherein the oligonucleotide probes comprise oligonucleotide probes for detecting the transcription level of CORO2B gene and aiming at CORO2B gene; the protein chip comprises a solid phase carrier and a specific antibody of CORO2B protein fixed on the solid phase carrier; the gene chip can be used for detecting the expression levels of a plurality of genes including CORO2B gene (for example, a plurality of genes related to osteoarthritis and/or rheumatoid arthritis). The protein chip can be used for detecting the expression level of a plurality of proteins including CORO2B protein (such as a plurality of proteins related to osteoarthritis or rheumatoid arthritis). By simultaneously detecting a plurality of markers for distinguishing rheumatoid arthritis and osteoarthritis, the diagnosis accuracy of different types of arthritis can be greatly improved.
Wherein the kit comprises a gene detection kit and a protein immunodetection kit; the gene detection kit comprises a reagent for detecting the transcription level of CORO2B gene; the protein immunodetection kit comprises a specific antibody of CORO2B protein. Further, the reagents include reagents required in the process of detecting the expression level of the CORO2B gene by using RT-PCR, real-time quantitative PCR, immunodetection, in-situ hybridization or a chip method. Preferably, the reagents comprise primers and/or probes for the CORO2B gene. Primers and probes which can be used for detecting the expression level of the CORO2B gene can be easily designed according to the nucleotide sequence information of the CORO2B gene.
The test paper comprises a reagent for detecting CORO2B gene expression.
The high-throughput sequencing platform comprises a reagent for detecting CORO2B gene expression.
The probe that hybridizes to the nucleic acid sequence of the CORO2B gene may be DNA, RNA, a DNA-RNA chimera, PNA, or other derivatives. The length of the probe is not limited, and any length may be used as long as specific hybridization and specific binding to the target nucleotide sequence are achieved. The length of the probe may be as short as 25, 20, 15, 13 or 10 bases in length. Also, the length of the probe can be as long as 60, 80, 100, 150, 300 base pairs or more, even for the entire gene. Since different probe lengths have different effects on hybridization efficiency and signal specificity, the length of the probe is usually at least 14 base pairs, and at most, usually not more than 30 base pairs, and the length complementary to the nucleotide sequence of interest is optimally 15 to 25 base pairs. The probe self-complementary sequence is preferably less than 4 base pairs so as not to affect hybridization efficiency.
Further, the antibody specific to the CORO2B protein comprises a monoclonal antibody and a polyclonal antibody. Antibodies specific for the CORO2B protein include intact antibody molecules, any fragment or modification of an antibody (e.g., chimeric antibodies, scFv, Fab, F (ab') 2, Fv, etc., so long as the fragment retains the ability to bind to the CORO2B protein.
In a specific embodiment of the invention, the primer for detecting CORO2B gene mRNA comprises a primer pair shown as SEQ ID NO.1 and SEQ ID NO. 2.
The invention also provides application of the CORO2B gene and/or expression products thereof in preparing medicaments for treating rheumatoid arthritis and/or osteoarthritis.
Further, the drug comprises an accelerant of the CORO2B gene or an expression product thereof. The promoter comprises a component for promoting CORO2B gene expression, a component for promoting the stability of a CORO2B gene expression product and a component for promoting the activity of a CORO2B gene expression product.
Further, the component for promoting the expression of the CORO2B gene comprises a reagent for promoting gene transcription, a reagent for promoting gene translation and a reagent for promoting the content of CORO2B protein.
Specifically, the components for promoting the expression of CORO2B gene comprise: a reagent containing CORO2B gene, a reagent formed by a vector or a host cell carrying CORO2B gene, and a reagent containing CORO2B protein.
The promoter of the invention can be used for supplementing the deletion or deficiency of endogenous CORO2B protein and treating rheumatoid arthritis and/or osteoarthritis caused by the deficiency of CORO2B protein by improving the expression of CORO2B protein. On the other hand, the CORO2B protein can be used for promoting the activity or the function of CORO2B protein, thereby treating rheumatoid arthritis and/or osteoarthritis.
The gene-carrying vector of the present invention is a variety of vectors known in the art, such as commercially available vectors, including plasmids, cosmids, phages, viruses, and the like.
In the present invention, the term "host cell" includes prokaryotic cells and eukaryotic cells. Examples of commonly used prokaryotic host cells include E.coli, Bacillus subtilis, and the like. Commonly used eukaryotic host cells include yeast cells, insect cells, and mammalian cells. Preferably, the host cell is a eukaryotic cell, such as a CHO cell, a COS cell, or the like.
According to a further aspect of the present invention there is also provided a medicament for use in the treatment of rheumatoid arthritis and/or osteoarthritis, said medicament comprising an enhancer of the CORO2B gene and/or its expression products as described above.
Further, the pharmaceutical composition of the present invention further comprises a pharmaceutically acceptable carrier, such carriers include (but are not limited to): diluents, excipients such as water and the like, fillers such as starch, sucrose and the like; binders such as cellulose derivatives, alginates, gelatin, and polyvinylpyrrolidone; humectants such as glycerol; disintegrating agents such as agar, calcium carbonate and sodium bicarbonate; an absorption enhancer quaternary ammonium compound; surfactants such as cetyl alcohol; adsorption carriers such as kaolin and bentonite; lubricants such as talc, calcium and magnesium stearate, polyethylene glycol, and the like.
