CN108359672A - A kind of method of quick clone mustard type rape seed coat gene TT2CDS sequences - Google Patents
A kind of method of quick clone mustard type rape seed coat gene TT2CDS sequences Download PDFInfo
- Publication number
- CN108359672A CN108359672A CN201711360127.4A CN201711360127A CN108359672A CN 108359672 A CN108359672 A CN 108359672A CN 201711360127 A CN201711360127 A CN 201711360127A CN 108359672 A CN108359672 A CN 108359672A
- Authority
- CN
- China
- Prior art keywords
- ttg1
- gene
- liquid
- clone
- rape
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of methods that TT2 gene C DS sequences are extracted in substitution from canola seed coat, because the relatively low CDS sequences of mRNA expression of TT2 genes can not clone in blade, kind skin materials are inconvenient.TTG1 transcription factors can promote TT2 gene expressions, by being overexpressed TTG1, improve TT2 expressions, can facilitate the clone of TT2 gene Cs DS.First in rape TTG1 genetic transformation to Agrobacterium rhizogenesA4, again Leaf Stems from Brassica juncea is infected with the liquid that infects of conversion, it is co-cultured again, squamous subculture and amplification cultivation obtain the hairy root of transgenosis, the transgenic hairy root that 1g is fresh is taken, carries out RNA extractions, reverse transcription, then carry out PCR reactions, Escherichia coli conversion is carried out, company is sent to be sequenced.TT2 genes can be cloned, to achieve the purpose that quick clone control rape seed skin color gene TT2CDS.
Description
Technical field
The present invention relates to agriculture Applied Biotechnology fields, more particularly to a kind of quick clone mustard type rape kind scytoblastema
Because of the method for TT2.
Background technology
Studies have shown that in many document reports, yellow seed coat rape (abbreviation yellow seed rape) is (black with Black seed coat rape
Seed rape) compared to have the advantages that kind of a thin skin, oil content it is high, it is oily in pigment and impurity are few, content of lignin is low etc..But it is traditional
Method is that immature extraction in skin of planting controls the key transcription factor TT2 that kernel seed coat colour is formed.Rape seed skin color at
It is difficult to be used further to the extraction of gene after ripe, either black seed or yellow seed, embryo is all yellow after seed maturity.The face of seed
Color is determined by kernel seed coat colour, and the kind skin of black seed rape is black；The kind skin of yellow seed rape is transparent, the seed of yellow seed rape
Show the yellow of embryo.And TT2 genes Abundances are bigger in kind of skin and Abundances are smaller in blade, it is either yellow
Seed or black seed all must carry out gene cloning, by the restriction in season and the factor ratio of seed development in kind of a skin mesoderm growing early stage
It is larger, it cannot need to select kernel seed coat colour character in seed prematurity, in this way to TT2 genes into accommodating clone
In the presence of by season, times during seed development, peel off the problems such as kind of skin is difficult.Therefore, a kind of quick clone mustard type rape kind scytoblastema
Because of the method for TT2, the method for carrying out gene cloning in seed development early stage can be substituted, is had to rape yellow seed breeding very heavy
The meaning wanted.
The mutation of rape seed skin color is related with control flavonoids synthetic gene and its product, and Procyanidins are to cause
The key substance of rape seed color distortion.TT2 is the key transcription factor for regulating and controlling rape seed skin color, belongs to MYB types
Transcription factor.The transcription factor of TT2-MYB types in arabidopsis, TTG1-WD40 type transcription factors, TT8-bHLH types
Transcription factor can form MBW complexs and be attached to dihydroflavonol 4-reductase gene（DFR）, anthocyanidin synthase gene
(ANS) and the promoter up regulation of anthocyanidin reductase gene (ANR) their expression.And the transcription factor of MYB types exists
It plays an important role in entire styrene acrylic metabolic pathway, and secondary of the transcription factor of MYB types in addition to participating in anthocyanidin
In metabolic pathway, also participate in the metabolism of some Primary products.
Invention content
The purpose of the present invention is to provide a kind of method of intuitive, economic, easy clone's mustard type rape seed coat gene TT2,
To be applied to canola seed coat gene cloning, the research that Biometabolic pathway is regulated and controled for canola seed coat provides quick side
Method.
