CN108348591A

CN108348591A - Recombinant listeria bacterium vaccine strains and its method for immunotherapy for cancer

Info

Publication number: CN108348591A
Application number: CN201680066712.0A
Authority: CN
Inventors: R·珀蒂; D·J·莫罗
Original assignee: Advaxis Inc
Current assignee: Ayala Pharmaceuticals Inc
Priority date: 2015-09-17
Filing date: 2016-09-16
Publication date: 2018-07-31
Also published as: WO2017049218A2; KR20180043381A; AU2016324170A1; MA42845A; EP3349789A2; MX2018003352A; CA2998889A1; JP2018527382A; IL258004A

Abstract

The present invention provides the methods for the treatment of cervical carcinoma, and the method includes applying the composition of the recombinant listeria bacterium comprising expression human papillomavirus antigen to subject.In another embodiment, the present invention provides the methods for the treatment of cervical carcinoma, and the method includes the conjoint therapies that application includes the steps that the recombinant listeria bacterium bacterial strain of chemoradiotherapy therapy and expression human papillomavirus antigen.

Description

Recombinant listeria bacterium vaccine strains and its method for immunotherapy for cancer

Technical field

The present invention provides the methods for the treatment of cervical carcinoma, and the method includes being applied to subject comprising expression human papilloma The step of composition of the recombinant listeria bacterium of viral antigen.In another embodiment, the present invention provides treatment cervical carcinomas Method, the method includes application include chemoradiotherapy therapy and express human papillomavirus antigen recombinant listeria bacterium bacterial strain Conjoint therapy the step of.

Background technology

Listerisa monocytogenes in mjme (Listeriamonocytogenes) (Lm) is a kind of food-borne gram sun Property bacterium, occasional lead to disease in the mankind especially the elderly, newborn, pregnant woman and immune compromised individuals.In addition to swashing strongly Congenital immunity living and induce enhancement antigen in the cytokine response of delivery cell (APC) function outside, Lm can also be molten from swallowing Enzyme body replicates after fleeing from the cytosol of APC, this mainly passes through the effect of Listeriolysin O (LLO) albumen.This The unique intracellular life cycle of kind makes the antigen secreted by Lm that can be processed under MHC I classes and the background of II class molecules and be in It passs, so as to cause potent cytotoxicity CD8⁺With Th1 CD4⁺The immune response that T cell mediates.Lm is in preclinical models Carrier as immunotherapy for cancer has obtained extensive research.Lm-LLO-E7 causes expression E7 to mouse immune and has been established Tumour recession, and impart digital preservation.The effect of Lm-LLO-E7, is related to its following ability：Induction infiltration tumour portion E7 specific CTLs, the mature dendritic cell of position, reduce modulability CD4 in tumor⁺CD25⁺The quantity and inhibition tumour blood of T cell Pipe occurs.

Lm also has the advantages that many intrinsic as immunotherapy carrier.Bacterium effectively grows and in vitro without spy It is different to require, and it lacks LPS, this be major toxicity in Gram-negative bacteria such as salmonella (Salmonella) because Son.The Lm carriers of gene attenuation also provide additional safety for serious adverse reaction, because they can easily pass through Antibiotic is eliminated, and is different from certain viral vectors, and inhereditary material unconformity is into host genome.

High carcinogenic risk human papilloma virus (HR-HPV) type persistent infection be considered to be invasive carcinoma of cervix (ICC) it is necessary but Non-sufficient reason.HPV 16 and 18 is most common type in malignant change, accounts for 70% of ICC or more, high-grade disease early period 50% or more become.HR-HPV E6 and E7 albumen are expressed dysplasia is consistent in cancer, destroy cell cycle regulating egg respectively White p53 and pRb.Dysplasia and wellability malignant change to the mandatory expression of E6 and E7 and these albumen it is viral come Source makes them become the excellent target of HPV therapeutic vaccines.

Cervical carcinoma is one of most common cancer of women worldwide.But periodically carry out cervical carcinoma screenings in the U.S. and other Country, this cancer be not common.Most of cervical carcinomas are caused by the virus of referred to as human papilloma virus or HPV.It can pass through It is contacted with people's progressive with HPV and infects HPV.HPV viruse has many types.Not all types of HPV can cause Cervical carcinoma.Some of them can lead to genital wart, but other types may not lead to any symptom.Most of adults are at certain HPV has been infected when a.Infection may die away.But it may result in genital wart or leads to cervical carcinoma sometimes.

American Cancer Society is estimated as U.S.'s cervical carcinoma in 2015：There to be about 12,900 new wellability uterine neck Carninomatosis example is diagnosed.There are about 4,100 women will die of cervical carcinoma.In addition, there is 528,000 cervical carcinoma new case in the whole world every year Report, is estimated to be 266,000 associated death.In duration/recurrent metastatic squamous cervical carcinoma (PRmCC), survival rate Less than 30%, this ratio was never exceeded within 12 months life cycles in history.Using the dual chemotherapy of the best platinum class of a line +/- bevacizumab, median survival interval are 13-17 months.However, the patient being in progress after the systemic therapy of at least one treatment line It can only survive 4-7 months.

In addition, having not gone through the therapy of approval after first-line treatment failure.Therefore, cervical carcinoma (including PRmCC) needs new Treatment mode.

The present invention meets this demand by providing for treating the attenuated live Listeria vaccine carrier of cervical carcinoma.This Invention further provides for the conjoint therapy for including attenuated live Listeria for treating cervical carcinoma.

Invention content

In one aspect, the present invention relates to a kind of duration/recurrent metastatic treated in people experimenter, (squamous is non- Squamous) cervical carcinoma (PRmCC) method, the method includes the step of to subject's administered recombinant Listeria bacterial strain, The Listeria bacterial strain includes recombinant nucleic acid, and the nucleic acid includes the first open reading frame, and first open reading frame is compiled Code recombinant polypeptide, the recombinant polypeptide include the N-terminal segment for being fused to HPV-E7 antigens or the LLO albumen of its segment.

On the other hand, the present invention relates to a kind of method for treating the cervical carcinoma in people experimenter, the method includes To the subject using the conjoint therapy for including the steps that chemoradiotherapy and recombinant listeria bacterium bacterial strain, the Listeria bacterial strain Including recombinant nucleic acid, the nucleic acid includes the first open reading frame, and the first open reading frame encoding recombinant polypeptide is described heavy Group polypeptide include be fused to the N-terminal segment of HPV-E7 antigens or the LLO albumen of its segment, wherein the Listeria bacterial strain with 5×10⁹The predose of a colony forming unit (CFU) is applied, and is wherein applied every 3 weeks to the patient with post dose Thus Listeria bacterial strain treats the cervical carcinoma in the people experimenter.

In a related aspect, cause the antitumor cell toxicity T in people experimenter to PRmCC thin the present invention relates to a kind of The method of born of the same parents' response, the method includes the step of to subject's administered recombinant Listeria bacterial strain, the Listerias Bacterial strain includes recombinant nucleic acid, and the nucleic acid includes the first open reading frame, the first open reading frame encoding recombinant polypeptide, institute It includes the N-terminal segment for being fused to HPV-E7 antigens or the LLO albumen of its segment to state recombinant polypeptide.

In a related aspect, the present invention relates to a kind of antitumor cell cytotoxic T cell responses caused in people experimenter Method, the method includes to the subject apply include Listeria bacterial strain disclosed herein and chemoradiotherapy therapy Conjoint therapy.

Other features and advantages of the present invention will be become apparent due to example following detailed description of and attached drawing.But It is, it should be understood that the detailed description and specific example are although it is indicated that the preferred embodiment of the present invention, but only by illustration It provides, because the variations and modifications in the spirit and scope of the present invention are to having read the people in the art of the detailed description It will be apparent for member.

Description of the drawings

It is considered as subject of the present invention and particularly points out and be distinctly claimed in the conclusion part of specification to be protected.However, When reading in conjunction with the drawings, by reference to detailed description below, the present invention can be best understood (to organizing and the side of operation All it is such for method) and its objects, features and advantages, in the accompanying drawings：

Fig. 1 .Lm-E7 and Lm-LLO-E7 expresses using different expression systems and secretes E7.By the way that box gene is introduced Lm-E7 (A) is generated in the domains orfZ of listerisa monocytogenes in mjme genome.Hly promoters drive hly signal sequences With the preceding five amino acid (AA) of LLO and the expression of subsequent HPV-16E7.B) by converting prfA- bacterium with plasmid pGG-55 Strain XFL-7 generates Lm-LLO-E7.PGG-55 has the hly promoters of the expression of driving LLO-E7 non-hemolytic fusions. PGG-55 also contains prfA genes, to select XFL-7 in vivo to the reservation of plasmid.

Fig. 2 .Lm-E7 and Lm-LLO-E7 secrete E7.Make Lm-Gag (swimming lane 1), Lm-E7 (swimming lane 2), Lm-LLO-NP (swimming Road 3), Lm-LLO-E7 (swimming lane 4), XFL-7 (swimming lane 5) and 10403S (swimming lane 6) be in Luria-Bertoni fluid nutrient mediums Overnight in 37 DEG C of growths.Precipitate the bacterium (pass through 600nm at absorbance OD determination) of equal number, and by each supernatant of 18ml Liquid carries out TCA precipitations.It is expressed by Westem engram analysis E7.The anti-mouse being coupled with anti-E7mAb, then with HRP- (Amersham) trace is detected, is then developed using ECL detection reagents.

The tumour immunity of Fig. 3 .LLO-E7 fusions inhibits effect.It shows the 7th, the 14th, the 21st, the 28th after tumor inoculation With the tumor size in the 56th day mouse in terms of millimeter.Unexposed mouse：Empty circles；Lm-LLO-E7：Solid circles；Lm- E7：Square；Lm-Gag：Open diamonds；And Lm-LLO-NP：Black triangle.

Splenocytes of Fig. 4 from the Lm-LLO-E7- mouse being immunized is proliferated when being exposed to TC-1 cells.By C57BL/6 Mouse is immunized and is strengthened with Lm-LLO-E7, Lm-E7 or control rLm bacterial strains.6 days harvest splenocytes after reinforcing, and with display Ratio bed board together with the TC-1 cells through irradiation.Cell is used³H thymidine pulses are handled and are harvested.Cpm is defined as (experiment Cpm)-(no TC-1 controls).

Fig. 5 .A. are in application TC-1 tumour cells and then using Lm-E7, Lm-LLO-E7, Lm-ActA-E7 or without vaccine In the mouse of (unexposed), the CD8 of the secretion of gamma-IFN of E7 specificity in spleen⁺The induction of T cell and the number for infiltrating tumour. B. it is directed to the CD8 of the spleen and E7 specificity in tumour of mouse of (A) description⁺The induction and infiltration of cell.

The Listeria construct that Fig. 6 contain the regions PEST induces the E7 specificity lymphs of greater percentage in tumour Cell.A. the representative data tested from 1.B. the average value and SE for the data tested from all 3.

Effect of Fig. 7 A. passages to the bacterial load (virulence) of recombinant listeria bacterium vaccine carrier.Upper figure：Lm-Gag. under Figure：Lm-LLO-E7. effect of Fig. 7 B. passages to the bacterial load of recombination Lm-E7 in spleen.It depicts from four mouse The average bacterium CFU living of every milliliter of Splenic vessel.

Fig. 8, which is shown, to be applied after the Lm-Gag of passage and the Lm-Gag not passed on for HIV-Gag and LLO Antigentic specificity CD8⁺The induction of T cell.By mouse with 10³A (A, B, E, F) or 10⁵A (C, D, G, H) CFU through passage Listeria vaccine carrier is immune, and analyzes T cells with antigenic specificity.B、D、F、H：The Listeria vaccine carrier not passed on. A-D：To the immune response of MHC I class HIV-Gag peptides.E-H：To the immune response of LLO peptides.I：To use by oneself 10⁵A CFU is through passage The splenocytes of the immune mouse of Lm-Gag stimulated with the control peptide from HPV E7.

Fig. 9 A show that the plasmid in entire LB stability studies detaches.Figure 10 B are shown to be ground in entire TB stability Plasmid separation in studying carefully.Figure 10 C show quantifying for TB stability studies.

Figure 10 shows work bacterial chloramphenicol (CAP) resistance and CAP susceptible colonies from the bacterium grown in LB Form the quantity of unit (CFU).Dark bars：CAP⁺；White bars：CAP^-.Two dark bars and two white bars of each time point Represent repeating sample.

Figure 11 shows the quantity of work bacterium CAP resistances and CAP sensibility CFU from the bacterium grown in TB.It is deep Vitta：CAP⁺；White bars：CAP.Two dark bars and two white bars of each time point represent repeating sample.

Figure 12 show the practical chromatogram of D133V saltation zones (arrow).Mixing rate is shown in bracket.

The expression of the position of the primer of Figure 13 .ADV451,452 and 453 and the prfA genetic fragments expanded in the reaction.

The specificity that Figure 14 are reacted using the PCR of primer ADV451 and ADV453.

The specificity that Figure 15 are reacted using the PCR of primer ADV452 and ADV453.

Figure 16 carry out PCR reactions to detect wild type prfA sequences using the DNA of primer ADV452 and 1ng primary quantity Sensitivity.

Figure 17 carry out PCR reactions to detect wild type prfA sequences using the DNA of primer ADV452 and 5ng primary quantity Sensitivity.

The averag density of the band for the PCR that Figure 18 describe in Figure 16.

The averag density of the band for the PCR that Figure 19 describe in Figure 17.

Figure 20 detect the verification of wild type prfA sequences progress to using primer ADV452 to carry out PCR reactions.

The averag density of the band for the PCR that Figure 21 describe in Figure 16.

Analyses of Figure 22 to the D133V prfA mutation in Lm-LLO-E7.A is used for the original graph of density measure technology Picture；B carries out number enhancing to facilitate look at low-density band to image.

In the patient that Figure 23 are in progress after the past systemic therapy for treating line with PRMCC and at >=1, ADXS11- 001 survival rate of display 12 months is 38.5% (n=10/26).

Figure 24 measure the progression free survival phase (PFS) after using ADXS11-001 initial treatments, and position PFS is 3.1 in display A month.

Tumor regression in .19 patients of Figure 25 and reaction.

The spy that Figure 26 carry out the overall survival (OS) for receiving the patient for the treatment of (3 doses of ADXS11-001) according to scheme It analyzes without hesitation.Among 26 patients receiving treatment, 18 people complete (to be received according to entire treat of scheme in 3 months 3 doses of axalimogene filolisbac), middle position overall survival phase is more than 1 year (12.1 months), 12 months overall survivals Rate reaches 55.6%.

Figure 27 realize 12 months life cycles regardless of the degree (1-3 items treat line) previously treated.

Figure 28 depict the Clinical Study Protocol, terminal and crucial criterion of acceptability of the clinical test described in example 12.

Figure 29 depict the CONSORT figures of the clinical test described in example 12.

Figure 30 depict 12 of the clinical test described in example 12 compared with the history COG experimental series in PRmCC Month survival rate.

Figure 31 A and 31B.A) 6 months survival rates are 42% (10/24), middle position OS is 4.8 months (95%CI：3.6-NR)； Middle position PFS is 2.6 months (95%CI：2.0-3.2)；B) suffer from 50% (12/24) for receiving 3 doses or more agent ADXS11-001 In person, middle position OS is NR (95%CI：3.5-NR), median follow-up time is 9.2 months, and 6 months survival rates are 67%.

Figure 32 depict be diagnosed as at one with Cervix Squamous Cell cancer then by radical hysterectomy into The timetable for the clinical test carried out in 66 years old women of row operative treatment.After the postoperative 7 years pelvic recurrences of uterectomy, patient Receive taxol/carboplatin × 8 period (6 periods include bevacizumab) → cis-platinum (2 periods)+pelvic irradiation.Ten After month, there is whole body recurrence, patient has participated in the clinical test described in example 12.

Figure 33, which are shown, describes persistently the scanning of reaction (CR) completely.

Specific implementation mode

In the following specific embodiments, multiple details are set forth, to provide a thorough understanding of the present invention.So And it should be appreciated by those skilled in the art that the present invention can be implemented without these details.In other situations In, to avoid making complication of the present invention, well known method, process and component are not described in detail.

As used in herein (including the appended claims), unless context is clearly pointed out on the contrary, the otherwise list of word Number form formula such as "one", "an" with " should/described " also include its corresponding plural.That quotes herein is all with reference to text Offer and be incorporated by reference, sequence that degree is accessed such as each individual publication, by GenBank accession number, patent application, The illustration in nucleotide or oligomerization or polypeptide sequence and the publication and patent document in patent, sequence table, sequence table It is specifically and individually indicated with attached drawing as being incorporated by reference.Term " present invention " refers to certain implementations of the present invention Example or some embodiments of the present invention.Unless otherwise stated, term " present invention " is not necessarily referring to all realities of the present invention Apply example.

Abbreviation will use following abbreviation in the specific implementation mode of the entire present invention and example：

APC antigen presenting cells

BID is twice daily, one every time

CFU colony forming units

Lm listerisa monocytogenes in mjme

NCBI National Center for Biotechnology Information

NCI National Cancer Institutes

PFS progression free survival phases

OS overall survivals

The objective reactivities of ORR

ORF open reading frame

PRmCC durations/relapse and metastasis cervical carcinoma

PCR PCRs

Q2W is biweekly, one every time

Q3W is once in three weeks, one every time

Q4W surroundings are primary, one every time

QD is once a day, one every time

The response evaluation criteria of RECIST entity tumors

SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis

TIL tumor infiltrating lymphocytes

UTR non-translational regions

In one embodiment, disclosed herein is a kind of duration treated in people experimenter/recurrent metastatic (squamous Or non-squamous) cervical carcinoma (PRmCC) method, the method includes the steps to subject's administered recombinant Listeria bacterial strain Suddenly, the Listeria bacterial strain includes recombinant nucleic acid, and the nucleic acid includes the first open reading frame, first open reading frame Encoding recombinant polypeptide, the recombinant polypeptide include the N-terminal segment for being fused to HPV-E7 antigens or the LLO albumen of its segment.

In another embodiment, disclosed herein is a kind of method for treating the cervical carcinoma in people experimenter, the methods Include the steps that the subject apply include chemoradiotherapy and recombinant listeria bacterium bacterial strain conjoint therapy, the Listeria Bacterial strain includes recombinant nucleic acid, and the nucleic acid includes the first open reading frame, the first open reading frame encoding recombinant polypeptide, institute It includes the N-terminal segment for being fused to HPV-E7 antigens or the LLO albumen of its segment to state recombinant polypeptide, wherein the Listeria bacterium Strain is with 5 × 10⁹The predose of a colony forming unit (CFU) is applied, and wherein applies subsequent agent to the patient every 3 weeks Thus the Listeria bacterial strain of amount treats the cervical carcinoma in the people experimenter.In another embodiment, the method It is included in subject described in the forward direction using the recombinant listeria bacterium bacterial strain and applies at least one chemoradiotherapy therapy.At another In embodiment, the subject receives to be no more than 2 doses of chemoradiotherapy therapies before the application recombinant listeria bacterium bacterial strain.