The mode of introducing the drug of the present invention into a tissue or cell can be classified into an in vitro mode or an in vivo mode. The in vitro method comprises introducing a drug containing CORO2B gene or a drug containing CORO2B protein into cells, and transplanting or returning the cells into the body. The in vivo mode involves the direct injection of a drug containing the CORO2B gene or a drug containing the CORO2B protein into the tissues of the body.
The medicine can also be combined with other medicines for treating rheumatoid arthritis or osteoarthritis, and the combination of a plurality of medicines can greatly improve the success rate of treatment.
In the context of the present invention, the "CORO 2B gene" includes polynucleotides of the CORO2B gene as well as any functional equivalents of the CORO2B gene. The CORO2B gene (Chromosome 15, NC _000015.10(68518373..68727806)) can be queried for related sequences in the International public nucleic acid sequence database GeneBank.
In the context of the present invention, the expression product of the CORO2B gene includes mRNA for CORO2B, and CORO2B protein. The CORO2B protein comprises a CORO2B whole protein or a partial peptide thereof. The partial peptide contains a functional domain associated with rheumatoid arthritis or osteoarthritis.
"CORO 2B protein" includes CORO2B protein as well as any functional equivalent of CORO2B protein. The functional equivalents comprise a conservative variant protein of CORO2B protein, or an active fragment or an active derivative thereof, an allelic variant, a natural mutant, an induced mutant, a protein encoded by DNA capable of hybridizing with DNA of CORO2B under high or low stringency conditions.
In general, it is known that modification of one or more amino acids in a protein does not affect the function of the protein. One skilled in the art will recognize that individual amino acid changes or small percentage amino acids or individual additions, deletions, insertions, substitutions to an amino acid sequence are conservative modifications, wherein a change in a protein results in a protein with a similar function. Conservative substitution tables providing functionally similar amino acids are well known in the art.
An example of a protein modified by the addition of an amino acid or amino acid residues is a fusion protein of the CORO2B protein. There is no limitation on the peptide or protein fused to the CORO2B protein, as long as the resulting fusion protein retains the biological activity of the CORO2B protein.
In the context of the present invention, "diagnosing rheumatoid arthritis and/or osteoarthritis" includes both determining whether a subject has suffered from rheumatoid arthritis or osteoarthritis and determining whether a subject is at risk of suffering from rheumatoid arthritis or osteoarthritis.
In the context of the present invention, "treatment" is to be divided from the change in the state of a disease and may include alleviation of the disease, complete cure of the disease, and prevention of the disease.
The invention has the advantages and beneficial effects that:
the invention discovers that the CORO2B gene expression is related to rheumatoid arthritis or osteoarthritis for the first time, and whether the subject has the rheumatoid arthritis or osteoarthritis or whether the subject is at risk of having the rheumatoid arthritis or osteoarthritis can be judged by detecting the expression of CORO2B in synovial tissue of the subject, so that a clinician is guided to provide a prevention scheme or a treatment scheme for the subject.
The invention discloses a molecular marker which can diagnose both rheumatoid arthritis and osteoarthritis, and the molecular marker can distinguish normal people from arthritis patients and can also effectively distinguish rheumatoid arthritis patients from osteoarthritis patients.
The invention discloses a medicament for treating rheumatoid arthritis and osteoarthritis. One medicine has multiple purposes, enlarges the medicine indications and reduces the economic burden.
Drawings
FIG. 1 shows a statistical chart of the detection of the differential expression of CORO2B gene at the transcriptional level using QPCR;
FIG. 2 shows a statistical chart of the differential expression of CORO2B gene measured at protein level using Western blot;
FIG. 3 shows a statistical graph of the detection of the overexpression of CORO2B gene at the transcriptional level using QPCR; wherein, A: osteoarthritic fibroblast-like synoviocytes; b: rheumatoid arthritis fibroblast-like synoviocytes;
FIG. 4 shows a statistical graph of the detection of the overexpression of CORO2B protein at the protein level using Western blot; a: osteoarthritic fibroblast-like synoviocytes; b: rheumatoid arthritis fibroblast-like synoviocytes.
Detailed Description
The present invention will be described in further detail with reference to the accompanying drawings and examples. The following examples are intended to illustrate the invention only and are not intended to limit the scope of the invention. Experimental procedures without specific conditions noted in the examples, generally following conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the laboratory Manual (New York: Cold Spring harbor laboratory Press,1989), or according to the manufacturer's recommendations.
Example 1 screening of differentially expressed genes in osteoarthritic synovial tissue, rheumatoid arthritic synovial tissue and normal synovial tissue