To achieve the above object, the technical solution adopted by the present invention：A kind of quick clone mustard type rape seed coat gene TT2
The method of CDS sequences it is characterized in that the TTG1 genes built are transferred in the competence of Wild Type Agrobacteria A4, then carries out
Centrifugation is resuspended to obtain and infects liquid B with isometric MS liquid, and then the explant rape 2 weeks to 3 week old, is added and infects liquid B
In, it disseminates 5-10 minutes at normal temperatures, is then co-cultured, after 24-48 hours, be then transferred to screening and culturing medium and trained
It supports, cuts the hairy root of fast growing after one week from explant, be transferred on subculture medium, liquid is transferred to after two weeks
Culture, the TTG1 hairy roots being overexpressed after one month are enlarged on body culture medium, TTG1 expression can promote TT2 tables
It reaches, mustard type rape seed coat gene TT2 CDS sequences can be cloned.
The bacterium solution A is the A4 agrobacterium rhizogenes competence prepared.
Described infects liquid B by converting TTG1 Agrobacteriums A4 and OD values (600）0.8 centrifugation is carried out with 50ml volume MS liquid
Resuspension obtains.
It is as follows：
（1）Prepare bacterium solution A：In the overexpression pCAMIBA3301 TTG1 genetic transformation to competence Agrobacterium rhizogenesA4 built
It obtains；
（2）Liquid B is infected in preparation：By converting TTG1 Agrobacteriums A4 and OD values (600）0.8 centrifugation carries out weight with 50ml volume MS liquid
It is outstanding to obtain；
（3）First in rape TTG1 genetic transformation to Agrobacterium rhizogenesA4, then with the liquid B that infects of conversion infect rape 2 weeks to 3
The explant of week old is disseminated 5-10 minutes at normal temperatures；
（4）It carries out again after co-culturing 24-48 hours, is then transferred to screening and culturing medium and is cultivated, after one week from explant
The hairy root for cutting fast growing, is transferred on subculture medium, is transferred on fluid nutrient medium after two weeks and is enlarged training
It supports, the TTG1 hairy roots being overexpressed after one month；
（5）Fresh transgenic hairy root is taken, carries out RNA extractions, reverse transcription, then carry out PCR reactions；
（6）Escherichia coli conversion is carried out, send company to be sequenced, clones TT2 genes, to which quick clone controls rape seed skin color
Gene TT2CDS sequences.
The present invention is from Agrobacterium-mediated Transformation and infects the approach such as equal biology to rape and starts with, and has extensively studied A4 Agrobacteriums use
The mechanism of action and TT2 gene clonings of hairy root are formed in conversion Leaf Stems from Brassica juncea, finds the hairy in the TTG1 of overexpression
TT2 gene C DS sequences can be cloned in root.Present invention Agrobacterium-mediated Transformation method is overexpressed Agrobacterium and infects, induces hairy
Root so as to simplicity, quickly clones TT2 gene C DS sequences.This have the advantage that it is easy to operate, not by rape
Development and seasonal effect.
Specific implementation mode
Embodiment 1:
A kind of method of quick clone mustard type rape seed coat gene TT2, its step are as follows:
（1）Prepare bacterium solution A：In the overexpression pCAMIBA3301 TTG1 genetic transformation to competence Agrobacterium rhizogenesA4 built
It obtains；
（2）Liquid B is infected in preparation：By converting TTG1 Agrobacteriums A4 and OD values (600）0.8 centrifugation carries out weight with 50ml volume MS liquid
It is outstanding to obtain；
（3）First in rape TTG1 genetic transformation to Agrobacterium rhizogenesA4, then with the liquid B that infects of conversion infect black seed juncea
The explant of rape purple leaf mustard rape 2 weeks to 3 week old, disseminates 5-10 minutes at normal temperatures；
（4）It carries out again after co-culturing 24-48 hours, is then transferred to screening and culturing medium and is cultivated, after one week from explant
The hairy root for cutting fast growing, is transferred on subculture medium, is transferred on fluid nutrient medium after two weeks and is enlarged training
It supports, the TTG1 hairy roots being overexpressed after one month；
（5）The transgenic hairy root that 1g is fresh is taken, carries out RNA extractions, reverse transcription, then carry out PCR reactions；
（6）Escherichia coli conversion is carried out, send company to be sequenced, clones TT2 genes, to which quick clone controls rape seed skin color
Gene TT2CDS sequences.