In one embodiment, cause the antitumor cell toxicity T in people experimenter to PRmCC thin disclosed herein is a kind of The method of born of the same parents' response, the method includes the step of to subject's administered recombinant Listeria bacterial strain, the Listerias Bacterial strain includes recombinant nucleic acid, and the nucleic acid includes the first open reading frame, the first open reading frame encoding recombinant polypeptide, institute It includes the N-terminal segment for being fused to HPV-E7 antigens or the LLO albumen of its segment to state recombinant polypeptide.In one embodiment, originally Text discloses a kind of method of the antitumor cell cytotoxic T cell response caused in people experimenter, and the method includes to described Subject is with 5 × 10⁹The predose administered recombinant Listeria bacterial strain of a colony forming unit, and wherein every 3 weeks to institute Patient is stated using the Listeria bacterial strain with post dose, thus causes antitumor cell cytotoxic T cell response.In another implementation In example, the tumour is to express the tumour of HPV-E7 or HPV-E6.

In another embodiment, disclosed herein is a kind of antitumor cell cytotoxic T cells caused in people experimenter to answer The method answered includes Listeria bacterial strain disclosed herein and chemoradiotherapy therapy the method includes being applied to the subject Conjoint therapy.

In some embodiments, disclosed herein is treat disease, defence disease and induce to the immune response of disease Method, the method includes the step of to subject's administered recombinant Listeria bacterial strain, the bacterial strain expresses fusogenic peptide, described to melt It includes the heterogenetic antigen or its segment that Listeriolysin O (LLO) segment and the disease are expressed to close peptide.The present invention also carries Supplied induction people experimenter in (CTL) response of anti-disease cytotoxic T cell and treat with the relevant obstacle of the disease and The method of symptom, the method includes administered recombinant Listeria bacterial strains.In one embodiment, there is provided herein a kind of recombinations Listeria bacterial strain, the recombinant listeria bacterium bacterial strain include recombinant nucleic acid, and the nucleic acid includes the first open reading frame, described First open reading frame encoding recombinant polypeptide, the recombinant polypeptide include to be fused to heterogenetic antigen or the LLO albumen of its segment The first N-terminal segment, and the wherein described recombinant nucleic acid also includes the second open reading frame, and second open reading frame is compiled Code mutant prfA genes.In one embodiment, mutant prfA genes are at No. 133 amino acid position of coding from amino Sour D or Asp or aspartate (or aspartic acid) arrive the gene of the point mutation of amino acid V or Val or valine.At another In embodiment, which is the Listeria of attenuation." attenuation " and " attenuation " can be covered by modification to reduce To the base in the bacterium of host toxicity, virus, parasite, infectious organisms, prion, tumour cell, infectious organisms Because etc..Host can be human or animal host or organ, tissue or cell.It illustrates in a non-limiting manner, bacterium can be attenuated With the combination of reduction and host cell, the propagation from a host cell to another host cell is reduced, extracellular growth is reduced, or Reduce the Intracellular growth in host cell.Attenuation can be by measuring one or more indexs of such as toxicity, LD₅₀, from device Clearance rate or competitive index in official and assess (see, for example, Auerbuch et al. (2001) Infect.Immunity 69： 5953-5957).In general, attenuation leads to LD₅₀Increase and/or clearance rate increase at least 25%；More generally increase at least 50%；Most It is increased typically at least 100% (2 times)；It is normal to increase at least 5 times；At least 10 times of more normal increase；It is most normal to increase at least 50 times； Often increase at least 100 times；More often increase at least 500 times；And most frequently increase at least 1000 times；It is general to increase at least 5000 times；More typically increase at least 10,000 times；And most typically increase at least 50,000 times；And most frequently increase at least 100,000 times.

Technical staff will readily appreciate that, term " toxicity reduction gene " can cover mediation to the toxicity of host, pathology or virulence, The gene for growing in host or surviving in host, wherein the gene is to mitigate, reduce or eliminate toxicity, pathology or virulence Mode is mutated.It can be by comparing the virulence or toxicity mediated by mutator and by the virulence of not mutated (or parent) gene mediated Or toxicity assesses described reduce or eliminate." mutator " cover gene control region, gene coding region, gene noncoding region or Missing, point mutation and frameshift mutation in its arbitrary combination.In one embodiment, people experimenter is treated there is provided herein a kind of In anus neoplasm or vagina cancer method, the method includes to the subject apply include chemoradiotherapy therapy and recombination The step of conjoint therapy of Listeria bacterial strain, the Listeria bacterial strain include recombinant nucleic acid, and the nucleic acid is opened comprising first Put reading frame, the first open reading frame encoding recombinant polypeptide, the recombinant polypeptide include be fused to heterogenetic antigen or its The N-terminal segment of the LLO albumen of segment, to treat the anus neoplasm or anus cancer in the people experimenter.

In one embodiment, the fusion protein of the recombinant listeria bacterium expression N-terminal LLO and heterogenetic antigen.Another In one embodiment, which is human papilloma virus HPV-16 E7 (HPV-E7).In another embodiment, the HPV Antigen is HPVE6.

In one embodiment, patient received ADXS11-001 every 3 weeks at 12 weeks in treatment cycle.In another embodiment In, it is designed using 3+3 and carries out dosage escalation with 2 dosage：5×10⁹A colony forming unit (CFU；Dosage level 1) and 1 × 10¹⁰A CFU (dosage level 2).

In another embodiment, dose-limiting toxicity (DLT) rate observed based on ＜ 33% selects to recommend II phase dosage.

In one embodiment, patient receives 1 × 10⁹A colony forming unit (CFU) then receives subsequent for every 1 month Dosage.In another embodiment, patient receives 1 × 10⁹A colony forming unit (CFU) then receives subsequent for every 1 month Dosage continue 3 months.In one embodiment, curative effect is assessed using any method known in the art, the method includes But it is not limited to RECIST v1.1 and immune related RECIST.

In one embodiment, term " ADXS11-001 " and " ADXS-HPV " are used interchangeably herein, and are Refer to the listerisa monocytogenes in mjme comprising coding with the nucleic acid of the truncation LLO of HPV-E7 Antigen Fusions.

In one embodiment, provided herein is the chemoradiotherapy schemes being used in combination with recombinant listeria bacterium provided in this article Or chemoradiotherapy therapy.In another embodiment, chemoradiotherapy therapy provided herein includes mitomycin and fluorouracil (5- ) and radiotherapy FU.In another embodiment, chemoradiotherapy therapy provided herein includes cis-platinum and radiotherapy.Another In one embodiment, which includes any other chemotherapeutics known in the art, including but not limited to cyclophosphamide, Mustargen, Chlorambucil, melphalan, nitroso ureas, Temozolomide, mitomycin, fluorouracil, azacitidine, imuran, Capecitabine, cytarabine, doxifluridine, gemcitabine, hydroxycarbamide, purinethol, methotrexate (MTX) or thioguanine were (in the past Referred to as thioguanine).

In one embodiment, chemoradiotherapy therapy provided herein includes the cis-platinum using 2 courses for the treatment of and parallel radiotherapy (54Gy is divided into 30 times, intensity modulated radiation therapy).In another embodiment, the scheme or therapy include using the 2-4 course for the treatment of, Cis-platinum or the conjunction of the 4-6 course for the treatment of, the 6-8 course for the treatment of, the 8-10 course for the treatment of, the 10-12 course for the treatment of, the 12-14 course for the treatment of or 14-16 course for the treatment of Suitable medicament and parallel radiotherapy.In another embodiment, radiotherapy include 20-30Gy, 30-40Gy, 40-50Gy, 50-60Gy, 60-70Gy, 70-80Gy, 80-90Gy or 90-100Gy.In another embodiment, radiotherapy be divided into 10-20 times, 20-30 times, 30-40 times, 40-50 times, 50-60 times, 60-70 times, 70-80 times, 80-90 times or 90-100 times.Those skilled in the art will manage Solution, clinician can in entire particular treatment disclosed herein as needed adjustment be administered to subject dosage and when Between table.

In one embodiment, before the application recombinant listeria bacterium bacterial strain, subject receives average 1.5 (ranges 0-5) the systemic chemotherapy of item treatment line.

In one embodiment, chemoradiotherapy therapy disclosed herein applies the recombinant listeria bacterium bacterial strain in first time It applies before.In another embodiment, the chemoradiotherapy therapy is applied after the application recombinant listeria bacterium bacterial strain. In another embodiment, the chemoradiotherapy therapy is after the first time application recombinant listeria bacterium bacterial strain and one to three times It is applied before strengthening the application recombinant listeria bacterium bacterial strain.In another embodiment, the chemoradiotherapy therapy with it is described heavy Group Listeria bacterial strain is administered simultaneously.

In one embodiment, chemoradiotherapy scheme or chemoradiotherapy therapy disclosed herein include apply 2 courses for the treatment of suitable Platinum and parallel radiotherapy (54Gy is divided into 30 times, intensity modulated radiation therapy).

In one embodiment, radiation provided herein lasts about 6 weeks.In another embodiment, which continues 3 Week.In another embodiment, the radiation is for 4 weeks.In another embodiment, which continues 5 weeks.In another implementation In example, which continues 7 weeks.In another embodiment, which continues 8 weeks.In another embodiment, which continues 6-8 weeks.In another embodiment, which continues 4-6 weeks.In another embodiment, which continues 2-4 weeks.Another In one embodiment, which continues 8-10 weeks.

In another embodiment, disclosed herein is a kind of antitumor cell cytotoxic T cells caused in people experimenter to answer The method answered, the method includes applying conjoint therapy disclosed herein to the subject.

In one embodiment, disclosed herein is a kind of sides inducing the immune response in people experimenter to tumour or cancer Method, the method includes applying the recombinant listeria bacterium bacterial strain comprising recombinant nucleic acid to the subject, the nucleic acid Including the first open reading frame, the first open reading frame encoding recombinant polypeptide, the recombinant polypeptide are heterologous comprising being fused to Property antigen or its segment LLO albumen N-terminal segment, wherein the recombinant nucleic acid also include the second open reading frame, it is described Second open reading frame encoding mutant body prfA genes, to which induction is to the immune response of tumour or cancer.

In one embodiment, disclosed herein is a kind of method for treating the cancer in people experimenter, the method includes The step of recombinant listeria bacterium bacterial strain disclosed herein being applied to the subject.In another embodiment, the present invention carries It is disclosed herein heavy the method includes being applied to the subject for a kind of method for avoiding people experimenter from suffering from cervical carcinoma The step of group Listeria bacterial strain.In another embodiment, which expresses recombinant polypeptide.At another In embodiment, which includes the plasmid of encoding recombinant polypeptide.In another embodiment, this method is also wrapped Include the step of strengthening people experimenter with the recombinant listeria bacterium bacterial strain of the present invention.In another embodiment, this method further includes The step of strengthening people experimenter with the immunogenic composition comprising heterogenetic antigen disclosed herein or its segment.Another In a embodiment, this method further includes the steps that strengthening people experimenter with immunogenic composition, and the composition guides subject Cell express the heterogenetic antigen.In another embodiment, cell is tumour cell.In another embodiment, the party Method further includes the steps that strengthening people experimenter with vaccine disclosed herein or composition.

In one embodiment, the segment under the background of LLO albumen disclosed herein and ActA albumen refers to including The peptide or polypeptide of the amino acid sequence of at least five continuous amino acid residue of LLO or ActA albumen.In another embodiment, The term refers to comprising LLO or ActA albumen or at least ten continuous amino acid residue of polypeptide, at least 15 continuous amino acids Residue, at least 20 continuous amino acid residues, at least 25 continuous amino acid residues, at least 40 continuous amino acid residues, extremely Few 50 continuous amino acid residues, at least 60 continuous amino acid residues, at least 70 continuous amino acid residues, at least 80 companies Continuous amino acid residue, at least 90 continuous amino acid residues, at least 100 continuous amino acid residues, at least 125 continuous amino Sour residue, at least 150 continuous amino acid residues, at least 175 continuous amino acid residues, at least 200 continuous amino acids are residual Base, at least 250 continuous amino acid residues, at least 300 continuous amino acid residues, at least 350 continuous amino acid residues, extremely The peptide or polypeptide of the amino acid sequence of few 400 continuous amino acid residues or at least 450 continuous amino acid residues.

In another embodiment, which is the functional fragment be expected and played a role such as the present invention (for example, working as Cause to disease phase when in N-terminal LLO/ heterogenetic antigens fusion protein or N-terminal ActA/ heterogenetic antigen fusion protein forms Close the immune response of antigen).In another embodiment, which is functional, and form is nonfused.

The present invention provides the password of Listeria homologous nucleic acid or Listeria endogenous nucleic acid in certain embodiments Son optimization.The best codon used by listerisa monocytogenes in mjme for each amino acid is in U.S. Patent Publication It is shown in 2007/0207170, which is hereby incorporated by reference.If at least one of nucleic acid codon quilt Following codons are replaced, then nucleic acid is codon optimization：Listerisa monocytogenes in mjme is by the codon than original sequence Codon in row is more frequently used for the amino acid.

N-terminal LLO protein fragments and heterogenetic antigen directly merge into each other in another embodiment.In another implementation In example, the gene for encoding N-terminal LLO protein fragments and heterogenetic antigen directly merges into each other.In another embodiment, the ends N End LLO protein fragments are connected with heterogenetic antigen by joint peptide.In another embodiment, N-terminal LLO protein fragments and different Property antigen in source is connected by heterologous peptide.In another embodiment, N-terminal LLO protein fragments are the N-terminals of heterologous antigen. In another embodiment, N-terminal LLO protein fragments are the most N-terminal parts of fusion protein.

As disclosed herein, the recombinant listeria bacterium bacterial strain inducing antineoplastic immune of expression LLO- Antigen Fusion bodies (is implemented Example 1), cause T cells with antigenic specificity proliferation (embodiment 2), generate antigentic specificity and tumor infiltrating T cell (embodiment 3).Therefore, vaccine of the invention effectively immune response of the induction to E7 and E6.

In another embodiment, the present invention provides a kind of method for treating the cervical carcinoma in people experimenter, the sides Method includes the steps that subject's administered recombinant Listeria bacterial strain, and the recombinant listeria bacterium bacterial strain contains LLO The recombinant polypeptide of the N-terminal segment and HPV HPV-16 E7s of albumen, thus the recombinant listeria bacterium bacterial strain inducing is to HPV-16 E7 Immune response, to treat the cervical carcinoma in people experimenter.In another embodiment, recombinant listeria bacterium bacterial strain expression weight Group polypeptide.In another embodiment, which includes the plasmid of encoding recombinant polypeptide.

In another embodiment, disclosed herein is a kind of method for avoiding people experimenter from suffering from cervical carcinoma, the methods Include the steps that subject's administered recombinant Listeria bacterial strain, the recombinant listeria bacterium bacterial strain includes to contain LLO eggs The recombinant polypeptide of white N-terminal segment and HPV HPV-16 E7s, thus the recombinant listeria bacterium bacterial strain inducing HPV-16 E7 is exempted from Epidemic disease response, to avoid people experimenter from suffering from cervical carcinoma.In another embodiment, recombinant listeria bacterium bacterial strain expression recombination Polypeptide.In another embodiment, which includes the plasmid of encoding recombinant polypeptide.

In another embodiment, disclosed herein is a kind of sides inducing the immune response in people experimenter to cervical carcinoma Method, the method includes the step of to subject's administered recombinant Listeria bacterial strain, the recombinant listeria bacterium bacterial strain packets Recombinant polypeptide containing N-terminal segment and HPV HPV-16 E7s containing LLO albumen, exempts from cervical carcinoma to induce in people experimenter Epidemic disease response.In another embodiment, which expresses recombinant polypeptide.In another embodiment, this is heavy Group Listeria bacterial strain includes the plasmid of encoding recombinant polypeptide.

In another embodiment, disclosed herein is a kind of method for treating the cervical carcinoma in people experimenter, the methods Include the steps that subject's administered recombinant Listeria bacterial strain, the recombinant listeria bacterium bacterial strain includes to contain ActA eggs The recombinant polypeptide of white N-terminal segment and heterogenetic antigen, thus the recombinant listeria bacterium bacterial strain inducing is to heterogenetic antigen Immune response, to treat the cervical carcinoma in people experimenter.In another embodiment, which expresses Recombinant polypeptide.In another embodiment, which includes the plasmid of encoding recombinant polypeptide.

In another embodiment, disclosed herein is a kind of method for avoiding people experimenter from suffering from cervical carcinoma, the methods Include the steps that subject's administered recombinant Listeria bacterial strain, the recombinant listeria bacterium bacterial strain includes to contain ActA eggs The recombinant polypeptide of white N-terminal segment and heterogenetic antigen, thus the recombinant listeria bacterium bacterial strain inducing is to heterogenetic antigen Immune response, to avoid people experimenter from suffering from cervical carcinoma.In another embodiment, which expresses Recombinant polypeptide.In another embodiment, which includes the plasmid of encoding recombinant polypeptide.

In another embodiment, disclosed herein is a kind of sides inducing the immune response in people experimenter to cervical carcinoma Method, the method includes the step of to subject's administered recombinant Listeria bacterial strain, the recombinant listeria bacterium bacterial strain packets Recombinant polypeptide containing N-terminal segment and heterogenetic antigen containing heterologous protein, to induce in people experimenter to cervical carcinoma Immune response.In another embodiment, which expresses recombinant polypeptide.In another embodiment, The recombinant listeria bacterium bacterial strain includes the plasmid of encoding recombinant polypeptide.

N-terminal ActA protein fragments and heterogenetic antigen directly merge into each other in another embodiment.In another reality It applies in example, the gene for encoding N-terminal ActA protein fragments and heterologous antigen directly merges into each other.In another embodiment, the ends N End ActA protein fragments are connected with heterogenetic antigen by joint peptide.In another embodiment, N-terminal ActA protein fragments and Heterologous antigen is connected by heterologous peptides.In another embodiment, N-terminal ActA protein fragments are the N-terminals of heterologous antigen. In another embodiment, N-terminal ActA protein fragments are the most N-terminal parts of fusion protein.

In another embodiment, disclosed herein is a kind of sides inducing the immune response in people experimenter to cervical carcinoma Method, the method includes the step of to subject's administered recombinant Listeria bacterial strain, the recombinant listeria bacterium bacterial strain packets Containing recombinant polypeptide, the recombinant polypeptide includes the peptide and heterogenetic antigen of the amino acid sequence containing PEST, thus the recombination Li Si Special bacteria strain induces the immune response to heterogenetic antigen, to treat the cervical carcinoma in people experimenter.In another embodiment In, which expresses recombinant polypeptide.In another embodiment, which includes coding The plasmid of recombinant polypeptide.In another embodiment, this method avoids people experimenter from suffering from cervical carcinoma.In another embodiment In, this method treats the cervical carcinoma in the people experimenter.