Synovial tissue of 5 rheumatoid arthritis patients were from rheumatoid arthritis patients in hospital orthopaedics knee replacement or synovectomy, and diagnosis of all cases met the classification standard of rheumatoid arthritis revised by the american college of rheumatology in 1987, of which 3 women, 2 men, mean age (55 ± 8) years, and mean course (12 ± 7) years. The synovial tissue of 5 osteoarthritic patients was obtained from osteoarthritic patients with orthopaedic knee replacement or synovectomy in hospitals, and the cases used met the diagnostic criteria for OA proposed by Altam, of which 2 women, 3 men, mean age (63 ± 5) years, and mean course (12 ± 8) years. 6 cases of normal synovial tissue were obtained from synovial tissue of joints of patients with trauma surgery. Clinical samples used in this study were informed and passed through the ethical committee of the hospital.
1. Tissue RNA extraction (using the Norgen RNA extraction kit)
1) Weighing about 20mg of in vitro synovial tissue sample in a clean area with less RNase interference by using a mortar containing a proper amount of liquid nitrogen, and grinding the sample into powder by using a pestle;
2) transferring the sample to a 2mL centrifuge tube without RNase;
3) adding 300 μ L lysine solution, placing in homogenizer, and grinding for 1-5 min;
4)12000g, centrifuging for 10min at 4 ℃, transferring supernatant into a new centrifuge tube with the volume of 1.5 mL;
5) adding 600 μ l RNase-Free Water, and mixing with a vortex machine;
6) adding 20 μ l protease K, bathing at 55 deg.C for 15min, and mixing with vortex;
7)14000g, centrifuging for 1min at room temperature to precipitate cell debris at the bottom of the centrifuge tube, taking supernatant and transferring the supernatant into another centrifuge tube without 1.5mL of RNase;
8) adding 450 μ l of 95% ethanol, and mixing by vortex;
RNA adsorption:
9) adding 650 μ l of lysate containing ethanol into a centrifugal column, and centrifuging for 1min at 14000 g;
10) abandoning the lower layer, and resetting the collecting pipe on the column;
11) repeating the steps from 9) to 10) according to the volume of the lysate;
12) adding 400 μ l Wash solution, 14000g, and centrifuging for 2 min;
13) abandoning the lower layer, and placing the column on a new collecting pipe;
and (3) DNase treatment:
14) adding 100 ul of Enzyme incorporation Buffer and 15 ul of DNase I, and centrifuging at 14000g for 1 min;
15) moving the solution in the collecting pipe into the column again;
16) standing at room temperature for 15 min;
RNA washing:
17) adding 400 μ l Wash solution, centrifuging at 14000g for 1min, discarding the lower layer, and placing the collection tube on the column;
18) adding 400 μ l Wash solution, centrifuging at 14000g for 2min, and discarding the collecting tube;
RNA elution:
19) the column was placed in a 1.7mL Elution tube;
20) add 30. mu.l of Elution Buffer;
21) centrifuge at 200g for 2min to allow the solution to bind well to the column, and then centrifuge at 14000g for 1 min.
2. Mass analysis of RNA samples
The concentration and purity of the RNA were determined by Nanodrop2000, RNA integrity by agarose gel electrophoresis and RIN by Agilent 2100. The total amount of RNA required for single library construction is 5 mug, the concentration is more than or equal to 200 ng/mug, and the OD260/280 is between 1.8 and 2.2.
3. Fragmented RNA
The Illumina platform is used for sequencing short sequence fragments, and the average length of mRNA can reach several kb, so random interruption is needed. The RNA can be randomly fragmented into small fragments of about 200bp by using metal ions.
4. Reverse Synthesis of cDNA
When double-strand synthesis is performed by reverse-transcribing a single-strand cDNA using mRNA as a template with a random primer by reverse transcriptase, dUTP is used instead of dTTP in dNTPs reagents so that the base in the second strand of the cDNA contains A/U/C/G.
5. Connection adapter
The double-stranded cDNA structure is sticky-ended, and is made blunt-ended by adding End Repair Mix, followed by an A base at the 3' End for ligation to a Y-shaped adaptor.
6. UNG enzyme digestion of cDNA double strand
Before PCR amplification, the second strand of cDNA was digested with UNG enzyme, so that only the first strand of cDNA was contained in the library.
7. On-machine sequencing of Illumina x-ten
Illumina x-ten sequencing platform, 2 × 150bp sequencing was performed.
8. Bioinformatics analysis
The procedure of analysis of raw data after obtaining sequencing data is as follows:
(1) carrying out trim on 5 'and 3' sections of reads by using cutadapt, wherein bases with the mass of less than 20 are removed from trim, and more than 10% of reads with N are deleted;
(2) tophat aligns to the reference genome. The reference genome version used was grch38.p7, fasta and gff files downloaded from NCBI;
(3) quantifying the expression quantity of mRNA by cuffquant and outputting the mRNA in a standardized way;
(4) the expression difference of mRNA of the control group and the disease group is compared by using a DEGseq package under the R environment. Significantly different mRNA screening conditions: p-value < 0.05.
9. Results
A total of 367 genes whose expression was different between normal persons and osteoarthritis patients, between normal persons and rheumatoid arthritis patients, and between rheumatoid arthritis patients and osteoarthritis patients were screened using the above criteria.
Example 2 Large sample validation of differentially expressed genes
Based on the results of previous high-throughput sequencing, we selected the CORO2B gene for validation based on the size of P value, which was down-regulated in both rheumatoid arthritis and osteoarthritis patients and was more down-regulated in rheumatoid arthritis patients than in osteoarticular patients.
First, detecting the differential expression of CORO2B gene at the transcriptional level
1. 100 rheumatoid arthritis synovial tissues, 100 cases of osteoarthritis synovial tissues, and 100 cases of normal synovial tissues were collected in the same manner as in example 1.