Embodiment 2:
A kind of method of quick clone mustard type rape seed coat gene TT2, its step are as follows:
（1）Prepare bacterium solution A：In the overexpression pCAMIBA3301 TTG1 genetic transformation to competence Agrobacterium rhizogenesA4 built
It obtains；
（2）Liquid B is infected in preparation：By converting TTG1 Agrobacteriums A4 and OD values (600）0.8 centrifugation carries out weight with 50ml volume MS liquid
It is outstanding to obtain；
（3）First in rape TTG1 genetic transformation to Agrobacterium rhizogenesA4, then with the liquid B that infects of conversion infect Sichuan Huang seed oil
The explant of dish 2 weeks to 3 week old, disseminates 5-10 minutes at normal temperatures；
（4）It carries out again after co-culturing 24-48 hours, is then transferred to screening and culturing medium and is cultivated, after one week from explant
The hairy root for cutting fast growing, is transferred on subculture medium, is transferred on fluid nutrient medium after two weeks and is enlarged training
It supports, the TTG1 hairy roots being overexpressed after one month；
（5）The transgenic hairy root that 1g is fresh is taken, carries out RNA extractions, reverse transcription, then carry out PCR reactions；
（6）Escherichia coli conversion is carried out, send company to be sequenced, clones TT2 genes, to which quick clone controls rape seed skin color
Gene TT2CDS sequences.
Embodiment 3:
A kind of method of quick clone mustard type rape seed coat gene TT2, its step are as follows:
（1）Prepare bacterium solution A：In the overexpression pCAMIBA3301 TTG1 genetic transformation to competence Agrobacterium rhizogenesA4 built
It obtains；
（2）Liquid B is infected in preparation：By converting TTG1 Agrobacteriums A4 and OD values (600）0.8 centrifugation carries out weight with 50ml volume MS liquid
It is outstanding to obtain；
（3）First in rape TTG1 genetic transformation to Agrobacterium rhizogenesA4, then with the liquid B that infects of conversion infect mustard type rape
The explant of NILB 2 weeks to 3 week old, disseminates 5-10 minutes at normal temperatures；
（4）It carries out again after co-culturing 24-48 hours, is then transferred to screening and culturing medium and is cultivated, after one week from explant
The hairy root for cutting fast growing, is transferred on subculture medium, is transferred on fluid nutrient medium after two weeks and is enlarged training
It supports, the TTG1 hairy roots being overexpressed after one month；
（5）The transgenic hairy root that 1g is fresh is taken, carries out RNA extractions, reverse transcription, then carry out PCR reactions；
（6）Escherichia coli conversion is carried out, send company to be sequenced, clones TT2 genes, to which quick clone controls rape seed skin color
Gene TT2CDS sequences.