The peptide and heterogenetic antigen of the amino acid sequence containing PEST directly merge into each other in another embodiment.At another In embodiment, the gene of the peptide and heterogenetic antigen that encode the amino acid sequence containing PEST directly merges into each other.In another implementation In example, the peptide of the amino acid sequence containing PEST is connected with heterogenetic antigen by joint peptide.In another embodiment, ammonia containing PEST The peptide of base acid sequence is connected with heterogenetic antigen by heterologous peptide.In another embodiment, containing PEST amino acid sequence Peptide is the N-terminal of heterogenetic antigen.In another embodiment, the peptide of the amino acid sequence containing PEST is the ends most N of fusion protein End part.

In another embodiment, vaccine inoculation being carried out to prevent the method for HPV, institute to people experimenter disclosed herein is a kind of The method of stating includes the steps that applying recombinant listeria bacterium bacterial strain provided in this article to the subject, wherein the Listeria It expresses HPV HPV-16 E7s and the wherein described Listeria expresses mutant prfA genes.In another embodiment, the mutation Body prfA genes are D133V prfA mutation.In another embodiment, mutant prfA genes are in the recombination Liszt In plasmid in bacterium.In another embodiment, which expresses recombinant polypeptide.In another embodiment In, which includes the plasmid of encoding recombinant polypeptide.

In another embodiment, subject, which is in, occurs in canceration (for example, cervical carcinoma) risk that HPV is mediated.Another In one embodiment, subject is HPV positive.In another embodiment, subject shows cervical intraepithelial neoplasia sample disease Become.In another embodiment, subject shows squamous intraepithelial lesion.In another embodiment, subject shows Dysplasia of cervix.

HPV for the target of the method for the present invention is HPV 16 in another embodiment.In another embodiment, should HPV is HPV-18.In another embodiment, which is selected from HPV-16 and HPV-18.In another embodiment, which is HPV-31.In another embodiment, which is HPV-35.In another embodiment, which is HPV-39.At another In embodiment, which is HPV-45.In another embodiment, which is HPV-51.In another embodiment, the HPV For HPV-52.In another embodiment, which is HPV-58.In another embodiment, which is high risk HPV types. In another embodiment, which is mucous membrane HPV types.

In another embodiment, disclosed herein is a kind of sides carrying out vaccine inoculation to people experimenter for purpose antigen Method, the method includes intravenously applying comprising or express the recombinant listeria bacterium bacterium of the purpose antigen to the people experimenter The step of strain, wherein the first peptide be selected from the N-terminal segment of (a) LLO albumen, (b) amino acid sequence containing PEST peptide, to be directed to Purpose antigen carries out vaccine inoculation to people experimenter.

In another embodiment, disclosed herein is a kind of sides carrying out vaccine inoculation to people experimenter for purpose antigen Method, the method includes intravenously applying immunogenic composition to the people experimenter, the composition includes the The fusion of one peptide and the purpose antigen, wherein first peptide is selected from the N-terminal segment of (a) LLO albumen and (b) contains PEST The peptide of amino acid sequence, to carry out vaccine inoculation to people experimenter for purpose antigen.

In another embodiment, disclosed herein is a kind of sides carrying out vaccine inoculation to people experimenter for purpose antigen Method, the method includes intravenously applying the recombinant listeria bacterium bacterial strain comprising recombinant polypeptide to the people experimenter, The recombinant polypeptide includes the first peptide for being fused to the purpose antigen, wherein first peptide is selected from the ends N of (a) LLO albumen The peptide of end fragment and (b) amino acid sequence containing PEST, to carry out vaccine inoculation to people experimenter for purpose antigen.

In another embodiment, disclosed herein is the CTL responses that purpose antigen is directed in a kind of induction people experimenter Method, the method includes applying comprising or express the recombinant listeria bacterium bacterial strain of the purpose antigen to the people experimenter Step, to induce the CTL responses for being directed to purpose antigen in people experimenter.In another embodiment, step of applying is vein Interior application.

In another embodiment, disclosed herein is the method that the cancer in a kind of induction subject subsides, the methods Include the steps that applying recombinant listeria bacterium bacterial strain disclosed herein to the subject.

In another embodiment, disclosed herein is the sides of a kind of incidence of the cancer in reduction subject or recurrence rate Method, the method includes applying recombinant listeria bacterium bacterial strain disclosed herein to the subject.

In another embodiment, described disclosed herein is a kind of method that the tumour inhibited in subject is formed of offer Method includes the steps that applying recombinant listeria bacterium bacterial strain disclosed herein to the subject.

In another embodiment, disclosed herein is a kind of method of the cancer remission in induction subject, the methods Include the steps that applying recombinant listeria bacterium bacterial strain disclosed herein to the subject.

In another embodiment, disclosed herein is a kind of method checking the tumour growth in people experimenter, the sides Method includes the steps that applying recombinant listeria bacterium bacterial strain disclosed herein to the subject.

In another embodiment, disclosed herein is a kind of method of the tumor size in reduction subject, the methods Include the steps that applying recombinant listeria bacterium bacterial strain disclosed herein to the subject.

In one embodiment, disease is infectious diseases, autoimmune disease, respiratory disorder, precancerosis disease or cancer.

Technical staff will readily appreciate that term " precancerosis disease " can cover dysplasia, anterior tubercle occurs for tumour；Greatly again Raw tubercle (MRN)；Low level dysplasia tubercle (LG-DN)；High-level dysplasia tubercle (HG-DN)；Epithelial duct is developed It is abnormal；The liver cell lesion that makes a variation (FAH)；Nodules of altered hepatocytes (NAH)；Chromosome imbalance；Telomerase abnormal activation；Telomerase Catalytic subunit expresses again；The expression of endothelial cell marker object such as CD31, CD34 and BNH9 are (see, for example, Terracciano With Tomillo (2003) Pathologica 95：71-82；Su and Bannasch (2003) Toxicol.Pathol.31：126- 133；Rocken and Carl-McGrath (2001) Dig.Dis.19：269-278；Kotoula et al. (2002) Liver 22： 57-69；Frachon et al. (2001) J.Hepato1.34：850-857；Shimonishi et al. (2000) J.Hepatobiliary Pancreat.Surg.7：542-550；Nakanuma et al. (2003) J.Hepatobiliary Pancreat.Surg.10：265-281).Diagnosis cancer and dysplastic method are disclosed (see, for example, Riegler (1996)Semin.Gastrointest.Dis.7：74-87；Benvegnu et al. (1992) Liver 12：80-83； Giannini et al. (1987) Hepatogastroenterol.34：95-97；Anthony(1976)Cancer Res.36： 2579-2583)。

In one embodiment, infectious diseases is by any of following pathogen but to be not limited to caused by them Infectious diseases：It is BCG/ tuberculosis, malaria, plasmodium falciparum, malariae, Plasmodium vivax, rotavirus, cholera, white Larynx-lockjaw, pertussis, haemophilus influenzae, hepatitis B, human papilloma virus, seasonal influenza), A types influenza (H1N1) Epidemic disease, measles and rubella, parotitis, meningococcus A+C, oral polio vaccine (unit price, divalent and trivalent), lung Scorching coccus, rabies, tetanus toxoid, yellow fever, Bacillus anthracis (anthrax), clostridium botulinum toxin (meat Poison poisoning), yersinia pestis (pestilence), variola major (smallpox) and other related poxvirus, francisella tularensis (tularemia), viral hemorrhagic fever, arenavirus (LCM, Junin virus, machupo virus, guanarito virus, draw sand Heat), bunyavirus (Hantavirus, Rift Valley fever), Flavivirus (dengue fever), filamentous form virus (Ebola virus, Marburg Virus), Burkholderia Pseudomallei, Bai Neite Coxs body (Q heat), Brucella kind (brucellosis), glanders primary Ke Huoerde bacterium (glanders), ornithosis virus (psittacosis), ricin toxin (coming from castor-oil plant), the ε of C.perfringens are malicious Element, staphylococcal enterotoxin B, typhus hot (Rickettsia prowazeki), other Richettsia, food and water-borne cause of disease Body, bacterium (cause diarrhoeal Escherichia coli, pathogenic vibrio, Shigella kind, Salmonella BCG/, jejunum curved Curved bar bacterium, yersinia enterocolitica), virus (calicivirus, hepatitis A, west nile virus, LaCrosse, Jia Lifu Buddhist nun Asia encephalitis, VEE, EEE, WEE, japanese encephalitis virus, Kyasanur forest virus, Nipah virus, Hantavirus, tick outflow Fever virus cuts elder brother's tribute subviral, crimean-Congo hemorrhagic fever virus, tick-brone encephalitis virus, hepatitis type B virus, the third type Hepatitis virus, herpes simplex virus (HSV), human immunodeficiency virus (HIV), human papilloma virus (HPV), protozoan (small Cryptosporidium, cyclospora cayatanesis, giardia lamblia, Entamoeba histolytica, toxoplasma), fungi (Microsporida), Yellow fever, tuberculosis (including drug resistant TB), rabies, prion, the relevant coronavirus of serious acute respiratory syndrome (SARS-CoV), Coccidioides posadasii, posadasis spheriforme, bacterial vaginosis BV, chlamydia trachomatis, giant cell disease Poison, granuloma inguinale, haemophilus ducreyi, neisseria gonorrhoeae, Spirochaeta pallida, trichomonas vaginalis or this field are Any other infectious diseases that do not list herein known.

In another embodiment, which is animal infection disease.In another embodiment, domestic animal disease Disease can be broadcast to people, and be referred to as " zoonosis ".In another embodiment, these diseases include but not limited to mouth hoof Epidemic disease, west nile virus, rabies, canine parvovirus, feline leukaemia virus, equine influenza virus, infectious bovine rhinotracheitis (IBR), pseudoabies, classic swine fever (CSF), IBR and pig puppet are mad as caused by infecting 1 type bovine herpes virus (BHV-1) of ox Dog disease (Aujeszky disease), toxoplasmosis, anthrax, vesicular stomatitis virus, Rhodococcus equi, tularemia, pestilence (plague Yale Gloomy bacterium), trichmonad.

In one embodiment, disease provided herein is cancer or tumour.In one embodiment, which is carcinous 's.In another embodiment, which is breast cancer.In another embodiment, which is cervical carcinoma.In another reality It applies in example, which is cancer containing Her2.In another embodiment, which is melanoma.In another embodiment, should Cancer is cancer of pancreas.In another embodiment, which is oophoroma.In another embodiment, which is gastric cancer. In another embodiment, which is the cancerous lesion of pancreas.In another embodiment, which is adenocarcinoma of lung.Another It is glioblastoma multiforme in a embodiment.In another embodiment, which is Colon and rectum gland cancer.Another In a embodiment, which is lung squamous cancer.In another embodiment, which is sdenocarcinoma of stomach.In another embodiment, should Cancer is Ovarian surface epithelium tumour (such as its benign, proliferative or pernicious type).In another embodiment, should Cancer is oral squamous cell carcinoma.In another embodiment, which is non-small cell lung cancer.In another embodiment, The cancer is carcinoma of endometrium.In another embodiment, which is carcinoma of urinary bladder.In another embodiment, which is Head and neck cancer.In another embodiment, which is prostate cancer.In another embodiment, which is oropharyngeal cancer.Another In one embodiment, which is lung cancer.In another embodiment, which is cancer of anus.In another embodiment, should Cancer is colorectal cancer.In another embodiment, which is cancer of the esophagus.The cervix neoplasms of the method targeting of the present invention exist It is squamous cell carcinoma in another embodiment.In another embodiment, which is gland cancer.In another embodiment In, which is adenosquamous carcinoma.In another embodiment, which is small cell carcinoma.In another embodiment, The cervix neoplasms are known in the art the cervix neoplasms of any other type.

In one embodiment, antigen provided in this article is heterologous tumour antigen, herein also referred to as " tumour is anti- Former, " antigenic polypeptide " or " exogenous antigen ".In another embodiment, the antigen is anti-for human papilloma virus E7 (HPV-E7) Original comes from HPV16 (in one embodiment, GenBank accession number AAD33253), in another reality in one embodiment It applies and comes from HPV18 (in one embodiment, GenBank accession number P06788) in example.In another embodiment, the antigenicity Polypeptide is HPV-E6, in one embodiment come from HPV16 (in one embodiment, GenBank accession number AAD33252, AAM51854, AAM51853 or AAB67615), HPV18 (in one embodiment, GenBank are come from another embodiment Accession number P06463).In another embodiment, which is Her/2-neu antigens.In another embodiment, The antigenic polypeptide be prostate-specific antigen (PSA) (in one embodiment GenBank accession number CAD30844, CAD54617, AAA58802 or NP_001639).In another embodiment, which is cuticula chymotrypsin protein Enzyme (SCCE) antigen (in one embodiment, GenBank accession number AAK69652, AAK69624, AAG33360, AAF01139 Or AAC37551).In another embodiment, which is Wilms tumour antigens 1, in another embodiment For WT-1 Telomerases (GenBank accession number P49952, P22561, NP_659032, CAC39220.2 or EAW68222.1). In another embodiment, the antigenic polypeptide be hTERT or Telomerase (GenBank accession number NM003219 (variant 1), NM198255 (variant 2), NM 198253 (variant 3) or NM 198254 (variant 4).In another embodiment, the antigenicity Polypeptide is protease 3 (in one embodiment, GenBank accession number M29142, M75154, M96839, X55668, NM 00277, M96628 or X56606).In another embodiment, which is tyrosinase related protein1 (TRP2) (in one embodiment, GenBank accession number NP_001913, ABI73976, AAP33051 or Q95119).In another reality It applies in example, which is that (in one embodiment, GenBank is stepped on high molecular weight melanoma associated antigen (HMW-MAA) Record NP_001888, AAI28111 or AAQ62842).In another embodiment, the antigenic polypeptide be Testisin ( In one embodiment, GenBank accession number AAF79020, AAF79019, AAG02255, AAK29360, AAD41588 or NP_ 659206).In another embodiment, which is that (in one embodiment, GenBank is stepped on NY-ESO-1 antigens Record CAA05908, P78358, AAB49693 or NP_640343).In another embodiment, which is PSCA (in one embodiment, GenBank accession number AAH65183, NP_005663, NP_082492, O43653 or CAB97347). In another embodiment, which is 13 receptor alpha (in one embodiment, GenBank accession number of interleukin (IL) NP_000631, NP_001551, NP_032382, NP_598751, NP_001003075 or NP_999506).In another implementation Example in, the antigenic polypeptide be carbonic anhydrase IX (CAIX) (in one embodiment, GenBank accession number CAI13455, CAI10985, EAW58359, NP_001207, NP_647466 or NP_001101426).In another embodiment, the antigen Property polypeptide be carcinomebryonic antigen (CEA) (in one embodiment, GenBank accession number AAA66186, CAA79884, CAA66955, AAA51966, AAD15250 or AAA51970).In another embodiment, which is that MAGE-A (is implemented at one In example, GenBank accession number NP_786885, NP_786884, NP_005352, NP_004979, NP_005358 or NP_ 005353).In another embodiment, the antigenic polypeptide plain (in one embodiment, GenBank accession number for survival AAC51660, AAYl5202, ABF60110, NP_001003019 or NP_001082350).In another embodiment, this is anti- Antigenic polypeptide is GP100 (in one embodiment, GenBank accession number AAC60634, YP_655861 or AAB31176). In another embodiment, which is known in the art any other antigenic polypeptide.In another embodiment, The antigenic peptide of the compositions and methods of the invention includes the immunogenic portion of the antigenic polypeptide.

In another embodiment, which is HPV-E6.In another embodiment, which is Telomerase (TERT).In another embodiment, which is LMP-1.In another embodiment, which is p53.In another reality It applies in example, which is mesothelin.In another embodiment, which is EGFRVIII.In another embodiment, this is anti- Originally it was carbonic anhydrase IX (CAIX).In another embodiment, which is PSMA.In another embodiment, which is HMW-MAA.In another embodiment, which is HIV-1Gag.In another embodiment, which is tyrosinase phase Close albumen 2.In another embodiment, the antigen be selected from HPV-E7, HPV-E6, Her-2, HIV-1Gag, LMP-1, p53, PSMA, carcinomebryonic antigen (CEA), LMP-1, kallikrein correlation peptase 3 (KLK3), KLK9, Muc, tyrosinase-related protein 2, Muc1, FAP, IL-13R α 2, PSA (prostate-specific antigen), gp-100, heat shock protein 70 (HSP-70), β-HCG, EGFR-III, granulocyte colony stimulating factor (G-CSF), angiogenin, angiogenesis hormone -1, Del-1, fibroblast Growth factor：Acid (aFGF) or alkaline (bFGF), follistatin, granulocyte colony stimulating factor (G-CSF), hepatic cell growth The factor (HGF)/dispersion factor (SF), interleukin 8 (IL-8), leptin, Midkine, placenta growth factor, blood platelet spread out Raw endothelial growth factor (PD-ECGF), platelet-derived growth factor-BB (PDGF-BB), multiple effect growth factor (PTN), Progranulin, proliferating agent, transforminggrowthfactor-α (TGF- α), transforming growth factor-β (TGF-β), tumor necrosis factor- α (TNF-α), vascular endothelial growth factor (VEGF)/vasopermeable factor (VPF), VEGFR, VEGFR2 (KDR/FLK-1) or its Segment, FLK-1 or its epitope, FLK-E1, FLK-E2, FLK-I1, endothelial factor or its segment, neural pilin 1 (NRP-1), Angiogenesis hormone -1 (Ang1), Tie2, platelet derived growth factor (PDGF), platelet derived growth factor receptor (PDGFR), transforming growth factor-β (TGF-β), endothelial factor, TGF-β receptor, monocyte chemoattractant protein-1 (MCP-1), VE- cadherins, CD31, ephrin, ICAM-1, V-CAM-1, VAP-1, E-Selectin, activator of plasminogen, plasminogen Activator inhibitor -1, COX-2, AC133 or Id1/Id3, angiogenesis hormone 3, promotees blood vessel life at nitricoxide synthase (NOS) At element 4, angiogenesis hormone 6, CD105, EDG, HHT1, ORW, ORW1 or TGF β co-receptors or combination thereof.At another In embodiment, the antigen is that Her2 antigens are fitted into disclosed in U.S. Patent Application Publication No.2011/0142791, by drawing It is incorporated herein with by the full patent texts.The use of the segment of antigen disclosed herein is also covered by the present invention.