2. RNA extraction and quality testing was performed as described in the examples
3. Reverse transcription
Mu.g of total RNA was reverse transcribed with reverse transcription buffer to synthesize cDNA. A25-mu-l reaction system is adopted, 1 mu g of total RNA is taken from each sample as template RNA, and the following components are respectively added into a PCR tube: DEPC water, 5 Xreverse transcription buffer, 10mmol/L dNTP, 0.1mmol/L DTT, 30. mu. mmol/L Oligo dT, 200U/. mu. L M-MLV, template RNA. Incubate at 42 ℃ for 1h, 72 ℃ for 10min, and centrifuge briefly.
4. QPCR amplification assay
A25. mu.l reaction system was used, with 3 parallel channels per sample, and all amplification reactions were repeated three more times to ensure the reliability of the results. The following reaction system was prepared: SYBR Green polymerase chain reaction system 12.5. mu.l, forward primer (5. mu.M/. mu.l) 1. mu.l, reverse primer (5. mu.M/. mu.l) 1. mu.l, template cDNA 2.0. mu.l, 8.5. mu.l without enzyme water; amplifying a forward sequence 5'-CGTGCTGATGTCTTTGAAA-3' (SEQ ID NO.1) and a reverse sequence 5'-TGACCACAACACTCTTCTT-3' (SEQ ID NO.2) of the CORO2B gene; the housekeeping gene is preferably GAPDH, and the forward primer sequence for amplifying the housekeeping gene is 5'-ATGTTCCAATATGATTCCA-3' (SEQ ID NO.3), and the reverse primer sequence is 5'-GATTTCCATTGATGACAAG-3' (SEQ ID NO. 4). All operations were performed on ice. The amplification procedure was: 95 ℃ for 5min, (95 ℃ 10s, 60 ℃ 60s) 42 cycles. SYBR Green is used as a fluorescent marker, PCR reaction is carried out on a Light Cycler fluorescent real-time quantitative PCR instrument, a target band is determined through melting curve analysis and electrophoresis, relative quantification is carried out by a delta CT method, and the result is shown in figure 1, compared with normal synovial tissue, the mRNA level of CORO2B gene in osteoarthritis synovial tissue is obviously reduced; the mRNA level of the cor 2B gene was significantly down-regulated in rheumatoid arthritis synovial tissue compared to osteoarthritis synovial tissue, with statistical significance for the difference (. about.p < 0.05). The upper bound of 95% confidence interval of normal synovial tissue mean was used as cut-off value of diagnostic experiment, under which the sensitivity of diagnosing normal and osteoarthritis with CORO2B was 95%, the specificity was 82%, and the results are shown in Table 1; the sensitivity of normal persons and rheumatoid arthritis patients diagnosed with CORO2B was 93% and the specificity was 84%, and the results are shown in Table 2. The upper bound of the 95% confidence interval of the mean value of osteoarthritic synovial tissue was used as cut-off value in the diagnostic test, under which the sensitivity of osteoarthritis and rheumatoid arthritis was 93% and the specificity was 84% using CORO2B, and the results are shown in Table 3.
TABLE 1 differentiation of Normal persons from osteoarthritis patients
Figure BDA0001584930100000111
Figure BDA0001584930100000121
TABLE 2 differentiation of Normal persons from rheumatoid arthritis patients
Figure BDA0001584930100000122
TABLE 3 osteoarthritis patients are distinguished from rheumatoid arthritis patients
Figure BDA0001584930100000123
Secondly, detecting the differential expression of CORO2B gene at protein level
1. Tissue protein extraction
(1) Weighing 50mg of tissue, and fully grinding the tissue by using liquid nitrogen;
(2) adding 500 mul of mixed working solution (RIPA lysate: PMSF 100:1) into each sample, and fully shaking;
(3) centrifuging at 13000rpm/min for 10min, and subpackaging the supernatant at-80 deg.C for storage.
2. Western blot detection
And (3) carrying out SDS-PAGE electrophoresis on the extracted protein quantitatively, and then carrying out membrane transfer, sealing, primary antibody incubation, secondary antibody incubation and color development.
3. Statistical treatment
The grey scale value of the protein band is analyzed by using Image J software, and the grey scale value of the CORO2B protein band is normalized by taking beta-actin as an internal reference. The results were expressed as mean ± sd, statistically analyzed using SPSS13.0 statistical software, and the difference between the two was considered statistically significant when P <0.05 using the t-test.
4. Results
The results are shown in fig. 2, where the osteoarthritic synovial tissue has a significantly reduced content of cor 2B protein compared to normal synovial tissue; compared with osteoarthritic synovial tissue, the rheumatoid arthritis synovial tissue has significantly reduced CORO2B protein, and the difference has statistical significance (P < 0.05).
Example 3 construction of CORO2B Gene expression plasmid
1. Construction of CORO2B Gene expression vector
And designing an amplification primer according to the coding sequence (shown as SEQ ID NO. 5) of the CORO2B gene. The coding sequence of the full-length CORO2B gene was amplified from a cDNA library of adult fetal brain (Clontech, cat # 638831), which was digested simultaneously with restriction enzymes BamHI and XhoI, inserted into the eukaryotic cell expression vector pcDNA3.1 digested simultaneously with restriction enzymes BamHI and XhoI, and the resulting recombinant vector pcDNA3.1-CORO2B was ligated for subsequent experiments.
2. Synovial tissue cell in vitro culture
Washing aseptically obtained synovium tissue of rheumatoid arthritis and osteoarthritis with PBS, repeatedly shearing with aseptic surgical scissors to obtain tissue blocks of about 1mm x 1mm x 1mm, adding collagenase II (0.5mg/ml) at 37 deg.C, digesting for 2 hr, filtering with 200 mesh gauze, centrifuging to remove supernatant, resuspending cells in DMEM culture solution, standing at 37 deg.C and 5% CO2Culturing in a cell culture box. When the cells grew into spindle-shaped and flaked, subculture was performed. After the cells are transmitted to 3 rd generation, FITC labeled mouse anti-human CD3, CD14, CD19 and PE labeled mouse anti-human CD11b are added for labeling, and flow cytometry detection and identification are carried out. The cells that were negative for all 4 markers described above were Fibroblast-like Synoviocytes (FLS) used in this study.