Rape seed skin color gene TT2CDS sequence tables：
<110>University Of Science and Technology Of Hunan
<120>A kind of method of quick clone mustard type rape seed coat gene TT2 CDS sequences
<160> 1
<210> 1
<211> 783
<212> DNA
<213>Mustard type rape（Brassica juncea）
<400> 1
ATGATGAGAAAGAGAGAAAGTAGTAAGGTGAAGAAAGAGGAGTTAAACAGAGGAGCTTGGACCGATCAAGAAG
ACAAGATCCTTAAAGACTATATCATGTTCCACGGCGAAGGAAAATGGAGCACACTCCCAAACCAAGCTGGTCTCAAG
AGGTGTGGCAAAAGCTGCAGACTTCGGTGGAAGAACTACTTGAGACCAGGCATAAAGCGCGGAAACATCTCATCTGA
TGAAGAAGAACTTATAATCCGCCTCCATAATCTCCTTGGAAACAGATGGTCGTTGATAGCTGGGAGGCTTCCAGGGC
GAACAGACAATGAAATAAAGAACCACTGGAACTCAAACCTCCGCAAAAGACTTCCAAAATCTCAAACCAACCAACAG
AAAAGTCGAAAACATTCCAACAACAACAACATGAATAAAGTATGTGTTATACGTCCAAAGGCGATTAGGTTCCCAAA
GGCTCTGACATTTCAGAATCAGAGTAGTATTGGTAGTACCAGTCTTCTTACTGTGAAGGAAAACGTGATTGATCATC
AAGCTGGTTCTCCTTCATTGTTGGGAGATCTTAAAATCGATTTTGATAAAATTCAGTCTGAGTATCTCTTCTCTGAT
TTGATGGACTTTGATGGTTTGGGTTGTGGAAACGTAATGTCTCTTGTTTCATCTGACGAGGTGCTGGGAGATTATGT
TTCGGCTGATACTTCTTGTCTGGGTAATCTTGACCTTAATAGACCTTTCACTTCTTGTCTTCAAGAAGATTGTCTCT
GGGACTTTAATTGTTAG。
Claims (3)
1. a kind of method of quick clone mustard type rape seed coat gene TT2 CDS sequences, it is characterized in that the TTG1 built
Gene is transferred in the competence of Agrobacterium A4, then is centrifuged to be resuspended to obtain with isometric MS liquid and infect liquid B, then
The explant of rape 2 weeks to 3 week old, addition are infected in liquid B, are disseminated 5-10 minutes, are then co-cultured, 24- at normal temperatures
It after 48 hours, is then transferred to screening and culturing and is cultivated, cut the hairy root of fast growing, transfer after one week from explant
It onto subculture medium, is transferred on fluid nutrient medium after two weeks and is enlarged culture, be overexpressed after one month
TTG1 hairy roots, TTG1 expression can promote TT2 to express, carry out rape TT2 CDS sequences so as to clone.
2. the method for quick clone mustard type rape seed coat gene TT2 CDS sequences according to claim 1, feature
It is that the bacterium solution A is the A4 agrobacterium rhizogenes competence prepared.
3. the method for quick clone mustard type rape seed coat gene TT2 CDS sequences according to claim 1, feature
It is that described infects liquid B by converting TTG1 Agrobacteriums A4 and OD values (600）0.8 centrifugation is resuspended with 50ml volume MS liquid
It obtains.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711360127.4A CN108359672A (en) | 2017-12-18 | 2017-12-18 | A kind of method of quick clone mustard type rape seed coat gene TT2CDS sequences |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711360127.4A CN108359672A (en) | 2017-12-18 | 2017-12-18 | A kind of method of quick clone mustard type rape seed coat gene TT2CDS sequences |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108359672A true CN108359672A (en) | 2018-08-03 |
Family
ID=63010217
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711360127.4A Pending CN108359672A (en) | 2017-12-18 | 2017-12-18 | A kind of method of quick clone mustard type rape seed coat gene TT2CDS sequences |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108359672A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101194598A (en) * | 2007-12-30 | 2008-06-11 | 九江学院 | Method for producing polygalacic acid with milkwort feather shaped root system culture |
| US20080153102A1 (en) * | 2006-12-21 | 2008-06-26 | Basf Plant Science Gmbh | Rooted plant assay system |
| CN102229945A (en) * | 2011-05-20 | 2011-11-02 | 陕西科技大学 | Cultivation method for inducing scutellaria baicalensis hairy root based on agrobacterium rhizogenes infection |
| EP2385130A1 (en) * | 2010-05-03 | 2011-11-09 | Université de Picardie Jules Verne | Method for producing recombinant proteins from plant hairy roots |
| CN105671077A (en) * | 2016-04-21 | 2016-06-15 | 哈尔滨工业大学 | Method for efficiently inducing table beet to generate hairy roots by utilizing agrobacterium rhizogenes |
| CN106497971A (en) * | 2017-01-13 | 2017-03-15 | 扬州大学 | A kind of cabbage type rape hairy root induction and cultural method rapidly and efficiently |
-
2017
- 2017-12-18 CN CN201711360127.4A patent/CN108359672A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080153102A1 (en) * | 2006-12-21 | 2008-06-26 | Basf Plant Science Gmbh | Rooted plant assay system |