In another embodiment, heterologous tumour antigen provided in this article is tumor associated antigen, in a reality It is one of following tumour antigen to apply in example：MAGE (melanoma associated antigen E) albumen, for example, MAGE 1, MAGE 2, MAGE 3, MAGE 4, tyrosinase；Mutant ras albumen；Mutation p 53 protein；P97 melanoma antigens and the relevant ras of advanced cancer Peptide or p53 peptides；To relevant 16/18 antigens of HPV of cervical carcinoma, with relevant KLH antigens of breast cancer, related with colorectal cancer CEA (carcinomebryonic antigen), with the relevant MART1 antigens of melanoma or with the relevant PSA antigens of prostate cancer.In another implementation It is melanoma associated antigen for composition provided herein and the antigen of method in example, is TRP- in one embodiment 2, MAGE-1, MAGE-3, gp-100, tyrosinase, HSP-70, β-HCG or combination thereof.It should be appreciated that technical staff's energy It will enough not mention herein but any heterologous antigen known in the art be used in method and composition provided herein.It should also manage Solution, the present invention provide but are not limited to encode the attenuation Listeria of the nucleic acid of at least one antigen disclosed herein.This The mutant for encoding disclosed antigen, mutain, splice variant, segment, truncated variant, soluble change are covered in invention The nucleic acid of body, extracellular domain, Intracellular domain, mature sequence etc..Provide the nucleic acid of the epitope, oligopeptides and polypeptide that encode these antigens. The embodiment of codon optimization is additionally provided, that is, is directed to the expression in Listeria and optimizes.Cited bibliography, GenBank accession number and nucleic acid disclosed herein, peptide and polypeptide are integrally herein incorporated by reference.In another reality Apply in example, selected nucleic acid sequence codified overall length or truncated gene, fusion or label gene, and can be cDNA, Genomic DNA or DNA fragmentation, preferably cDNA.It can be mutated or otherwise modify as needed.These modifications include close Numeral optimizes to optimize use of the codon in selected host cell or bacterium i.e. Listeria.Selected sequence can also be compiled Code secretion, cytoplasmic, nucleus, film combination or cell surface polypeptide.

In one embodiment, vascular endothelial growth factor (VEGF) is important participation angiogenesis (embryo's cyclic system The formation of system) and angiogenesis (from existing vascular system grow blood vessel) signal protein.In one embodiment, VEGF activity Be limited primarily to the cell of blood vessel endothelium, although its to other cell types of limited quantity have effect (such as stimulation monocyte/ Macrophage migration).VEGF has shown that stimulating endothelial cell mitosis and cell migration in vitro.VEGF also enhances micro- blood Pipe permeability, and also sometimes referred to as vascular permeability factor.

In one embodiment, all members of VEGF families stimulate cell response, this passes through on combination cell surface Tyrosine kinase receptor (VEGFR), lead to their dimerizations and be activated via transphosphorylation to realize.The VEGF by Body has the extracellular portion being made of 7 immunoglobulin-like domains, single transmembrane region and containing the tyrosine kinase domain separated Intracellular part.

In one embodiment, VEGF-A is VEGFR-2 (KDR/Flk-1) ligands and VEGFR-1 (Flt-1) ligand. In one embodiment, VEGFR mediates the known cell response to VEGF of almost all.The function of VEGFR-1 is less clear, Although think in one embodiment its by be isolated VEGF and VEGFR-2 in conjunction with by adjust VEGFR-2 signal transductions, at one In embodiment, this is even more important during the angiogenesis of embryo.In one embodiment, VEGF-C and VEGF-D are The ligand of VEGFR-3 receptors, the VEGFR-3 receptors mediate lymphatic vessel generation in one embodiment.

In one embodiment, composition of the invention includes vegf receptor or its segment, is in one embodiment VEGFR-2 is in another embodiment VEGFR-1, and is VEGFR-3 in another embodiment.

In one embodiment, VEGF R2 (VEGFR2) is high on the endothelial cell (EC) of activation Express and participate in the formation of new blood vessel.In one embodiment, all 5 isotypes of VEGFR2 combinations VEGF.In a reality It applies in example, signal transduction proliferative induction, migration and final differentiation of the VEGF via VEGFR2 on EC.In one embodiment In, the mouse homologue of VEGFR2 is fetal livers kinase gene -1 (Flk-1), is strong therapeutic targets, and in tumour growth, enter It invades and plays an important role in shifting.In one embodiment, VEGFR2 is also referred to as kinase insert domain receptor (type III receptor junket ammonia Acid kinase) (KDR), differentiation group 309 (CD309), FLK1, Ly73, Krd-1, VEGFR, VEGFR-2 or 6130401C07.

In one embodiment, antigen is originated from fungal pathogens, bacterium, parasite, worm or virus.In another implementation In example, which is selected from tetanus toxoid, hemagglutinin molecule, diphtheria toxoid, HIV gp120, HIV from influenza virus Gag albumen, IgA protease, insulin peptide B, powdery scab of potato bacterium (Spongospora subterranea) antigen, vibrios Antigen, salmonella (Salmonella) antigen, pneumococcal antigens, respiratory syncytial virus (RSV) antigen, haemophilus influenzae How are (Haemophilus influenza) outer membrane protein, helicobacter pylori (Helicobacter pylori) urase, meningitis Plucked instrument coccus (Neisseria meningitidis) pilin, NEISSERIA GONORRHOEAE (N.gonorrhoeae) pilin, melanocyte Tumor related antigen (TRP-2, MAGE-1, MAGE-3, gp-100, tyrosinase, MART-1, HSP-70, β-HCG) comes from HPV- 16, the human papillomavirus antigen E1 and E2 of HPV-18, HPV-31, HPV-33, HPV-35 or HPV-45 type human papilloma virus, P53 albumen, Mucl or the pSA of tumour antigen CEA, mutation either the ras albumen of other forms, mutation or other forms.

In other embodiments, antigen is related to one of following disease：Cholera, diphtheria, haemophilus, hepatitis A, second Type hepatitis, influenza, measles, meningitis, parotitis, pertussis, smallpox, pneumococcal pneumonia, polioencephalitis, rabies, rubella, Lockjaw, pulmonary tuberculosis, typhoid fever, varicella-zoster, pertussis, yellow fever, the immunogene from Addison's disease and antigen, It is allergy, allergic reaction, bruton syndrome, cancer including entity and blood-born tumor, eczema, Hashimoto's thyroiditis, more Myositis, dermatomyositis, type 1 diabetes, acquired immunodeficiency syndrome, graft rejection, such as kidney, heart, pancreas, lung, bone With the more arteries of panarteritis, nodositas under liver allograft, Graves disease, polyendocrine autoimmune disease, hepatitis, microscope Inflammation, pemphigus, primary biliary cirrhosis, pernicious anaemia, chylous diarrhea, antibody-mediated ephritis, glomerulonephritis, rheumatism It is disease, systemic lupus erythematosus, rheumatoid arthritis, seronegativity spondyloarthropathy, rhinitis, Sjogren syndromes, systemic Sclerosis, sclerosing cholangitis, Wei Genashi granulomas, dermatitis herpetiformis, psoriasis, leucoderma, multiple sclerosis, brain ridge It is marrow inflammation, Guillain-Barre＆1＆ syndrome, myasthenia gravis, Lambert-Eaton syndrome, sclera, episclera, Uveitis, chronic The chain high IgM syndromes of mucocutaneous candidiasis, rubella, transient hypogammaglobulinemia of infancy, myeloma, X-, this Ke Te-aldrich's syndrome, ataxia telangiectasia, autoimmune hemolytic anemia, autoimmunity Property thrombopenia, autoimmune neutropenia, waldenstrom macroglobulinemia, amyloidosis, Chronic lymphocytic leukemia, non-Hodgkin lymphoma, plasmodium falciparum circumsporozoite protein, microbial antigen, viral antigen, Autoantigen and listeriosis.

In another embodiment, in the immune response for treating cervical carcinoma, defence cervical carcinoma or induction to cervical carcinoma The present invention method in, instead of HPV-16 E7 or as its supplement, use HPV E6 antigens.

In another embodiment, in the immune response for treating cervical carcinoma, defence cervical carcinoma or induction to cervical carcinoma Method disclosed herein in, instead of LLO segments or as its supplement, use ActA protein fragments.

In another embodiment, in the immune response for treating cervical carcinoma, defence cervical carcinoma or induction to cervical carcinoma The present invention method in, instead of LLO segments or as its supplement, use the protein fragments of the amino acid sequence containing PEST.

In another embodiment, the present invention provides a kind of anti-E7 cytotoxic T cells (CTL) induced in people experimenter The method of response, this method include the steps that the recombinant listeria bacterium bacterial strain packet to subject's administered recombinant Listeria bacterial strain Recombinant polypeptide containing N-terminal segment and HPV HPV-16 E7s containing LLO albumen, to induce the anti-E7CTL in people experimenter to answer It answers.In another embodiment, which includes the plasmid of encoding recombinant polypeptide.In another embodiment In, this method further includes the steps that strengthening subject with the recombinant listeria bacterium bacterial strain of the present invention.In another embodiment, should Method further includes the steps that strengthening subject with the immunogenic composition comprising HPV-16 E7.In another embodiment, the party Method further includes the steps that strengthening subject with immunogenic composition, and the composition guides the cell of subject to express HPV-16 E7. In another embodiment, CTL responses can generate therapeutic efficacy to disease, obstacle or the symptom that HPV is mediated.At another In embodiment, CTL responses can generate preventative effect to disease, obstacle or the symptom that HPV is mediated.

In another embodiment, the present invention provides treatment or improves disease, obstacle or disease that the HPV in subject is mediated The method of shape, the method includes the step of to subject's administered recombinant Listeria bacterial strain, the recombinant listeria bacteriums Bacterial strain includes the recombinant polypeptide of N-terminal segment and HPV HPV-16 E7s containing LLO albumen, thus the recombinant listeria bacterium bacterial strain The immune response to HPV-16 E7 is induced, disease, obstacle or the symptom mediated to the HPV for treating or improving in subject.Another In one embodiment, subject is people experimenter.In another embodiment, subject is non-human subject.In another reality It applies in example, subject is the subject of any other type known in the art.

It is HPV 16 in another embodiment to lead to the HPV of disease, obstacle or symptom.In another embodiment, should HPV is HPV-18.In another embodiment, which is HPV-31.In another embodiment, which is HPV-35. In another embodiment, which is HPV-39.In another embodiment, which is HPV-45.In another embodiment, The HPV is HPV-51.In another embodiment, which is HPV-52.In another embodiment, which is HPV-58. In another embodiment, which is high risk HPV types.In another embodiment, which is mucous membrane HPV types.

In another embodiment, disease, obstacle or the symptom that HPV is mediated are genital wart.In another embodiment, Disease, obstacle or the symptom that HPV is mediated are non-genital wart.In another embodiment, disease, obstacle or the disease that HPV is mediated Shape is respiratory tract papilloma.In another embodiment, disease, obstacle or the symptom that HPV is mediated are known in the art any Disease, obstacle or the symptom that other HPV are mediated.

In another embodiment, for treating or improving HPV mediations disease, obstacle or symptom it is disclosed herein Method in, instead of HPV-16 E7 or as its supplement, use HPV E6 antigens.

In another embodiment, for treating or improving HPV mediations disease, obstacle or symptom it is disclosed herein Method in, instead of LLO segments or as its supplement, use ActA protein fragments.

In another embodiment, for treating or improving HPV mediations disease, obstacle or symptom it is disclosed herein Method in, instead of LLO segments or as its supplement, use the protein fragments of the amino acid sequence containing PEST.

The antigen of method disclosed herein and composition is HPV E7 albumen in another embodiment.In another reality It applies in example, which is HPV E6 albumen.In another embodiment, which is known in the art any other HPV egg In vain.

" HPV-16 E7 " refers to E7 albumen in another embodiment.In another embodiment, which refers to E7 segments. In another embodiment, which refers to HPV-16 E7.In another embodiment, the term refer to it is known in the art it is any its The HPV-16 E7 of his type.

The E7 albumen of method disclosed herein and composition is 16 E7 albumen of HPV in another embodiment.Another In one embodiment, which is HPV-18E7 albumen.In another embodiment, which is HPV-31E7 albumen. In another embodiment, which is HPV-35E7 albumen.In another embodiment, which is HPV-39E7 eggs In vain.In another embodiment, which is HPV-45E7 albumen.In another embodiment, which is HPV- 51E7 albumen.In another embodiment, which is HPV-52 E7 albumen.In another embodiment, which is HPV-58E7 albumen.In another embodiment, which is high risk HPV type E7 albumen.In another embodiment, should E7 albumen is mucous membrane HPV type E7 albumen.

" E6 antigens " refers to E6 albumen in another embodiment.In another embodiment, which refers to E6 segments. In another embodiment, which refers to E6 peptides.In another embodiment, the term refer to it is known in the art it is any its The E6 antigens of his type.

The E6 albumen of method disclosed herein and composition is 16 E6 albumen of HPV in another embodiment.Another In one embodiment, which is HPV-18 E6 albumen.In another embodiment, which is HPV-31E6 albumen. In another embodiment, which is HPV-35 E6 albumen.In another embodiment, which is HPV-39 E6 Albumen.In another embodiment, which is HPV-45 E6 albumen.In another embodiment, which is HPV- 51E6 albumen.In another embodiment, which is HPV-52 E6 albumen.In another embodiment, which is HPV-58 E6 albumen.In another embodiment, which is high risk HPV type E6 albumen.In another embodiment, The E6 albumen is mucous membrane HPV type E6 albumen.

The immune response of the method and composition induction of the present invention is t cell response in another embodiment.Another In a embodiment, immune response includes t cell response.In another embodiment, which is CD8⁺T cell response.Another In one embodiment, which includes CD8⁺T cell response.

The N-terminal LLO protein fragments of the method and composition of the present invention include SEQ ID No in another embodiment： 2.In another embodiment, which includes LLO signal peptides.In another embodiment, which includes SEQ ID No： 2.In another embodiment, the segment is about by SEQ ID No：2 compositions.In another embodiment, the segment is substantially By SEQ ID No：2 compositions.In another embodiment, which corresponds to SEQ ID No：2.In another embodiment, The segment and SEQ ID No：2 is homologous.In another embodiment, the segment and SEQ ID No：2 segment is homologous.For one The length of the Δ LLO of a little examples is 416 AA (not including signal sequence), because including the activation domain containing cysteine 484 88 residues of amino terminal inside are truncated.Those skilled in the art will be appreciated that no activation domain is specifically without half Any Δ LLO of cystine 484 is suitable for the invention method and composition.In another embodiment, E7 or E6 antigens With any Δ LLO (including PEST amino acid sequences, SEQ ID NO：6) the cell-mediated of fusion enhancement antigen antitumor is exempted from Epidemic disease.

In another embodiment, the LLO albumen of the vaccine for building the present invention has following sequence：

(GenBank accession number P13128； SEQ ID NO：1；Nucleic acid sequence is listed in GenBank accession number X15127, SEQ ID NO：33).Corresponding to the sequence Preceding 25 AA of preceding albumen are signal sequence, and are cut from LLO when by bacterial secretory.Therefore, in the present embodiment, overall length Active LLO albumen is that 504 residues are long.In another embodiment, the above LLO segments are used as in vaccine incorporated herein LLO segments source.

In another embodiment, the N-terminal segment of the LLO albumen of the compositions and methods of the invention is used for following Sequence：

In another embodiment, which corresponds to the about AA20-442 of LLO albumen used herein.

In another embodiment, which has following sequence：

In another embodiment, " truncated LLO " or " Δ LLO " refers to the LLO segments for including PEST amino acid domains. In another embodiment, which refers to the LLO segments for including PEST sequences.

In another embodiment, which refers to the activation domain not comprising amino terminal and does not include cystine 484 LLO segments.In another embodiment, which refers to non-hemolytic LLO segments.In another embodiment, the LLO pieces Section becomes anhemolytic because of the missing of activation domain or mutation.In another embodiment, the LLO segments are because of cysteine 484 Missing or mutation and as anhemolytic.In another embodiment, the LLO segments are due to the missing of another location or mutation As anhemolytic.

In another embodiment, which is made of about preceding 441 AA of LLO albumen.In another embodiment In, which is made of about preceding 420 AA of LLO.In another embodiment, which is the non-of LLO albumen Haemolysis form.

In another embodiment, which includes the residual of the homologous LLO albumen for corresponding to one of above AA ranges Base.Residue numbering need not accurately correspond to residue numbering listed above in another embodiment；For example, if the homologous LLO Albumen has relative to LLO albumen used herein to be inserted into or lacks, then therefore can adjust the residue numbering.

In another embodiment, which is known in the art any other LLO segment.

In another embodiment, dosage is 5-500 × 10⁸A CFU.In another embodiment, dosage be 7-500 × 10⁸A CFU.In another embodiment, dosage is 10-500 × 10⁸A CFU.In another embodiment, dosage 20-500 ×10⁸A CFU.In another embodiment, dosage is 30-500 × 10⁸A CFU.In another embodiment, dosage 50- 500×10⁸A CFU.In another embodiment, dosage is 70-500 × 10⁸A CFU.In another embodiment, dosage is 100-500×10⁸A CFU.In another embodiment, dosage is 150-500 × 10⁸A CFU.In another embodiment, agent Amount is 5-300 × 10⁸A CFU.In another embodiment, dosage is 5-200 × 10⁸A CFU.In another embodiment, agent Amount is 5-150 × 10⁸A CFU.In another embodiment, dosage is 5-100 × 10⁸A CFU.In another embodiment, agent Amount is 5-70 × 10⁸A CFU.In another embodiment, dosage is 5-50 × 10⁸A CFU.In another embodiment, dosage For 5-30 × 10⁸A CFU.In another embodiment, dosage is 5-20 × 10⁸A CFU.In another embodiment, dosage is 1-30×10⁹A CFU.In another embodiment, dosage is 1-20 × 10⁹A CFU.In another embodiment, dosage 2- 30×10⁹A CFU.In another embodiment, dosage is 1-10 × 10⁹A CFU.In another embodiment, dosage 2-10 ×10⁹A CFU.In another embodiment, dosage is 3-10 × 10⁹A CFU.In another embodiment, dosage be 2-7 × 10⁹A CFU.In another embodiment, dosage is 2-5 × 10⁹A CFU.In another embodiment, dosage is 3-5 × 10⁹ A CFU.

In another embodiment, dosage is 1 × 10⁹A organism.In another embodiment, dosage is 1.5 × 10⁹ A organism.In another embodiment, dosage is 2 × 10⁹A organism.In another embodiment, dosage is 3 × 10⁹It is a Organism.In another embodiment, dosage is 4 × 10⁹A organism.In another embodiment, dosage is 5 × 10⁹A life Object.In another embodiment, dosage is 6 × 10⁹A organism.In another embodiment, dosage is 7 × 10⁹A biology Body.In another embodiment, dosage is 8 × 10⁹A organism.In another embodiment, dosage is 10 × 10⁹A biology Body.In another embodiment, dosage is 1.5 × 10¹⁰A organism.In another embodiment, dosage is 2 × 10¹⁰A life Object.In another embodiment, dosage is 2.5 × 10¹⁰A organism.In another embodiment, dosage is 3 × 10¹⁰It is a Organism.In another embodiment, dosage is 3.3 × 10¹⁰A organism.In another embodiment, dosage is 4 × 10¹⁰ A organism.In another embodiment, dosage is 5 × 10¹⁰A organism.

In another embodiment, by recombinant listeria bacterium bacterial strain with 1 × 10⁹-3.31×10¹⁰The dosage of a CFU is applied To people experimenter.In some embodiments, the dosage level for being less than aforementioned range lower limit can be enough, and in other cases may be used Big dosage is also wanted using what those skilled in the art determined.