3. Transfection
The prepared fibroblast-like synoviocytes were divided into two groups, namely a control group (transfected pcDNA3.1 empty vector) and a CORO2B overexpression group (transfected pcDNA3.1-CORO 2B). Transfection of the vector was performed using liposome 2000, and the specific transfection method was performed as indicated in the specification. The working concentrations of pcDNA3.1 empty vector and pcDNA3.1-CORO2B were 0.5. mu.g/ml.
4. QPCR detection
4.1 extraction of cellular Total RNA Using conventional methods.
4.2 reverse transcription and QPCR procedures were the same as in example 2.
4.3 results
As shown in FIG. 3, the mRNA level of CORO2B was significantly up-regulated in the pcDNA3.1-CORO 2B-transfected cells compared to the pcDNA3.1 empty vector-transfected cells, the difference being statistically significant (P <0.05)
5. Western detection
5.1 extraction of Total cellular protein
And (3) extracting the total protein of the cells by taking the fibroblast-like synoviocytes with good log-phase growth, and extracting the protein according to the instruction of an EpiQuik whole-cell extraction kit.
5.2Western blot detection
The procedure is as in example 2.
5.3 results
As shown in FIG. 4, the protein level of CORO2B was significantly up-regulated in the cells transfected with pcDNA3.1-CORO2B compared to the cells transfected with the empty vector of pcDNA3.1, with a statistical significance of the difference (P < 0.05).
Example 4 Effect of CORO2B Gene overexpression on fibroblast-like synovial cell proliferation
1. Step (ii) of
At 2 × 105The cells were inoculated in 96-well cell culture plates at a density of one ml, and after the cells were attached to the walls, cell transfection was performed according to the method of example 3, each experimental group was designed to have three wells, each 100. mu.l, placed at 37 ℃ in 5% CO2After 48h of transfection, 10. mu.l of CK-8 solution was added to each well of the wells to be tested, and the cells were incubated in the incubator for 1h to measure the absorbance (OD) of each well at 450 nm.
2. Statistical method
The experiments were performed in 3 replicates, the data were expressed as mean ± sd, and the statistical analysis was performed using SPSS13.0 statistical software, and the difference between the cor 2B gene overexpression group and the control group was considered statistically significant when P <0.05 using t-test.
3. Results
The results are shown in tables 4 and 5, where the proliferation of the pcDNA3.1-CORO2B transfected cells was significantly slower than that of the cells transfected with the empty pcDNA3.1 vector, the difference being statistically significant (P < 0.05).
TABLE 4 determination of OD values for osteoarthritis fibroblast-like synoviocytes
Experimental group OD value (optical Density)
pcDNA3.1 0.1574±0.005
pcDNA3.1-CORO2B 0.08434±0.003
TABLE 5 determination of OD values of synovial cells of rheumatoid arthritis
Experimental group OD value (optical Density)
pcDNA3.1 0.1586±0.004
pcDNA3.1-CORO2B 0.08625±0.001
The above description of the embodiments is only intended to illustrate the method of the invention and its core idea. It should be noted that, for those skilled in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall into the protection scope of the claims of the present invention.
Sequence listing
<110> Beijing, the deep biometric information technology GmbH
<120> CORO2B application as molecular diagnosis and treatment marker
<160>5
<170>SIPOSequenceListing 1.0
<210>1
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
cgtgctgatg tctttgaaa 19
<210>2
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
tgaccacaac actcttctt 19
<210>3
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
atgttccaat atgattcca 19
<210>4
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
gatttccatt gatgacaag 19
<210>5
<211>1428
<212>DNA
<213> human source (Homo sapiens)
<400>5
atgtcctggc gtccgcaata ccgtagctcc aagttccgga atgtctacgg gaaggtggcc 60
aaccgggagc actgcttcga tgggatcccc atcaccaaga atgtgcacga caaccacttc 120
tgtgccgtca acacccgctt cctggccatc gtcaccgaga gcgcaggggg cggctccttc 180
ctcgtcatcc ccctggagca gacaggcagg attgaaccca actaccccaa ggtctgcggc 240
caccagggca atgtgctgga tatcaaatgg aaccccttca tcgacaacat cattgcctcg 300
tgctcggagg acacgtcggt gcggatctgg gagatccccg agggcgggct gaagcggaac 360
atgacggagg cgctcctgga gctgcacggg cacagccggc gtgtggggct ggtcgagtgg 420
caccccacca ccaacaacat cctgttcagc gctggctacg actacaaggt cctcatctgg 480
aacctggatg tgggtgagcc ggtgaagatg attgactgcc acacggatgt gatcctctgc 540
atgtccttca acacggacgg cagcctgctc accaccacgt gcaaggacaa gaagctgcgt 600
gtgattgagc cccgctctgg ccgtgttctg caggaggcca actgcaaaaa ccacagagtg 660
aaccgggtgg tgttcctggg gaacatgaag cggctcctca cgacaggggt ctccaggtgg 720
aacacaagac agattgccct ctgggaccag gaggacctct ccatgcccct gatcgaagag 780
gaaattgatg ggctctctgg cctcctgttc cccttctatg atgctgacac ccacatgctc 840
tacctggctg gaaagggtga tggaaacatc cggtactacg agatcagcac tgagaagccc 900
tacctgagtt acctcatgga gttccgctcc ccagccccgc agaaaggcct aggggtcatg 960
cccaagcacg ggctggatgt gtcagcctgc gaggtgttccgcttctacaa gctggtgact 1020
ctcaagggcc tgatcgagcc catctccatg atcgtgcccc ggaggtcaga ttcctaccag 1080
gaagacattt acccaatgac accaggcacg gagccagcac tgaccccgga tgaatggctg 1140
ggaggcatca accgagatcc cgtgctgatg tctttgaaag aaggctataa gaagtcctca 1200
aaaatggtat ttaaggctcc catcaaagaa aagaagagtg ttgtggtcaa cggaatagat 1260
ttattagaaa atgtcccacc caggacagag aatgagctcc ttcgaatgtt cttccggcag 1320
caggatgaga ttcgacggtt gaaagaggag ctggcccaga aggacatccg cattcggcag 1380
ctccagctgg aactgaaaaa cttgcgcaac agccccaaga actgttag 1428