| CN101194598A (en) * | 2007-12-30 | 2008-06-11 | 九江学院 | Method for producing polygalacic acid with milkwort feather shaped root system culture |
| EP2385130A1 (en) * | 2010-05-03 | 2011-11-09 | Université de Picardie Jules Verne | Method for producing recombinant proteins from plant hairy roots |
| CN102229945A (en) * | 2011-05-20 | 2011-11-02 | 陕西科技大学 | Cultivation method for inducing scutellaria baicalensis hairy root based on agrobacterium rhizogenes infection |
| CN105671077A (en) * | 2016-04-21 | 2016-06-15 | 哈尔滨工业大学 | Method for efficiently inducing table beet to generate hairy roots by utilizing agrobacterium rhizogenes |
| CN106497971A (en) * | 2017-01-13 | 2017-03-15 | 扬州大学 | A kind of cabbage type rape hairy root induction and cultural method rapidly and efficiently |
Non-Patent Citations (2)
| Title |
|---|
| MINGLI YAN ET AL.: "Cloning of TTG1 gene and PCR identification of genomes A, B and C in Brassica species", 《GENETICA》 * |
| 严明理: "芥菜型油菜黄籽形成的分子机理研究", 《中国博士论文全文数据库(电子期刊)农业科技辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Anila et al. | Metabolic engineering of Dunaliella salina for production of ketocarotenoids | |
| Al Abdallat et al. | Agrobacterium tumefaciens-mediated transformation of callus cells of Crataegus aronia | |
| CN107099540B (en) | NtFERL gene influencing tobacco pigment content and application thereof | |
| Úbeda-Mínguez et al. | Tools for microalgal biotechnology: development of an optimized transformation method for an industrially promising microalga—Tetraselmis chuii | |
| Zheng et al. | Expression of bkt and bch genes from Haematococcus pluvialis in transgenic Chlamydomonas | |
| WO2021067645A1 (en) | Genetically modified plants and methods of making the same | |
| Utsumi et al. | Formation of friable embryogenic callus in cassava is enhanced under conditions of reduced nitrate, potassium and phosphate | |
| Sankari et al. | Identifying a carotenoid cleavage dioxygenase 4a gene and its efficient agrobacterium-mediated genetic transformation in Bixa orellana L. | |
| Argôlo et al. | The regulation of solasodine production by Agrobacterium rhizogenes-transformed roots of Solanum aviculare | |
| Dautor et al. | Development of genetic transformation methodologies for an industrially-promising microalga: Scenedesmus almeriensis | |
| Wilson et al. | Development of an Agrobacterium-mediated transformation method for Taxus suspension cultures | |
| CN116083446A (en) | Application of IbCD 4 gene in regulating carotenoid content in sweet potato tuberous root | |
| Ma et al. | Establishment of an efficient transformation system and its application in regulatory mechanism analysis of biological macromolecules in tea plants | |
| Paul et al. | A simple and efficient protocol for hairy root culture of Arabidopsis thaliana | |
| CN116814652A (en) | Ganlong No.1 CcMYB4_LIKE gene and expression protein and application thereof | |
| Musfir Mehaboob et al. | Indirect somatic embryogenesis and Agrobacterium-mediated transient transformation of ginger (Zingiber officinale Rosc.) using leaf sheath explants | |
| CN108359672A (en) | A kind of method of quick clone mustard type rape seed coat gene TT2CDS sequences | |
| KR101259682B1 (en) | Haematococcus pluvialis beta-carotene ketolase cDNA and method for generation of transgenic plants producing keto-carotenoids and higher level of beta-carotene using the same | |
| Bauer et al. | Genetička transformacija ukrasne koprive, Coleus blumei Benth. s pomoću bakterija Agrobacterium | |
| Chen et al. | Eucalyptus | |
| Dickinson et al. | Transient heterologous gene expression methods for poison ivy leaf and cotyledon tissues | |
| Moazami et al. | Agrobacterium-mediated transient assay of the gus gene expression in sugar beet | |
| CN114507679B (en) | Pinus massoniana terpenoid synthesis related enzyme gene PmDXR and application of promoter thereof | |
| CN109943573A (en) | A method of changing Scent of Chrysanthemum ingredient terpenes volatile content | |
| Mikami et al. | Transformation efficiency and transgene expression level in marker-free RDR6-knockdown transgenic tobacco plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180803 |