In another embodiment, recombinant listeria bacterium bacterial strain is with 5 × 10⁹The predose of a CFU is applied, and subsequent every 3 All (Q3W) applies 1 × 10¹⁰The subsequent dose of a CFU.In another embodiment, recombinant listeria bacterium bacterial strain is with 5 × 10⁹It is a The predose of CFU is applied, and then applies 1 × 10 every 3 weeks¹⁰The subsequent dose of a CFU continues 12 weeks periods.At another In embodiment, recombinant listeria bacterium bacterial strain is with 5 × 10⁹The predose of a CFU is applied, and then then applies 5 × 10 every 3 weeks⁸It is a CFU-1×10¹⁰The subsequent dose of a CFU continues 12 weeks periods.In another embodiment, recombinant listeria bacterium bacterial strain is with 5 ×10⁹The predose of a CFU is applied, and then applies 1 × 10 every 3 weeks¹⁰The subsequent dose of a CFU continues 24 weeks periods. In another embodiment, recombinant listeria bacterium bacterial strain is with 5 × 10⁹The predose of a CFU is applied, then apply 1 every 3 weeks × 10¹⁰The subsequent dose of a CFU continues 48 weeks periods.In another embodiment, recombinant listeria bacterium bacterial strain is with 5 × 10⁹It is a The predose of CFU is applied, and then applies 1 × 10 every 3 weeks¹⁰The subsequent dose of a CFU, until realizing that at least 50% tumour disappears It moves back.In another embodiment, recombinant listeria bacterium bacterial strain is with 5 × 10⁹The predose of a CFU is applied, and is then applied every 3 weeks 5×10⁸A CFU-1 × 10¹⁰The subsequent dose of a CFU, until realizing at least 50% tumor regression.In another embodiment In, recombinant listeria bacterium bacterial strain is with 5 × 10⁹The predose of a CFU is applied, and then applies 1 × 10 every 3 weeks¹⁰A CFU's is follow-up Dosage, until realizing at least tumor regression of 70%-80%.In another embodiment, recombinant listeria bacterium bacterial strain with 5 × 10⁹The predose of a CFU is applied, and then applies 1 × 10 every 3 weeks¹⁰The subsequent dose of a CFU, until realizing at least 80%- 90% tumor regression.In another embodiment, recombinant listeria bacterium bacterial strain is with 5 × 10⁹The predose of a CFU is applied, 1 × 10 is then applied every 3 weeks¹⁰The subsequent dose of a CFU, until realizing complete tumor regression.In another embodiment, weight Group Listeria bacterial strain is with 5 × 10⁹The predose of a CFU is applied, and then applies 5 × 10 every 3 weeks⁸A CFU-1 × 10¹⁰It is a The subsequent dose of CFU, until realizing complete tumor regression.In another embodiment, recombinant listeria bacterium bacterial strain with 5 × 10⁹The predose of a CFU is applied, and then applies 5 × 10 every 3 weeks⁸A CFU-1 × 10¹⁰The subsequent dose of a CFU, continues three A dosage or the progression of disease for being repeated up to patient experience confirmation for every three weeks or reaction completely.In another embodiment, it recombinates Listeria bacterial strain is with 5 × 10⁹The predose of a CFU is applied, and then applies 1 × 10 every 3 weeks¹⁰The subsequent dose of a CFU, holds Continue three dosage or every 3 be repeated up to patient experience confirmation progression of disease or completely reaction.

In one embodiment, Listeria bacterial strain disclosed herein is applied in 15 minutes in the form of 80ml is transfused To subject.In another embodiment, Listeria bacterial strain disclosed herein with 10-20ml, 20-30ml, 30-40ml, 40-50ml, 50-60ml, 70-80ml, 80-90ml, 90-100ml, 100-150ml, 150-200ml, 200-250ml or 250- The form application of 300ml infusions.In another embodiment, Listeria bacterial strain disclosed herein is transfused with 80ml-250ml Form application.In another embodiment, Listeria bacterial strain disclosed herein through 5-10 minutes, through 10-20 minutes, warp 20-30 minutes, through 30-40 minutes, through 40-50 minutes or through 50-60 minutes apply.It will be appreciated by those skilled in the art that Infusion amount is bigger, and administration time will continue more to grow.

In some embodiments, treatment cycle combined therapy daystart, and continue at least 12 weeks, 24 weeks or 48 weeks.In other embodiments, treatment cycle from application combined therapy daystart, and continue at least 12 weeks, 24 weeks or 48 weeks.In other embodiments, the daystart that treatment cycle is treated from application chemoradiotherapy, and continue at least 12 weeks, 24 weeks Or 48 weeks.In other embodiments, treatment cycle from application recombinant listeria bacterium disclosed herein or includes the Liszt The daystart of the composition of bacterium simultaneously continues at least 12 weeks, 24 weeks or 48 weeks.

In another embodiment, it is single maintenance or the hardening agent of certain intervals after treatment cycle disclosed herein Amount.

In another embodiment, the recombinant listeria bacterium of term " follow-up " and " reinforcing " dosage is interchangeable herein makes With because they are applied after initial application recombinant listeria bacterium disclosed herein.

In another embodiment, dosage is strengthened with Q2W, Q4W application.In another embodiment, application is strengthened every 3 weeks Dosage 9 dosage (3 weeks × 3 periods) in total then apply single reinforcing dosage in every 2 months.In another embodiment, often Dosage 9 dosage (3 weeks × 3 periods) in total are strengthened in application in 3 weeks, then apply single reinforcing dosage within every 3 months.At another In embodiment, dosage 9 dosage (3 weeks × 3 periods) in total are strengthened in application every 3 weeks, then apply single hardening agent within every 2 months Amount continues 1 year period.In another embodiment, dosage 9 dosage (3 weeks × 3 periods) in total are strengthened in application every 3 weeks, Then the single reinforcing dosage of application in every 3 months continues 1 year period.In another embodiment, dosage is strengthened in application every 3 weeks 9 dosage (3 weeks × 3 periods) in total then apply the period that single reinforcing dosage continues at least a year for every 2 months.Another In one embodiment, dosage 9 dosage (3 weeks × 3 periods) in total are strengthened in application every 3 weeks, and then application in every 3 months is single strong Agent amount continues the period of at least a year.In another embodiment, dosage 9 dosage (3 weeks × 3 in total is strengthened in application every 3 weeks A period), then every 2 or the single reinforcing dosage of application in 3 months continue 1 year to 3 years period.

In one embodiment, monthly dosage 3 dosage in total is strengthened in application after initial application.In another embodiment In, monthly dosage 4-10 dosage in total is strengthened in application after initial application.In another embodiment, every after initial application Dosage 10-20 dosage in total is strengthened in moon application.

In one embodiment, dosage 3 dosage in total is strengthened in application in every 3 or 4 weeks after initial application.In another reality It applies in example, applies within every 3 or 4 weeks after initial application and strengthen dosage 4-10 dosage in total.In another embodiment, initial Dosage 10-20 dosage in total is strengthened in application in every 3 or 4 weeks after.

In one embodiment, every to continue within 3-4 weeks administration until progression of disease or completely reaction.

Other administrations are arranged as identical every 4 weeks once, when can preferably be cooperateed with especially in scheme for combining, Yi Jizhen To the mixed form of auxiliary treatment, wherein patient receives the administration in primary × 3 " period " every 3 weeks, then every 2 or connects for 3 months By single same dose infusion until sometime point (1-2) as " reinforcing " or " maintenance " to be administered.In another reality It applies in example, is the single maintenance of predetermined space (including but not limited to those of disclosed herein) after method disclosed herein Or strengthen dosage.

In another embodiment, the recombinant polypeptide of method of the invention is expressed by recombinant listeria bacterium bacterial strain.Another In a embodiment, which is mediated by the nucleic acid molecule that recombinant listeria bacterium bacterial strain carries.

In another embodiment, which is recombinated more by the plasmid expression of encoding recombinant polypeptide Peptide.In another embodiment, which includes the gene of encoding bacterial transcription factor.In another embodiment, the plasmid Encode Listeria transcription factor.In another embodiment, which is prfA.In another embodiment, should PrfA is mutant prfA.In another embodiment, the prfA encoding D 133V ammonia in the plasmid in the Listeria The embarrassed mutation of base acid.In another embodiment, transcription factor is any other transcription factor known in the art.

In another embodiment, which includes the gene of encoding metabolic enzyme.In another embodiment, the metabolic enzyme For bacterial metabolism enzyme.In another embodiment, which is Listeria metabolic enzyme.In another embodiment, it is metabolized Enzyme is amino acid metabolism enzyme.In another embodiment, which is related to Cell wall synthesis approach.In another reality It applies in example, which is the product of D- amino acid aminotransferase genes (dat).In another embodiment, the metabolic enzyme It is the product of alanine racemase enzyme gene (dal).In another embodiment, the metabolic enzyme be it is known in the art any other Metabolic enzyme.

In another embodiment, method of the invention further include with the present invention recombinant listeria bacterium bacterial strain strengthen people by The step of examination person.In another embodiment, it is used to strengthen the recombinant listeria bacterium bacterial strain of inoculation and for initial " just exempting from " The bacterial strain of inoculation is identical.In another embodiment, strengthen bacterial strain to be different from just exempting from bacterial strain.In another embodiment, by phase Same dosage is for just exempting from and strengthening inoculation.In another embodiment, by large dosage for strengthening.In another embodiment In, by low dose for strengthening.

In another embodiment, method of the invention further includes being inoculated with people with the immunogenic composition comprising HPV-16 E7 The step of subject.In another embodiment, immunogenic composition includes recombination E7 albumen or its segment.In another reality It applies in example, immunogenic composition includes expression recombination E7 albumen or the nucleic acid molecule of its segment.In another embodiment, The non-Listeria of application is inoculated with after Listeria inoculation.In another embodiment, it is applied before Listeria inoculation Non- Listeria inoculation.

In another embodiment, " reinforcing " is to show subject to apply other vaccine dose.In the method for the present invention In another embodiment, strengthen (or 3 inoculations in total) using 2 times.In another embodiment, strengthen using 3 times.Another In a embodiment, strengthen using 4 times.In another embodiment, strengthen using 5 times.In another embodiment, using 6 times Strengthen.In another embodiment, strengthen using more than 6 times.

The recombinant listeria bacterium bacterial strain of the method and composition of the present invention is recombination monocyte in another embodiment Increasing property Listeria bacterial strain.In another embodiment, which is recombination Xi Er Listerias (Listeria Seeligeri) bacterial strain.In another embodiment, which is recombination listeria grayi (Listeria Grayi) bacterial strain.In another embodiment, which is recombination Vyacheslav Ivanov Listeria (Listeria Ivanovii) bacterial strain.In another embodiment, which is recombination listeria murrayi (Listeria Murrayi) bacterial strain.In another embodiment, which is recombination Wei Erxun Listerias (Listeria Welshimeri) bacterial strain.In another embodiment, which is any other Listeria known in the art Belong to the recombinant bacterial strain of strain.

The present invention provide it is a variety of be used to prepare or be engineered the present invention attenuation Listerias listeria strains with Bacterial strain.In one embodiment, Listeria bacterial strain be listerisa monocytogenes in mjme 10403S wild types (referring to Bishop and Hinrichs (1987) J.Immun0l.139：2005-2009；Lauer et al. (2002) J.Bact.184：4177- 4186).In another embodiment, Listeria bacterial strain is listerisa monocytogenes in mjme DP-L4056 (bacteriophage solutions From) (referring to Lauer et al. (2002) J.Bact.184：4177-4186).In another embodiment, Listeria bacterial strain For listerisa monocytogenes in mjme DP-L4027, be bacteriophage dissociation and be hly gene delections (referring to Lauer Et al. (2002) J.Bact.184：4177-4186；Jones and Portnoy (1994) Infect.Immunity 65：5608- 5613).In another embodiment, Listeria bacterial strain is listerisa monocytogenes in mjme DP-L4029, is phagocytosis Body dissociation, ActA missing (referring to Lauer et al. (2002) J.Bact.184：4177-4186；Skoble et al. (2000) J.Cell Biol.150：527-538).In another embodiment, Listeria bacterial strain is monocytosis Liszt Bacterium DP-L4042 (Δ PEST) is (referring to Brockstedt et al. (2004) Proc.Natl.Acad.Sci.USA 101：13832- 13837；Support information).In another embodiment, Listeria bacterial strain is listerisa monocytogenes in mjme DP-L4097 (LLO-S44A) (referring to Brockstedt et al. (2004) Proc.Natl.Acad.Sci.USA 101：13832-13837；Branch Hold information).In another embodiment, Listeria bacterial strain is listerisa monocytogenes in mjme DP-L4364 (Δ lplA； Lipoprotein ligase (lipoate protein ligase)) (referring to Brockstedt et al. (2004) Proc.Natl.Acad.Sci.USA 101：13832-13837；Support information).In another embodiment, Listeria bacterium Strain is listerisa monocytogenes in mjme DP-L4405 (Δ inlA) (referring to Brockstedt et al. (2004) Proc.Natl.Acad.Sci.USA 101：13832-13837；Support information).In another embodiment, Listeria bacterium Strain is listerisa monocytogenes in mjme DP-L4406 (Δ inlB) (referring to Brockstedt et al. (2004) Proc.Natl.Acad.Sci.USA 101：13832-13837；Support information).In another embodiment, Listeria bacterium Strain is listerisa monocytogenes in mjme CS-L0001 (Δ ActA-deltainlB) (referring to Brockstedt et al. (2004) Proc.Natl.Acad.Sci.USA 101：13832-13837；Support information).In another embodiment, Listeria bacterium Strain is listerisa monocytogenes in mjme CS-L0002 (Δ ActA-delta lplA) (referring to Brockstedt et al. (2004)Proc.Natl.Acad.Sci.USA 101：13832-13837；Support information).In another embodiment, Li Si Special bacteria strain is listerisa monocytogenes in mjme CS-L0003 (L461T- Δ lplA) (referring to Brockstedt et al. (2004)Proc.Natl.Acad.Sci.USA 101：13832-13837；Support information).In another embodiment, Li Si Special bacteria strain is listerisa monocytogenes in mjme DP-L4038 (Δ ActA-LLO L461T) (referring to Brockstedt et al. (2004)Proc.Natl.Acad.Sci.USA 101：13832-13837；Support information).In another embodiment, Li Si Special bacteria strain is listerisa monocytogenes in mjme DP-L4384 (S44A-LLO L461T) (referring to Brockstedt et al. (2004)Proc.Natl.Acad.Sci.USA 101：13832-13837；Support information).In another embodiment, Li Si Special bacteria strain is listerisa monocytogenes in mjme.Mutation in lipoprotein is (referring to O ' Riordan et al. (2003) Science 302：462-464).In another embodiment, Listeria bacterial strain is listerisa monocytogenes in mjme DP- (10403S hly (L461T) have point mutation (referring to U.S. Provisional Patent Application No.60/ to L4017 in hemolysin gene On July 24th, 490,089,2003 submits).In another embodiment, Listeria bacterial strain is monocytosis Li Si Special bacterium EGD (referring to GenBank accession number AL591824).In another embodiment, Listeria bacterial strain increases for monocyte More property Listeria EGD-e (referring to GenBank accession number NC_003210, ATCC accession number BAA-679).In another implementation In example, Listeria bacterial strain is the listerisa monocytogenes in mjme DP-L4029 of uvrAB missings (referring on 2 2nd, 2004 The U.S. Provisional Patent Application No.60/ that the U.S. Provisional Patent Application No.60/541,515 of submission, on July 24th, 2003 submit 490,080).In another embodiment, Listeria bacterial strain is listerisa monocytogenes in mjme ActA-/inlB- bis- prominent Variant (referring to ATCC accession number PTA-5562).In another embodiment, Listeria bacterial strain is monocytosis Lee This special bacterium lplA mutant or hly mutant (referring to the U.S. Patent application No.20040013690 for authorizing Portnoy et al.). In another embodiment, Listeria bacterial strain is listerisa monocytogenes in mjme DAL/DAT double-mutants.(referring to awarding Give the U.S. Patent application No.20050048081 of Frankel and Portnoy).The present invention covers comprising above-mentioned Listeria bacterium The reagent and method of strain, and modified for example by plasmid and/or by genome conformity with include following nucleic acid this A little bacterial strains encode one of following gene or its nucleic acid arbitrarily combined：Hly (LLO, Listeria hemolysin), iap (p60), InlA, inlB, inlC, dal (alanine racemase), dat (D- amino acid aminotransferases), plcA, plcB, actA；Or it is situated between Lead the nucleic acid of following aspect：The combination of growth, propagation, the rupture of single wall vesica, the rupture of double-walled vesica, and host cell, by Host cell absorbs.The present invention is not limited by above-disclosed specific bacterial strain.

In another embodiment, recombinant listeria bacterium bacterial strain of the invention passes in animal reservoir.At another In embodiment, which allows the bacterial strain as the optimizing effect of vaccine carrier.In another embodiment, which stablizes Lee The immunogenicity of this special bacteria strain.In another embodiment, which stablizes the virulence of Listeria bacterial strain.In another reality It applies in example, which enhances the immunogenicity of Listeria bacterial strain.In another embodiment, which enhances Listeria bacterium The virulence of strain.In another embodiment, which removes the unstable sub-strain of Listeria bacterial strain.In another embodiment In, which reduces the generality of the unstable sub-strain of Listeria bacterial strain.In another embodiment, Listeria bacterial strain packet The genome of the gene of the recombinant peptide containing antigen containing coding is inserted into.In another embodiment, Listeria bacterial strain is carried comprising volume The plasmid of the gene of code recombinant peptide containing antigen.In another embodiment, which carries out (for example, in example as described herein In 12).In another embodiment, which is carried out by any other method known in the art.

In another embodiment, frozen cell is had been stored in for the recombinant listeria bacterium bacterial strain in the method for the present invention In library.In another embodiment, recombinant listeria bacterium bacterial strain has been stored in lyophilized cells library.

In another embodiment, the cell bank of method and composition of the invention is master cell bank.In another implementation In example, cell bank is working cardial cell library.In another embodiment, cell bank is Good Manufacture Practice (GMP) cell bank.Another In one embodiment, cell bank is intended for preparing clinical grade material.In another embodiment, cell bank meets people's supervision Specification.In another embodiment, cell bank is the cell bank of any other type known in the art.

" Good Manufacture Practice " is in another embodiment by United States Federal Regulations (United States Code of Federal Regulations) (21CFR 210-211) definition.In another embodiment, " Good Manufacture Practice " is by giving birth to Produce clinical grade material or defined for the other standards of mankind's consumption, for example, country /region except the U.S. standard.

In another embodiment, recombinant listeria bacterium bacterial strain used in method of the invention comes from a collection of vaccine dose Amount.

In another embodiment, recombinant listeria bacterium bacterial strain used in method of the invention carrys out free United States Patent (USP) No.8, freezing or freeze-drying backlog, the patent prepared by the method disclosed in 114,414 are herein incorporated by reference.

In another embodiment, peptide of the invention is fusogenic peptide.In another embodiment, " fusogenic peptide " refers to including The peptide or polypeptide of 2 or more the albumen to be linked together by peptide bond or other chemical bonds.In another embodiment, egg It is directly linked together in vain by peptide or other chemical bonds.In another embodiment, albumen by 2 or more albumen it Between 1 or more amino acid (for example, " spacer ") link together.