Claims (6)

1. The product for detecting the CORO2B gene expression level is applied to the preparation of tools for distinguishing normal people from osteoarthritis and/or rheumatoid arthritis.
2. Use according to claim 1, characterized in that the product comprises: products of normal people and osteoarthritis and/or rheumatoid arthritis are distinguished by RT-PCR, real-time quantitative PCR, immunodetection, in-situ hybridization, chip or high-throughput sequencing platform detection CORO2B gene expression.
3. The use according to claim 2, characterized in that said product comprises at least one pair of primers specifically amplifying the CORO2B gene, an antibody specifically binding to the CORO2B protein, or a probe hybridizing to the nucleic acid sequence of the CORO2B gene.
4. The use according to claim 3, wherein the primer sequences are shown as SEQ ID No.1 and SEQ ID No. 2.
5. The application of a reagent for promoting CORO2B gene expression in preparing a medicament for treating osteoarthritis and/or rheumatoid arthritis; characterized in that the reagent is a CORO2B gene overexpression vector or a host cell containing the overexpression vector.
Application of CORO2B protein in preparing medicine for treating osteoarthritis and/or rheumatoid arthritis.
CN201810167669.8A 2018-02-28 2018-02-28 Application of CORO2B as molecular diagnosis and treatment marker Active CN108359726B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810167669.8A CN108359726B (en) 2018-02-28 2018-02-28 Application of CORO2B as molecular diagnosis and treatment marker

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810167669.8A CN108359726B (en) 2018-02-28 2018-02-28 Application of CORO2B as molecular diagnosis and treatment marker

Publications (2)

Publication Number Publication Date
CN108359726A CN108359726A (en) 2018-08-03
CN108359726B true CN108359726B (en) 2020-09-04

Family

ID=63002791

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810167669.8A Active CN108359726B (en) 2018-02-28 2018-02-28 Application of CORO2B as molecular diagnosis and treatment marker

Country Status (1)

Country Link
CN (1) CN108359726B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116990520A (en) * 2022-04-25 2023-11-03 中国科学院深圳先进技术研究院 Protein rod-shaped body marker and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010088432A (en) * 2008-09-09 2010-04-22 Kansetsu Saisei Kenkyusho:Kk Polymorphism relating to effectiveness-side effect expression by tnf inhibitor therapy and use thereof
CN102597268A (en) * 2009-09-03 2012-07-18 弗·哈夫曼-拉罗切有限公司 Methods for treating, diagnosing, and monitoring rheumatoid arthritis

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9752191B2 (en) * 2009-07-09 2017-09-05 The Scripps Research Institute Gene expression profiles associated with chronic allograft nephropathy

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010088432A (en) * 2008-09-09 2010-04-22 Kansetsu Saisei Kenkyusho:Kk Polymorphism relating to effectiveness-side effect expression by tnf inhibitor therapy and use thereof
CN102597268A (en) * 2009-09-03 2012-07-18 弗·哈夫曼-拉罗切有限公司 Methods for treating, diagnosing, and monitoring rheumatoid arthritis