In another embodiment, vaccine of the invention also includes adjuvant.In another embodiment, method of the invention It is granulocyte/macrophage colony stimulating factor (GM-CSF) albumen with the adjuvant used in composition.In another embodiment, The adjuvant includes GM-CSF albumen.In another embodiment, which is the nucleic acid molecule for encoding GM-CSF.At another In embodiment, which is the nucleic acid molecule for including coding GM-CSF.In another embodiment, which is saponin(e QS21.In another embodiment, which includes saponin(e QS21.In another embodiment, which is monophosphoryl lipid matter A.In another embodiment, which includes monophosphoryl lipid A.In another embodiment, which is SBAS2.Another In one embodiment, which includes SBAS2.In another embodiment, which is the few core containing unmethylated CpG Thuja acid.In another embodiment, which includes the oligonucleotides containing unmethylated CpG.In another embodiment, The adjuvant is immunostimulatory cells factor.In another embodiment, which includes immunostimulatory cells factor.Another In one embodiment, which is the nucleic acid molecule of encoding immune stimulating cell factor.In another embodiment, the assistant Agent includes the nucleic acid molecule of encoding immune stimulating cell factor.In another embodiment, which is or comprising thorn sugar Glycosides (quill glycoside).In another embodiment, which is or comprising bacterium mitogen.In another reality It applies in example, which is or comprising bacteriotoxin.In another embodiment, which is or comprising known in the art any Other adjuvants.

In another embodiment, nucleotide of the invention is operably coupled to driving encoded peptide in Listeria bacterial strain Promoter/regulating and controlling sequence of middle expression.Can be used for driving promoter/regulating and controlling sequence of the constitutive expression of gene is that this field is ripe Know, and includes but not limited to the P of such as Listeria_hlyA、P_ActAWith p60 promoters, streptococcus (Streptococcus) Bac promoters, streptomyces griseus (Streptomyces griseus) sgiA promoters and bacillus thuringiensis (B.thuringiensis) phaZ promoters.In another embodiment, the induction type and group of the nucleic acid of the peptide of the present invention are encoded It knits specific expressed by the way that the nucleic acid for encoding the peptide to be placed under the regulation and control of induction type or tissue-specific promoter/regulating and controlling sequence It realizes.The example of the tissue specificity or inducible promoter/regulating and controlling sequence that can be used for this purpose includes but not limited to MMTV LTR inducible promoters and SV40 late enhancers/promoter.In another embodiment, using in response to derivant (such as Metal, glucocorticoid etc.) and the promoter of induction.Thus, it will be understood that being, the present invention includes using any known or unknown And promoter/regulating and controlling sequence of the expression for the required albumen being operably connected with it can be driven.

The N-terminal segment of the ActA albumen used in the method and composition of the present invention has such as in another embodiment Sequence shown in lower：SEQ ID NO：4：

In another embodiment, ActA pieces Section includes SEQ ID NO：Sequence shown in 4.In another embodiment, ActA segments are known in the art any other ActA segments.In another embodiment, the recombinant nucleotide of the segment of coding ActA albumen includes sequence as follows： SEQ ID NO：5：

In another embodiment, recombinant nucleotide has SEQ ID NO：Sequence shown in 5.In another implementation In example, recombinant nucleotide includes the sequence of the segment of any other coding ActA albumen.

In another embodiment of the method and composition of the present invention, it is anti-that PEST amino acid sequences are fused to E7 or E6 It is former.As disclosed herein, the recombinant listeria bacterium bacterial strain inducing antineoplastic immune of expression PEST amino acid sequences-Antigen Fusion body (example 3) and generate antigentic specificity, tumor infiltrating T cell (example 4).In addition, it was confirmed that include antigen and ammonia containing PEST Base acid sequence KENSISSMAPPASPPASPKTPIEKKHADEIDK (SEQ ID NO：6) fusion protein of LLO enhances thin Born of the same parents mediate immune.

Therefore, Antigen Fusion extremely derives from other LM PEST amino acid sequences and PEST amino of other prokaryotes bodies Acid sequence is also by the immunogenicity of enhancement antigen.In another embodiment, PEST amino acid sequences, which have, is selected from SEQ ID NO：The sequence of 7-12.In another embodiment, PEST amino acid sequences are the PEST amino acid sequences from LM ActA albumen Row.In another embodiment, PEST amino acid sequences are KTEEQPSEVNTGPR (SEQ ID NO：7)、 KASVTDTSEGDLDSSMQSADESTPQPLK(SEQ ID NO：8)、KNEEVNASDFPPPPTDEELR(SEQ ID NO：9) or RGGIPTSEEFSSLNSGDFTDDENSETTEEEIDR(SEQ ID NO：10).In another embodiment, the PEST amino acid Sequence comes from the streptococcolysin O protein of Streptococcus species (Streptococcus sp).In another embodiment, PEST amino acid sequences come from the streptolysin O of streptococcus pyogenes (Streptococcus pyogenes), such as AA KQNTASTETTTTNEQPK (SEQ ID NO at 35-51：11).In another embodiment, PEST amino acid sequences come from The streptolysin O of streptococcus equisimilis (Streptococcus equisimilis), such as at AA 38-54 KQNTANTETTTTNEQPK(SEQ ID NO：12).In another embodiment, which is to be given birth to from protokaryon Another PEST amino acid sequences of object.In another embodiment, which is known in the art any Other PEST amino acid sequences.

It can be according to such as by such as Rechsteiner and Rogers (1996, Trends Biochem.Sci.21：267- 271) the PEST amino acid sequences of other prokaryotes bodies are identified for the method described in LM.Alternatively, being given birth to from other protokaryons The PEST amino acid sequences of object may be based on this method to identify.Other protokaryons of expectable wherein PEST amino acid sequences Organism includes but not limited to other Listeria strains.In another embodiment, PEST amino acid sequences are embedded in antigen In property albumen.Therefore, in another embodiment, " fusion " refer to both include antigen and also comprising be connected to antigen one end or The antigenic protein of PEST amino acid sequences in embedded antigen.

In another embodiment, using any other method known in the art or algorithm, such as CaSPredictor (Garay-Malpartida HM, Occhiucci JM, Alves J, Belizario JE.Bioinformatics.2005 6 Month；21 supplementary issues 1：I169-76 PEST amino acid sequences are identified).In another embodiment, using following methods：

By the way that 1 value is distributed to amino acid Ser, Thr, Pro, Glu, Asp, Asn or Gln, calculate per 30-35 amino The PEST indexes of the section of acid.The coefficient value (CV) of each PEST residues is 1, the coefficient value of other each amino acid (non-PEST) It is 0.

Each method for being used to identify PEST amino acid sequences represents the individual embodiment of the present invention.

In another embodiment, LLO albumen of the invention, ActA albumen or its segment need not be accurately such as this paper institutes The sequence shown is such, but can make LLO the or ActA eggs that other holdings are fused to antigen as shown in elsewhere herein Change, modification or the variation of white functional characteristic.In another embodiment the present invention using LLO albumen, ActA albumen or its The analog of segment.Analog is in another embodiment with naturally occurring albumen or peptide the difference is that conserved amino Sequence difference or modification sequence not being had an impact or both of the above.

In another embodiment, entire E7 albumen or its segment composition are to LLO albumen, ActA albumen or amino containing PEST The peptide of acid sequence is to generate the recombinant peptide of the method for the present invention.E7 albumen used (as a whole or as segment source) There is following sequence in another embodiment： In another embodiment, which is SEQ ID No：13 homologue.In another reality It applies in example, which is SEQ ID No：13 variant.In another embodiment, which is SEQ ID No：13 Isomers.In another embodiment, which is SEQ ID No：13 segment.In another embodiment, the E7 eggs It is SEQ ID No in vain：The segment of 13 homologue.In another embodiment, which is SEQ ID No：13 variant Segment.In another embodiment, which is SEQ ID No：The segment of 13 isomers.

In another embodiment, the sequence of E7 albumen is： In another embodiment, which is SEQ ID No：14 homologue. In another embodiment, which is SEQ ID No：14 variant.In another embodiment, which is SEQ ID No：14 isomers.In another embodiment, which is SEQ ID No：14 segment.In another embodiment In, which is SEQ ID No：The segment of 14 homologue.In another embodiment, which is SEQ ID No： The segment of 14 variant.In another embodiment, which is SEQ ID No：The segment of 14 isomers.

In another embodiment, which has sequence shown in one of following GenBank entries：M24215、NC_ 004500, V01116, X62843 or M14119.In another embodiment, the E7 albumen be from the above GenBank entries it The homologue of one sequence.In another embodiment, which is the change of the sequence from one of the above GenBank entries Body.In another embodiment, which is the isomers of the sequence from one of the above GenBank entries.At another In embodiment, which is the segment of the sequence from one of the above GenBank entries.In another embodiment, the E7 Albumen is the segment of the homologue of the sequence from one of the above GenBank entries.In another embodiment, which is The segment of the variant of sequence from one of the above GenBank entries.In another embodiment, which is more than The segment of the isomers of the sequence of one of GenBank entries.

In another embodiment, entire E6 albumen or its segment composition are to LLO albumen, ActA albumen or amino containing PEST The peptide of acid sequence is to generate the recombinant peptide of the method for the present invention.E6 albumen used (as a whole or as segment source) There is following sequence in another embodiment： In another embodiment, which is SEQ ID No：15 it is homologous Object.In another embodiment, which is SEQ ID No：15 variant.In another embodiment, which is SEQ ID No：15 isomers.In another embodiment, which is SEQ ID No：15 segment.In another reality It applies in example, which is SEQ ID No：The segment of 15 homologue.In another embodiment, which is SEQ ID No：The segment of 15 variant.In another embodiment, which is SEQ ID No：The segment of 15 isomers.

In another embodiment, the sequence of E6 albumen is： In another embodiment, which is SEQ ID No：16 it is homologous Object.In another embodiment, which is SEQ ID No：16 variant.In another embodiment, which is SEQ ID No：16 isomers.In another embodiment, which is SEQ ID No：16 segment.In another reality It applies in example, which is SEQ ID No：The segment of 16 homologue.In another embodiment, which is SEQ ID No：The segment of 16 variant.In another embodiment, which is SEQ ID No：The segment of 16 isomers.

In another embodiment, which has sequence shown in one of following GenBank entries：M24215、 M14119, NC_004500, V01116, X62843 or M14119.In another embodiment, which is more than The homologue of the sequence of one of GenBank entries.In another embodiment, which is from the above GenBank entries One of sequence variant.In another embodiment, which is the different of the sequence from one of the above GenBank entries Structure body.In another embodiment, which is the segment of the sequence from one of the above GenBank entries.At another In embodiment, which is the segment of the homologue of the sequence from one of the above GenBank entries.In another embodiment In, which is the segment of the variant of the sequence from one of the above GenBank entries.In another embodiment, the E6 Albumen is the segment of the isomers of the sequence from one of the above GenBank entries.

In another embodiment, " homology " refer to LLO sequences (e.g., with SEQ ID No：One of 1-3) it is same Property be more than 70%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 1-3 is more than 64%. In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 1-3 is more than 68%.In another implementation In example, " homology " refers to and SEQ ID No：The homogeneity of one of 1-3 is more than 72%.In another embodiment, " homologous Property " refer to and SEQ ID No：The homogeneity of one of 1-3 is more than 75%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 1-3 is more than 78%.In another embodiment, " homology " refers to and SEQ ID No：1-3 it One homogeneity is more than 80%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 1-3 is big In 82%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 1-3 is more than 83%.Another In one embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 1-3 is more than 85%.In another embodiment In, " homology " refers to and SEQ ID No：The homogeneity of one of 1-3 is more than 87%.In another embodiment, " homology " Refer to and SEQ ID No：The homogeneity of one of 1-3 is more than 88%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 1-3 is more than 90%.In another embodiment, " homology " refers to and SEQ ID No：One of 1-3's Homogeneity is more than 92%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 1-3 is more than 93%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 1-3 is more than 95%.Another In a embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 1-3 is more than 96%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 1-3 is more than 97%.In another embodiment, " homology " refers to With SEQ ID No：The homogeneity of one of 1-3 is more than 98%.In another embodiment, " homology " refers to and SEQ ID No： The homogeneity of one of 1-3 is more than 99%.In another embodiment, " homology " refers to and SEQ ID No：One of 1-3's is same One property is 100%.

In another embodiment, " homology " refer to E7 sequences (e.g., with SEQ ID No：One of 13-14) it is same Property be more than 70%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 13-14 is more than 62%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 13-14 is more than 64%.Another In one embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 13-14 is more than 68%.In another embodiment In, " homology " refers to and SEQ ID No：The homogeneity of one of 13-14 is more than 72%.In another embodiment, " homologous Property " refer to and SEQ ID No：The homogeneity of one of 13-14 is more than 75%.In another embodiment, " homology " refer to SEQ ID No：The homogeneity of one of 13-14 is more than 78%.In another embodiment, " homology " refers to and SEQ ID No： The homogeneity of one of 13-14 is more than 80%.In another embodiment, " homology " refers to and SEQ ID No：One of 13-14 Homogeneity be more than 82%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 13-14 is big In 83%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 13-14 is more than 85%. In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 13-14 is more than 87%.In another implementation In example, " homology " refers to and SEQ ID No：The homogeneity of one of 13-14 is more than 88%.In another embodiment, " homologous Property " refer to and SEQ ID No：The homogeneity of one of 13-14 is more than 90%.In another embodiment, " homology " refer to SEQ ID No：The homogeneity of one of 13-14 is more than 92%.In another embodiment, " homology " refers to and SEQ ID No： The homogeneity of one of 13-14 is more than 93%.In another embodiment, " homology " refers to and SEQ ID No：One of 13-14 Homogeneity be more than 95%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 13-14 is big In 96%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 13-14 is more than 97%. In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 13-14 is more than 98%.In another implementation In example, " homology " refers to and SEQ ID No：The homogeneity of one of 13-14 is more than 99%.In another embodiment, " homologous Property " refer to and SEQ ID No：The homogeneity of one of 13-14 is 100%.

In another embodiment, " homology " refer to E6 sequences (e.g., with SEQ ID No：One of 15-16) it is same Property be more than 70%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 15-16 is more than 64%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 15-16 is more than 68%.Another In one embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 15-16 is more than 72%.In another embodiment In, " homology " refers to and SEQ ID No：The homogeneity of one of 15-16 is more than 75%.In another embodiment, " homologous Property " refer to and SEQ ID No：The homogeneity of one of 15-16 is more than 78%.In another embodiment, " homology " refer to SEQ ID No：The homogeneity of one of 15-16 is more than 80%.In another embodiment, " homology " refers to and SEQ ID No： The homogeneity of one of 15-16 is more than 82%.In another embodiment, " homology " refers to and SEQ ID No：One of 15-16 Homogeneity be more than 83%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 15-16 is big In 85%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 15-16 is more than 87%. In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 15-16 is more than 88%.In another implementation In example, " homology " refers to and SEQ ID No：The homogeneity of one of 15-16 is more than 90%.In another embodiment, " homologous Property " refer to and SEQ ID No：The homogeneity of one of 15-16 is more than 92%.In another embodiment, " homology " refer to SEQ ID No：The homogeneity of one of 15-16 is more than 93%.In another embodiment, " homology " refers to and SEQ ID No： The homogeneity of one of 15-16 is more than 95%.In another embodiment, " homology " refers to and SEQ ID No：One of 15-16 Homogeneity be more than 96%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 15-16 is big In 97%.In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 15-16 is more than 98%. In another embodiment, " homology " refers to and SEQ ID No：The homogeneity of one of 15-16 is more than 99%.In another implementation In example, " homology " refers to and SEQ ID No：The homogeneity of one of 15-16 is 100%.

In another embodiment, " homology " refer to PEST amino acid sequences (e.g., with SEQ ID No：6-12 it One) or with ActA sequences (e.g., with SEQ ID No：One of 4-5) homogeneity be more than 70%.In another embodiment, " same Source property " refers to and SEQ ID No：6-12 or SEQ ID No：The homogeneity of one of 4-5 is more than 60%.In another embodiment In, " homology " refers to and SEQ ID No：6-12 or SEQ ID No：The homogeneity of one of 4-5 is more than 64%.In another reality It applies in example, " homology " refers to and SEQ ID No：6-12 or SEQ ID No：The homogeneity of one of 4-5 is more than 68%.Another In a embodiment, " homology " refers to and SEQ ID No：6-12 or SEQ ID No：The homogeneity of one of 4-5 is more than 72%. In another embodiment, " homology " refers to and SEQ ID No：6-12 or SEQ ID No：The homogeneity of one of 4-5 is more than 75%.In another embodiment, " homology " refers to and SEQ ID No：6-12 or SEQ ID No：The homogeneity of one of 4-5 More than 78%.In another embodiment, " homology " refers to and SEQ ID No：6-12 or SEQ ID No：One of 4-5's is same One property is more than 80%.In another embodiment, " homology " refers to and SEQ ID No：6-12 or SEQ ID No：One of 4-5 Homogeneity be more than 82%.In another embodiment, " homology " refers to and SEQ ID No：6-12 or SEQ ID No：4-5 One of homogeneity be more than 83%.In another embodiment, " homology " refers to and SEQ ID No：6-12 or SEQ ID No：The homogeneity of one of 4-5 is more than 85%.In another embodiment, " homology " refers to and SEQ ID No：6-12 or SEQ ID No：The homogeneity of one of 4-5 is more than 87%.In another embodiment, " homology " refers to and SEQ ID No：6-12 or SEQ ID No：The homogeneity of one of 4-5 is more than 88%.In another embodiment, " homology " refers to and SEQ ID No：6- 12 or SEQ ID No：The homogeneity of one of 4-5 is more than 90%.In another embodiment, " homology " refers to and SEQ ID No：6-12 or SEQ ID No：The homogeneity of one of 4-5 is more than 92%.In another embodiment, " homology " refers to and SEQ ID No：6-12 or SEQ ID No：The homogeneity of one of 4-5 is more than 93%.In another embodiment, " homology " refer to SEQ ID No：6-12 or SEQ ID No：The homogeneity of one of 4-5 is more than 95%.In another embodiment, " homology " is Refer to and SEQ ID No：6-12 or SEQ ID No：The homogeneity of one of 4-5 is more than 96%.In another embodiment, " homologous Property " refer to and SEQ ID No：6-12 or SEQ ID No：The homogeneity of one of 4-5 is more than 97%.In another embodiment, " homology " refers to and SEQ ID No：6-12 or SEQ ID No：The homogeneity of one of 4-5 is more than 98%.In another implementation In example, " homology " refers to and SEQ ID No：6-12 or SEQ ID No：The homogeneity of one of 4_5 is more than 99%.At another In embodiment, " homology " refers to and SEQ ID No：6-12 or SEQ ID No：The homogeneity of one of 4-5 is 100%.

In one embodiment, determine that albumen and/or peptide are appointed to what is listed herein by the method that this field fully describes The homology of what amino acid sequence, including immunoblotting assay, or used in a variety of available software packages by the method for foundation Any computerized algorithm by amino acid sequence, which is analyzed, to carry out.In these software packages some for example including FASTA, BLAST, MPsrch or Scanps software package, and Smith and Waterman algorithms and/or whole are used in other embodiments Body/part or BLOCKS are compared for analyzing.Each method for determining homology represents the individual embodiment of the present invention.

In another embodiment, LLO albumen, ActA albumen or its segment are connected to antigen by chemical coupling.Another In one embodiment, by glutaraldehyde for being coupled.In another embodiment, coupling is using known in the art any suitable Method carries out.

In another embodiment, fusion protein of the invention is prepared by any suitable method, these methods include Such as limitation or the direct chemical synthesis of the method by being discussed below of clone and appropriate sequence.In another embodiment, gram Longzi sequence, and cut subsequence appropriate using restriction enzyme appropriate.In another embodiment, then junction fragment is given birth to At required DNA sequence dna.In another embodiment, the DNA of encoding fusion protein uses DNA cloning method such as polymerase chain (PCR) is reacted to prepare.First, the either side in the new end of n DNA segment individually expands.5 ' ends of the sequence of one amplification Peptide linker is encoded, and 3 ' ends of the sequence of another amplification also encode peptide linker.Due to 5 ' ends of the first segment and the second segment 3 ' ends it is complementary, two segments (after partial purification, such as on LMP agaroses) can be used as overlapping mould in the 3rd PCR reactions Plate.The sequence of amplification will include segment (forming amino sequence now), connector and the opening on codon, vent position carboxyl side Sequence (forming carboxyl sequences now) on the amino side of site.Then Insert Fragment is connected into plasmid.

In another embodiment, LLO albumen, ActA albumen or its segment and antigen or its segment pass through this field skill Mode is coupled known to art personnel.In another embodiment, antigen or its segment are even directly or through connector (spacer) It is linked to ActA albumen or LLO albumen.In another embodiment, chimeric molecule as single chain fusion protein with recombination form table It reaches.

In another embodiment, fusogenic peptide of the invention is synthesized using standard chemical peptide symthesis technology.At another In embodiment, chimeric molecule is as single continuous Peptide systhesis.In another embodiment, LLO albumen, ActA albumen or its piece Section and antigen or its segment individually synthesize, and then pass through the carboxyl terminal of the amino terminal and another molecule of a molecule Condensation and merge, to form peptide bond.In another embodiment, ActA albumen or LLO albumen and antigen are respectively between peptide It is condensed every one end of molecule, to form continuous fusion protein.

In another embodiment, peptide of the invention and albumen are prepared by Solid phase peptide synthesis (SPPS), such as by Stewart et al. is in Solid Phase Peptide Synthesis, second edition, 1984, Pierce Chemical Described in Company, Rockford, Ill., or by Bodanszky and Bodanszky (The Practice of Peptide Synthesis, 1984, Springer-Verlag, New York) it is described.In another embodiment, the amino of suitable protecting Sour residue is connected to the insoluble polymer support of derivatization, such as crosslinked polystyrene or polyamides by its carboxylic group Polyimide resin." suitable protecting " refers to there is blocking group on the alpha-amido group of amino acid and any side chain functionalities. Side chain protecting group be typically to solvent used in entire building-up process, reagent and stable reaction conditions, and can be not It can influence to remove under conditions of final peptide prod.The gradually synthesis of oligopeptides carries out in the following manner：N is removed from initial Then the c-terminus of next amino acid in the sequence of required peptide is coupled to thereon by blocking group.The amino acid is also subject to Suitable protecting.The carboxyl of new amino acid can be made to inactivate to react with the N-terminal of the amino acid combined with support, reactive mode It is such as to form carbodiimide, symmetric anhydride or " active ester " group, such as hydroxybenzotriazole by forming reactive group Or pentafluorophenyl group ester.

In another embodiment, the present invention provides a kind of kit, which includes the vaccine of the present invention, using dress Set and describe the expository material of the application method of the present invention.Although model kit is described below, other available examinations The content of agent box will be apparent for technical personnel according to the disclosure.

It should be understood to the one skilled in the art that quantitative term " about " can cover and add deduct 5%, or add deduct in another embodiment 10%, or add deduct 15% in another embodiment, or add deduct 20% in another embodiment.

It needs to treat illness or its sequelae or susceptible illness it should be understood to the one skilled in the art that term " subject " can be covered Or the mammal including people of its sequelae.The subject may include dog, cat, pig, ox, sheep, goat, horse, rat With mouse and people.Term " subject " is not excluded for individual all normal in all respects.

All references cited herein is incorporated by reference, and is reached as each individual disclosure, database item Mesh (such as Genbank sequences or GeneID entries), patent application or patent particularly and individually indicate by reference simultaneously The degree entered.Be incorporated by reference this statement by applicant according to 37C.F.R. § 1.57 (b) (1) be intended to be related to it is each and All individual disclosures, data base entries (such as Genbank sequences or GeneID entries), patent application or patent, in them Each clearly limited according to 37C.F.R. § 1.57 (b) (2), even if these references are not close to being incorporated by reference Special statement.Specification includes that the special statement (if any) being incorporated by reference does not weaken in any way to draw The general statement being incorporated to mode.The reference citation of this paper, which is not intended to, recognizes that the bibliography is related art, It does not constitute to perhaps any approval on date in these disclosures or document yet.

For the embodiment more fully illustrated the present invention, following instance is provided.However, they should never be explained For the broad range of the limitation present invention.

Experimental detail chapters and sections

Example 1：LLO- Antigen Fusion body inducing antitumor immunities

Material and experimental method (example 1-2)

Cell line

TC-1 tumours that C57BL/6 is homogenic are immortalized through HPV-16E6 and E7 and are converted with c-Ha-ras oncogenes. T.C.Wu (Johns Hopkins University School of Medicine, Baltimore, MD) provide TC-1 be The pulmonary epithelial cells of height tumorigenesis, which expresses low-level HPV-16E6 and E7, and is converted by c-Ha-ras oncogenes.It allows TC-1 is in 37 DEG C and 10%CO₂Under be grown in RPMI 1640,10%FCS, 2mM L-Glutamine, 100U/ml penicillin, 100 μ g/ml streptomysins, 100 μM of nonessential amino acid, 1mM Sodium Pyruvates, 50 micromoles (mcM) 2-ME, 400 micrograms (mcg)/ml National -109 culture medium of Culture Collection (the National Collection Type Culture- of G418 and 10% In 109medium).C3 is the mouse embryo cell from C57BL/6 mouse, which immortalizes through 16 genomes of complete HPV And it is converted through pEJ-ras.EL-4/E7 is the thymoma EL-4 through E7 retroviral transductions.

Listerisa monocytogenes in mjme bacterial strain and breeding

Listeria bacterial strain used is Lm-LLO-E7 (the hly-E7 fusions in sequestered expression system；Figure 1A), Lm-E7 (being integrated into single copy E7 box genes in Listeria genome), Lm-LLO-NP (" DP-L2028 "；Free Hly-NP fusions in type expression system) and Lm-Gag (" ZY-18 "；The single copy HIV-1Gag being integrated into chromosome Box gene).By E7 5 '-GG of primerCTCGAGCATGGAGATACACC-3′(SEQ ID No：17；The sites XhoI, which indicate down, draws Line) and 5 '-GGGGACTAGTTTATGGTTTCTGAGAACA-3′(SEQ ID No：18；The sites SpeI are underlined) pass through PCR amplification is simultaneously connected into pCR2.1 (Invitrogen, San Diego, CA).It is digested from pCR2.1 and is cut off by XhoI/SpeI E7, and connect into pGG-55.Hly-E7 fusions and multipotency transcription factor prfA are cloned into pAM401, i.e., it is a kind of more Copy shuttle plasmid (Wirth R et al., J Bacteriol, 165：831,1986), to generate pGG-55.Hly promoters are driven Preceding 441 amino acid of dynamic hly gene outcomes (lacks the ends hemolytic C-, hereinafter referred to as " Δ LLO ", and has SEQ ID No：Sequence shown in 25) expression, E7 genes are connected to by the sites XhoI, to generate hly-E7 merge base Cause, the gene are transcribed and secrete into LLO-E7.It is negative with the pGG-55 conversions prfA selected to retain plasmid in vivo Listeria strain X FL-7 (is provided, University of Pennsylvania) (Figure 1A-B) by Hao doctors Shen.It uses 5 '-GGGG of primerGCTAGCCCTCCTTTGATTAGTATATTC-3′(SEQ ID No：19；The sites NheI are underlined) and 5′-CTCCCTCGAGATCATAATTTACTTCATC-3′(SEQ ID No：20；The sites XhoI are underlined) generate hly open Mover and genetic fragment.By prfA gene primers 5 '- GACTACAAGGACGATGACCGACAAGTGATAACCCGGGATCTAAATAAATCCGTTT-3′(SEQ ID No：27；XbaI Site is underlined) and 5 '-CCCGTCGACCAGCTCTTCTTGGTGAAG-3′(SEQ ID No：21；The sites SalI indicate Underscore) carry out PCR amplification.By the expression cassette that will contain the hly promoters and signal sequence of expression and the secretion of driving E7 It is introduced into the domains orfZ of LM genomes, generates Lm-E7.By E7 5 '-GC of primerGGATCCCATGGAGATACACCTAC-3′ (SEQ ID No：22；The sites BamHI are underlined) and 5 '-GCTCTAGATTATGGTTTCTGAG-3′(SEQ ID No： 23；The sites XbaI are underlined) pass through PCR amplification.Then E7 is connected into pZY-21 shuttle vectors.With obtained plasmid PZY-21-E7 converts LM bacterial strain 10403S, which includes being inserted in 1.6-kb corresponding with the domain orfX, Y, Z of LM genomes The expression cassette in the center of sequence.The homeodomain allows E7 box genes to be inserted into the domains orfZ by homologous recombination.For E7 box genes Integration in the domains orfZ, screening and cloning.Containing (Lm-LLO-E7 and Lm-LLO-NP) or without (Lm-E7 and ZY-18) chlorine Bacterium is cultivated in the brain-heart infusion medium of mycin (20 μ g/ml).Bacterium is freezed with aliquot at -80 DEG C.Pass through Western Blotting verification expression (Fig. 2).

Western blot method

Make Listeria bacterial strain in Luria-Bertoni culture mediums in 37 DEG C of growths, and is measured at 600nm identical It is harvested under optical density.Supernatant TCA is precipitated, and is resuspended in the 1x sample buffers supplemented with 0.1N NaOH.By equal amount Each cell precipitate or each supernatant loading precipitated through TCA to 4-20%Tris- glycine PAGE gels (NOVEX, San Diego, CA).Gel is transferred to polyvinylidene fluoride, anti-E7 monoclonal antibodies (mAb) (Zymed is used in combination Laboratories, South San Francisco, CA) detection, the anti-mouse secondary antibody (Amersham being then coupled with HRP- Pharmacia Biotech, Little Chalfont, U.K.) it incubates together, developed with Amersham ECL detection reagents, and It is exposed to Hyperfilm (Amersham Pharmacia Biotech).

The measurement of tumour growth

Every other day slide calliper rule is used to measure tumour across most short and longest surface diameter.The average value of the two measurement results is made It maps relative to different time points for average tumor diameter (in terms of millimeter).When diameter of tumor reaches 20mm, mouse is put to death.Only The measurement of tumor result of display existence mouse at every point of time.

Influence of the Listeria recombinant to the tumour growth of foundation

6-8 week old C57BL/6 mouse (Charles River) are in left flank abdomen notch graft by 2 × 10⁵A TC-1 cells.It is swollen Tumor is inoculated with latter week, and tumour has reached the palpable size of a diameter of 4-5mm.Then 0.1LD was used at the 7th and 14 day₅₀Peritonaeum Interior Lm-LLO-E7 (10⁷A CFU), Lm-E7 (10⁶A CFU), Lm-LLO-NP (10⁷A CFU) or Lm-Gag (5 × 10⁵A CFU) Handle the group of 8 mouse.

⁵¹Cr releases measure

With 0.1LD₅₀Lm-LLO-E7, Lm-E7, Lm-LLO-NP or Lm-Gag Intraperitoneal immunization 6-8 week old C57BL/6 are small Mouse.Ten days after immunity inoculation, spleen is harvested.Using the TC-1 cells through irradiation as feeder cells, splenocyte is established in culture (100: 1, splenocyte：TC-1)；It stimulates in vitro 5 days, is then used in standard⁵¹During Cr releases measure, wherein using following targets： EL-4, EL-4/E7 or through E7H-2b peptides (RAHYNIVTF, SEQ ID NO：24) EL-4 of pulse processing.It carries out in triplicate E: T cell ratio be：80: 1,40: 1,20: 1,10: 1,5: 1 and 2.5: 1.After 4h being incubated at 37 DEG C, by cell precipitation, and 50 μ l supernatants are taken out from each hole.With Wallac1450 scintillation counters (Gaithersburg, MD) determination sample.It will be special Property cracking percentage be determined as [(per minute experiment count (cpm)-spontaneous cpm)/(total spontaneous cpm of cpm-)] × 100.

TC-1 proliferated specificallies

By C57BL/6 mouse 0.1LD₅₀It is immune, and pass through intraperitoneal injection 1LD after 20 days₅₀Lm-LLO-E7、Lm- E7, Lm-LLO-NP or Lm-Gag are strengthened.Six days after reinforcing, spleen is harvested from immunized mouse and unexposed mouse.With 2.5×10⁴、1.25×10⁴、6×10³Or 3 × 10³A source of the TC-1 cells/wells as E7Ag through irradiation, or do not have to TC- 1 cell or with 10 μ g/ml Con A, with 5 × 10 in flat 96 hole plate⁵Splenocyte is established in a/hole in culture.45h Afterwards with 0.5 μ Ci [³H] thymidine/hole pulse processing cell.After 18h, harvested using Tomtec collectors 96 (Orange, CT) flat 1450 scintillation counters of Wallac assessment proliferation is used in combination in plate.Variation in terms of cpm is calculated as experiment cpm- without Ag cpm.

Flow cytometry

By C57BL/6 mouse 0.1LD₅₀Lm-LLO-E7 or Lm-E7 intravenous (i.v.) is immune, and strengthens after 30 days. Using bandSoftware (Becton Dickinson, Mountain View, CA)Streaming Cytometer is to CD8 (53-6.7, PE coupling), CD62 ligands (CD62L；MEL-14, APC coupling) and the E7H-2Db tetramers Carry out Tris-clolr flow cytometry.By the splenocyte of the 5th day harvest after reinforcing in room temperature (rt) with having loaded HPV-16 E7 (RAHYNIVTF) Or the H-2Db tetramer stainings of control (HIV-Gag) peptide.The tetramer is used with 1/200 dilution, by Larry R.Pease Doctor (Mayo Clinic, Rochester, MN) and by NIAID Tetramer Core Facility and NIH AIDS Research and Reference Reagent Program are provided.Analyze the tetramer⁺、CD8⁺、CD62L^{It is low}Cell.

B16F0-Ova is tested

To 24 C57BL/6 mouse inoculations 5 × 10⁵A B16F0-Ova cells.At the 3rd, 10 and 17 day, by 8 mouse Group 0.1LD₅₀Lm-OVA(10⁶A cfu), Lm-LLO-OVA (10⁸A cfu) it is immune, another eight animals keep not handling.

Statistics

In order to compare diameter of tumor, the average value and SD of the tumor size each organized are determined, and examine and determine by student t Statistical significance.P≤0.05 is regarded as significantly.

As a result

It compared the ability that Lm-E7 and Lm-LLO-E7 influences TC-1 growths.It is established on the left flank abdomen of C57BL/6 mouse Subcutaneous tumor.After seven days, tumour has reached palpable size (4-5mm).At the 7th and 14 day, mouse inoculation is given 0.1LD₅₀Lm-E7, Lm-LLO-E7 or Lm-Gag as a contrast and Lm-LLO-NP.The foundation of Lm-LLO-E7 inductions 75% The complete recession of TC-1 tumours, and control tumour growth (Fig. 3) in other 2 mouse in this set.On the contrary, using Lm- The immunity inoculation of E7 and Lm-Gag does not have inducing tumor regression.The experiment is repeated as many times, and always obtains very similar result.Separately Outside, under different immunization protocols, Lm-LLO-E7 has also obtained similar result.In another experiment, single immunization can be controlled More the 5mm TC-1 tumours that mouse is established.

In other experiments, similar result has been obtained with the tumor cell line of other 2 expression E7：C3 and EL-4/E7. In order to confirm the effect of being inoculated with Lm-LLO-E7, respectively at the 60th day or the 40th day with TC-1 or EL-4/E7 tumour cells again Challenge has eliminated the animal of their tumour.The animal being immunized through Lm-LLO-E7 keeps without tumour until experiment terminates (just For TC-1, the 124th day；For EL-4/E7, the 54th day).

Therefore, antigen can enhance the immunogenicity of the antigen as the expression of the fusion protein with Δ LLO.

Example 2：LM-LLO-E7 processing causes TC-1 specific spleen cells to be proliferated

In order to measure inductions of the Lm-E7 to T cell with Lm-LLO-E7, it is special to measure TC-1 in immunized mouse Property proliferative response (the active measurement of antigen specific immune).From through Lm-LLO-E7 be immunized mouse splenocyte when with 20: 1,40: 1,80: 1 and 160: 1 splenocyte：When TC-1 ratios are exposed to TC-1 cells (source as E7) through irradiation Proliferation (Fig. 4) occurs.Conversely, only showing the increasing of background level from the splenocyte through the immune mouse of Lm-E7 and rLm controls It grows.

Example 3：E7 and LLO, ActA or PEST amino acid sequence merge enhancing E7 specific immunities and to generate infiltration swollen The E7 specific Cs D8 of tumor⁺Cell

Material and experimental method

It is subcutaneously implanted 500mcl (microlitre) in the left flank abdomen of 12 C57BL/6 mouse (n=3)Its Include 100 microlitres of 2 × 10 in phosphate buffered saline (PBS) (PBS)⁵A TC-1 tumour cells and 400 microlitres(BD Biosciences, Franklin Lakes, N.J.).It is small in the 7th, 14 and 21 day Intraperitoneal immunization Mouse, and spleen and tumour were harvested at the 28th day.Tumour MATRIGEL is taken out from mouse, and is cultivated containing 2 milliliters of (m1) RP 10 In the test tube of base on ice 4 DEG C be incubated overnight.Tumour is shredded with tweezers, is cut into 2mm blocks, and with 3ml enzymatic mixtures (in PBS 0.2mg/ml collagenase Ps, 1mg/ml DNAse-1) it is incubated 1 hour at 37 DEG C together.Tissue suspension is passed through into nylon net filter, The NaN of 5% fetal calf serum+0.05% is used in combination₃Solution washing in PBS, is dyed for the tetramer and IFN-γ.