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
The WD40-domain containing protein CORO2B is specifcally enriched in glomerular podocytes and regulates the ventral actin cytoskeleton;M.Rogg等;《SCIENTIFIC Reports》;20171121;第11页倒数第4段 *
Variation at the ANP32A Gene Is Associated With Risk of Hip Osteoarthritis in Women;Ana M.Valdes等;《ARTHRITIS & RHEUMATISM》;20090731;第60卷(第7期);2046-2054 *

Also Published As

Publication number Publication date
CN108359726A (en) 2018-08-03

Similar Documents

Publication Publication Date Title
KR20170120124A (en) Biomarker panel for cancer detection
CN108642167B (en) BAIAP2 as a target for diagnosis and treatment of rheumatoid arthritis and/or osteoarthritis
CN108103186B (en) Molecular markers for diagnosis of rheumatoid arthritis and osteoarthritis
CN108384846B (en) Application of C11orf95 gene and expression product thereof in diagnosis and treatment of rheumatoid arthritis and osteoarthritis
CN108611409B (en) Biomarker for diagnosis and treatment of rheumatoid arthritis and osteoarthritis
JP2006507845A (en) LMNA gene and its involvement in Hutchinson-Gilford Progeria Syndrome (HGPS) and arteriosclerosis
CN108359726B (en) Application of CORO2B as molecular diagnosis and treatment marker
CN108559772B (en) MARCH1 gene as diagnosis and treatment marker for rheumatoid arthritis and osteoarthritis
CN111378668B (en) Non-coding RNA as diagnosis and treatment marker of osteoporosis
CN105296623A (en) Molecular marker for diagnosis of osteoarthritis
Christiano et al. Compound heterozygosity for nonsense and missense mutations in the LAMB3 gene in nonlethal junctional epidermolysis bullosa
US20040029192A1 (en) Compositions and methods for the diagnosis and treatment of kidney disease
CN108486245B (en) WFS1 as a novel molecular marker
CN108642168B (en) Diagnosis and treatment of rheumatoid arthritis and osteoarthritis based on SPAST gene
CN107164507A (en) The diagnostic tool of postmenopausal women&#39;s primary osteoporosis
CN110577994B (en) Product for non-invasive diagnosis of male osteoporosis
CN110577995B (en) Diagnostic marker for male osteoporosis
Thorson et al. Identification of SYT-SSX transcripts from synovial sarcomas using RT-multiplex PCR and capillary electrophoresis
KR20210134551A (en) Biomarkers for predicting the recurrence possibility and survival prognosis of papillary renal cell carcinoma and uses thereof
JP6128654B2 (en) Use of myelin basic protein as a novel genetic factor in rheumatoid arthritis
JP2006526986A (en) Diagnosis method for inflammatory bowel disease
JP2003204790A (en) Disease-sensitive gene of chronic rheumatoid arthritis and use thereof
WO2007043531A1 (en) Genetic marker for use in diagnosis of sensitivity to anti-tumor agent or concurrent chemoradiation therapy, and use thereof
CN111378667B (en) LOC105376287 as diagnosis and treatment molecule for osteoporosis
JP2002521062A (en) Genetic polymorphisms in the human neurokinin 1 receptor gene and their use in diagnosis and treatment of disease

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB02 Change of applicant information

Address after: Room 1210, Building 3, Ronghua Xintai Building, 10 Ronghua South Road, Yizhuang Economic and Technological Development Zone, Daxing District, Beijing

Applicant after: Beijing Yang Shen biology information technology company limited

Address before: 100080 Beijing city Haidian District Shanyuan Street No. 1 cubic court building room 3103

Applicant before: Beijing Yang Shen biology information technology company limited

CB02 Change of applicant information
TA01 Transfer of patent application right

Effective date of registration: 20200813

Address after: 065500 Gu'an Bojian Biotechnology Co., Ltd., Gu'an emerging industry demonstration zone, Langfang City, Hebei Province

Applicant after: GU'AN BOJIAN BIOTECHNOLOGY Co.,Ltd.

Address before: Room 1210, Building 3, Ronghua Xintai Building, 10 Ronghua South Road, Yizhuang Economic and Technological Development Zone, Daxing District, Beijing

Applicant before: BEIJING MEDINTELL BIOMED INFORMATION TECHNOLOGY Co.,Ltd.

TA01 Transfer of patent application right
GR01 Patent grant
GR01 Patent grant