With 10 there are brefeldin A⁷A cell/ml is by splenocyte and tumour cell and 1 micromole (mcm) HPV-16 E7 incubates 5 hours together.Cell is washed twice, and in 50 microlitres of anti-mouse Fc receptor supernatants (2.4G2) 4 DEG C incubate 1 hour or stay overnight.It is permeabilization for surface molecular CD8 and CD62L by cell dyeing, use permeabilization kitOr(Pharmingen, San Diego, Calif.) is fixed, and is dyed for IFN-γ. 500,000 event is obtained using double excitation flow cytometry FACSCalibur, and uses Cellquest softwares (Becton Dickinson, Franklin Lakes, NJ) analysis.Calculate (the CD62L of activation^{It is low})CD8⁺IFN-γ secretion in T cell is thin The percentage of born of the same parents.

For tetramer staining, H-2D is allowed^bThe tetramer loads HPV-16 E7 (RAHYNIVTF, the SEQ that phycoerythrin (PE) is coupled ID NO：24) it, is dyed 1 hour in room temperature, the MEL-14 (CD62L) for being used in combination anti-allophycocyanin (APC) to be coupled and FITC couplings CD8 30min is dyed at 4 DEG C.By comparing the tetramer in spleen and in tumour⁺CD8⁺CD62L^{It is low}Cell analyzes cell.

As a result

In order to analyze the ability of Lm-ActA-E7 enhancement antigen specific immunities, TC-1 tumour cells are implanted into mouse, and With Lm-LLO-E7 (1 × 10⁷A CFU), Lm-E7 (1 × 10⁶A CFU) or Lm-ActA-E7 (2 × 10⁸A CFU) it is immune, or It does not handle (unexposed).Mouse tumor from Lm-LLO-E7 and Lm-ActA-E7 groups contains than in Lm-E7 or unexposed The CD8 of the secretion of gamma-IFN of greater percentage in mouse⁺Cell (Fig. 5 A) and tetramer specific C D8⁺Cell (Fig. 5 B).

In another experiment, Lm-LLO-E7, Lm-PEST-E7, Lm- Δ PEST-E7 or Lm- are applied to tumor-bearing mice E7epi, and measure the level of the E7 specific lymphocytes in tumour.0.1LD was used at the 7th and 14 day₅₀4 kinds of vaccines processing it is small Mouse.Tumour was harvested at the 21st day, the antibody for being directed to CD62L, CD8 be used in combination and with E7/Db tetramer stainings.In inoculation Lm-LLO- The lymphocyte of tetramerpositive increased percentage (Fig. 6 A) within the tumor is observed in the mouse of E7 and Lm-PEST-E7.It should As a result it is reproducible (Fig. 6 B) in being tested at three.

Thus, Lm-LLO-E7, Lm-ActA-E7 and Lm-PEST-E7 respectively effectively induce the CD8 of infiltration tumour⁺T is thin Born of the same parents and tumor regression.

Example 4：Listeria vaccine carrier causes exempting from for the enhancing to heterologous and endogenous antigen by mouse passage Epidemic disease response

Material and experimental method

Bacterium bacterial strain

Listerisa monocytogenes in mjme bacterial strain 10403S serotypes 1 (ATCC, Manassas, Va.) are to be used for these The parent strain of the wild-type organisms of research and following constructs.Bacterial strain 10403S has when injecting BALB/c mouse in peritonaeum Have about 5 × 10⁴The LD of a CFU₅₀." Lm-Gag " is that (have the subtype B for the phenotype for forming plasomidum comprising HIV-1 bacterial strains HXB Laboratory strains) gag genes copy recombination LM bacterial strains, the gene use modified shuttle vector pKSV7 stable integrations Into Listeria chromosome.Gag albumen is expressed and is secreted by the bacterial strain, as measured by western blot.All bacterial strains are equal The growth in brain heart infusion (BHI) meat soup or agar plate (Difco Labs, Detroit, Mich).

Bacteria Culture

The bacterium individually cloned of the selection from expression passerby's antigen (passenger antigen) and/or fusion protein And the overnight incubation in BHI meat soups.The aliquot of the culture is freezed at -70 DEG C, does not add additive.Pass through the storage Standby liquid, makes culture grow into the O.D. of 0.1-0.2 under 600nm, and aliquot is freezed again at -70 DEG C, does not add Additive.In order to prepare the bacterium library of clone, using procedure above, but after each passage, multiple bacterial clones are selected, and examine The expression of target antigen is looked into, as described herein.By the clone for the expression that confirmed heterologous antigen wherein for passing on next time.

Bacterium is passed in mouse

6-8 week old female BAl BIc/c (H-2d) mouse is purchased from Jackson Laboratories (Bar Harbor, Me) simultaneously In the micro- isolation environment for maintaining pathogen-free domestic.Work in the aliquot of stock culture of the stored frozen at -70 DEG C is thin Bacterium titre by after thawing and using it is preceding on BHI agar plates bed board by measure.It amounts to, by 5 × 10⁵A bacterium is intravenous It is injected into BALB/c mouse.After 3 days, spleen is harvested, is homogenized, and the sample of being serially diluted that spleen is homogenized is incubated in BHI meat soups It stays overnight, then the bed board on BHI agar plates.For further passing on, aliquot is set to grow into 0.1-0.2O.D. again ,- It is freezed at 70 DEG C, and bacterial titer is measured again by being serially diluted.It is after initial passage (0 passage), the process is total It is repeated 4 times altogether.

For the intracellular cytokine dyeing of IFN-γ

By lymphocyte supplemented with 50U/m1 people's recombinant il-2 and 1 microlitre/ml Brefeldin A (Golgistop^TM PharMingen, San Diego, CA) complete RPMI-10 culture mediums in presence or absence of HIV-GAG cytotoxic T Cell trains (CTL) epitope (AMQMLKETI；SEQ ID No：25), Listeria LLO (GYKDGNEYI；SEQ ID No：26) or HPV viruse gene E7 (RAHYNIVTF；SEQ ID No：24) with 1 micromolar concentration culture 5 hours in the case of.It is right first Cell carries out padding, is washed out and receives to be suggested according to manufacturer using Cytofix/Cytoperm kits The intracellular cytokine dyeing that (PharMingen, San Diego, CA) is carried out.Intracellular IFN-γ is dyed, FITC has been used The rat anti-mouse IFN-γ monoclonal antibody (clone XMG 1.2) and its isotype controls Ab (rat IgG1 of coupling；Derive from PharMingen).It amounts to, by 10 at 4 DEG C⁶A cell is in the PBS containing 1% bovine serum albumin(BSA) and 0.02% sodium azide Dyeing 30 minutes, are then washed 3 times in FACS buffer solution in (FACS buffer solution).In FACScan^TMFlow cytometer or FACSCalibur^TMSample data is acquired on instrument (Becton Dickinson, San Jose, CA).It uses FACSCalibur^TMFlow cytometer carries out CD8, and (PERCP couplings, rat anti-mouse clones 53-6.7Pharmingen, San Diego, Calif.), CD62L (APC coupling, rat anti-mouse, clone MEL-14) and three color streamings of intracellular IFN-γ it is thin Born of the same parents' art, and by CELLQuest software (Becton Dickinson, Mountain View, CA) to data carry out into One step is analyzed.Cell is subjected to CD8 high and CD62L^{It is low}Then gating analyzes their CD8⁺It is dyed with intracellular IFN-γ.

As a result

The virulence of passage enhancing recombination listerisa monocytogenes in mjme in mouse

By three different constructs for determining influence of the passage to recombinant listeria bacterium vaccine carrier.These constructs In two carrying passerby's antigens genomes be inserted into：First includes HIV gag genes (Lm-Gag), and second includes HPV E7 genes (Lm-E7).The plasmid that third (Lm-LLO-E7) includes has the passerby merged with the LLO of clipped form anti- The gene of the fusion and coding prfA of former (HPV E7), prfA are the positive regulatory factors for controlling Listeria virulence factor. The plasmid, so that in host living, selects pressure to be beneficial to plasmid conservation for supplementing prfA negative mutants, because There is no plasmid bacterium then non-toxic.All 3 constructs have bred many generations extensively in bacterium in vitro.

Sub-culturing bacteria results in the increase of bacterial virulence, and as measured by the existence bacterial population in spleen, each is all It is preceding 2 generation.For Lm-Gag and Lm-LLO-E7, virulence increases with each passage, until 2nd generation (Fig. 7 A).Containing plasmid Construct Lm-LLO-E7 shows most significant virulence and increases.Before passage, the primary immune dosage of Lm-LLO-E7 must increase To 10⁷A bacterium, and spleen must be harvested on day 2 to recycle bacterium (and for the 10 of Lm-Gag⁵A bacterium it is initial Dosage then harvests on day 3).After initial passage, the standard dose of Lm-LLO-E7 is sufficient to make and can harvest on day 3.It is right In Lm-E7, the bacterium through not passing on, virulence increases by 1.5 orders of magnitude (Fig. 7 B).Therefore, Li Si is increased by mouse passage The virulence of special bacteria vaccine bacterial strain.

Passage increases listerisa monocytogenes in mjme and induces CD8⁺The ability of T cell

Next, using HIV-Gag peptides AMQMLKETI (SEQ ID No：And LLO 91-99 (GYKDGNEYI 25)；SEQ ID No：26), by carrying out intracellular cytokine dyeing with MHC I class specific immunity dominant epitopes, and passage pair is determined Antigentic specificity CD8⁺The effect of T cell.By 10³The passage bacterium (Lm-Gag) of a CFU is injected into mouse and produces largely HIV-Gag specific Cs D8⁺T cell, and the Lm-Gag that do not pass on of same dose does not induce detectable Gag specific Cs D8⁺T is thin Born of the same parents.The dosage for not passing on bacterium is even increased by 100 times and does not also compensate their relative virus force；In fact, even higher Detectable Gag specific Cs D8 is not caused under dosage yet⁺T cell.Same dose using passage bacterium is thin by Gag specificity Ts Born of the same parents' induction increases 50% (Fig. 8).Using LLO specific Cs D8⁺T cell observed identical antigentic specificity CD8⁺T cell Induction pattern, caused by showing these results not and being the property by passerby's antigen, because they are anti-with endogenous Listeria It is observed when former LLO.Therefore, the immunogenicity of Listeria vaccine strains is increased by mouse passage.

Example 5：Plasmid containing PrfA in the LM bacterial strains lacked with PrfA is steady there is no antibiotic Fixed

Material and experimental method

Bacterium

Listerisa monocytogenes in mjme strain X FL7 includes 300 base pair deletions in prfA genes.XFL7 takes Restore to band part virulence and assign the pGG55 of CAP resistances, and has in U.S. Patent Application Publication No.200500118184 It is described.

The solution development of plasmid is extracted from Listeria

By 1mL listerisa monocytogenes in mjme Lm-LLO-E7 research work cell bank virus inoculations to contain 34 μ g/ In the 27mL BH1 culture mediums of mL CAP, and grown 24 hours under 37 DEG C and 200rpm.

Make the culture samples precipitation (15000rpm continues 5 minutes) of seven 2.5mL, and by sediment at 37 DEG C with 50 μ l lysozyme solns incubate the different durations from 0-60 minutes.

Lysozyme soln：

- 29 μ l1M dipotassium hydrogen phosphates

- 21 μ 11M potassium dihydrogen phosphates

40% sucrose of -500 μ l (passes through 0.45 μm of filter aseptic filtration)

- 450 μ l water

- 60 μ l lysozymes (50mg/mL)

After being incubated with lysozyme, suspension is centrifuged as previously described, and abandon supernatant.Then receive each precipitation logical Cross the QIAprep Spin Miniprep of modified version(Qiagen, Germantown, Maryland) scheme carries out Plasmid extraction.Scheme is amended as follows：

1. the volume of buffer solution PI, P2 and N3 improve three times, so that increased biomass can be cracked completely.

2. the lysozyme of 2mg/mL is added in the cell being resuspended, P2 is then added.Then by cracked solution at 37 DEG C It incubates 15 minutes, then is neutralized.

3. Plasmid DNA is resuspended in 30 μ L rather than to improve concentration in 50 μ L.

In other experiments, cell is incubated 15 minutes in P1 buffer solutions+lysozyme, then (is split with P2 at room temperature Solve buffer solution) and P3 (neutralization buffer) incubations.

The Plasmid DNA of the separation derived from each squamous subculture of equal volume is run on 0.8% Ago-Gel, uses bromine Change the sign of the dyeing of second ingot and observation structure or segregational instability.

The result shows that from the plasmid extraction efficiency of listerisa monocytogenes in mjme Lm-LLO-E7 as lysozyme incubates The extension of time and improve, at about 50 minutes incubate when reach optimum level.

These results provide the effective ways that plasmid is extracted from Listeria vaccine strains.

Replica plating

By the diluted sample of primary culture be not present or there are in the case of 34 μ g/mL CAP in the agar containing LB or TB Bed board on plate.Counting difference between selectivity and non-selective agar is used to determine whether there are plasmid any apparent point From unstability.

As a result

Something lost of the pGG55 plasmids in listerisa monocytogenes in mjme strain X FL7 there is no antibiotic Pass stability (that is, there is no selection pressure such as antibiotic selective pressure the degree that is kept by bacterium of plasmid or Plasmid keeps stablizing associated degree with bacterium) by Luria-Bertani culture mediums (LB：5g/L NaCl、10g/ml Soy peptone, 5g/L yeast extracts) and Terrific Broth culture mediums (TB：10g/L glucose, 11.8g/L soybean eggs White peptone, 23.6g/L yeast extracts, 2.2g/L KH₂PO₄、9.4g/LK₂HPO₄) led in a manner of cultivating in duplicate in the two It crosses serial passage culture and assesses.By the cell of the 50mL fresh culture fixed quantities in shaking flasks of the 250mL with baffle (1ODmL) is inoculated with, then with 24 hours interval secondary cultures.Culture is warm under 37 DEG C and 200rpm in orbital shaker It educates.In each secondary culture, OD is measured₆₀₀, and use it for calculating the cell doubling time (or algebraically) having been subjected to, until 30 generations and 42 generations are respectively reached in LB and TB.The known of each subculture stage (every about 4 generations) is precipitated by centrifugal process Then the cell (15ODmL) of quantity uses above-mentioned Qiagen QIAprep SpinScheme extracts plasmid DNA.After purification, so that Plasmid DNA is received agarose gel electrophoresis, then carry out ethidium bromide staining.Although the matter in prepared product The amount of grain is slightly changed between samples, but general trend is constant (Fig. 9 A- of amount of plasmid for the algebraically of bacterium B).Therefore, pGG55 shows stability in strain X FL7, or even there is no antibiotic.

Also by monitoring matter during stability study by the photocopy culture on a lbmc agar plate of each subculture stage Grain stability.It is consistent with the result derived from agarose gel electrophoresis, in LB or TB Liquid Cultures (being respectively Figure 10 and Figure 11) The quantity of the cell containing plasmid is without overall variation during entire research.

These find to prove the plasmid of coding prfA there is no antibiotic in the Liszt being mutated containing prfA Stability is shown in bacteria strain.

Materials and methods (example 6-10)

PCR reagent：

For expanding prfA genes and distinguishing that the primer of D133V mutation is shown in table 1.By by primer in TE buffer solutions In be diluted to 400 μM and be prepared for the stock solution of primer ADV451,452 and 453.By the aliquot of stock solution in water 20 μM are diluted further in (PCR grades) with preparation work solution.Primer is stored in -20 DEG C.Reagent is in table used in PCR It is shown in 2.

1. primer ADV451,452 and 453 of table.

Table 2.PCR reagents.

It is prepared by Plasmid DNA

Use PureLink^TMExtracts kit (Invitrogen, K2100-05) is measured in HiPure plasmids according to manufacturer Explanation extract and purify there is (pGG55 by prepared by middle amount from Escherichia coli or listerisa monocytogenes in mjme D133V the pGG55 plasmids) and without (pGG55 WT) prfA being mutated.For the plasmid purification from Listeria, will carry The bacterium bacterial strain of pGG55 D133V or WT plasmids is from the backlog streak inoculation of freezing to supplemented with chloramphenicol (25 μ g/ml) In BHI agar plates.Make the single colony from each bacterial strain in the 5ml selective mediums (BHI with 25 μ g/ml chloramphenicol Meat soup) at 37 DEG C and acutely rock it is lower growth 6 hours, then with 1: 500 passage be seeded in 100ml selective mediums It is grown overnight under the conditions of similar.It will be harvested from the bacterium being incubated overnight by being centrifuged 10 minutes at 4,000xg, then It is resuspended in the buffer solution R3 containing 2mg/ml lysozymes (Sigma, L7001) (buffer solution is resuspended).By bacterial suspension at 37 DEG C It is lower to incubate at least 1 hour, then go to conventional scheme.Diluted matter is measured at 260nm and 280nm in spectrophotometer The concentration and purity of grain.In order to prepare template DNA, therefrom amount prepares stock solution and is resuspended in pGG55 D133V and WT plasmids Reach the ultimate density of 1ng/ μ l in water.For pGG55 WT plasmids, serial 10 times of diluted samples are prepared for from 1ng/ μ l solution, it is right Ying Yucong 10^-1To 10^-7Dilution.

Test the prfA specific PCR schemes of clinical grade material

Reaction mixture includes 1x PCR buffer solutions, 1.5mM MgCl₂, 0.8mM dNTP, 0.4 μM of each primer, 0.05U/ μ l Taq archaeal dna polymerases and 0.04ng/ μ l pGG55 D133V template plasmids.For each test, 10 pipes are needed, The key component of every pipe is shown in table 3 in 25 μ l reactions.PCR is reacted, with enough 11 secondary responses as shown in table 4 Reagent prepare main mixture, then the 24 μ l PCR mixtures are added in each pipe.Then, 1 μ l in total are serially diluted PGG55 WT plasmids are added in corresponding pipe：1ng in pipe 3；100pg in pipe 4；10pg in pipe 5；1pg in pipe 6；100fg in pipe 7； 10fg in pipe 8；1fg in pipe 9；0.1fg in pipe 10.This is serially diluted sample for calibration standard curve to determine that method is sensitive Degree.In addition, 0.5 μ l water and 0.5 μ l primers ADV451 (20 μM of storing solutions) are added in pipe 1, and 1 μ l water is added in pipe 2, is reached To the final volume of 25 μ l.For 25 μ l reactions, the amount of each reagent of every pipe is shown in table 5.With PCR in the reaction Cycling condition is shown in table 6.

PCR after reaction, 5 μ l Gel Loading buffers (6x, have bromophenol blue) are added in each sample, and is led to Cross 10 μ l of electrophoretic analysis on 1.2% Ago-Gel in tbe buffer liquid.Gel size is 7cm × 7cm × 1cm, has 15 The comb of a sample well (1mm × 2mm).Gel is run about 30 minutes at 100V, until Bromophenol Blue dye reaches the centre of gel. Gel is dyed 20 minutes in ethidium bromide (0.5 μ g/ml), is decolourized 10 minutes in water.It is seen by with ultraviolet light Gel is examined, and is taken pictures.Image is analyzed using ribbon density Survey Software (Quantity One 4.5.1 editions, BioRad).

The a set of individual anti-countermeasures of PCR of table 3. are verified to detect wild type prfA sequences in Lm-LLO-E7 samples Existence in product.

It is prepared by 4. main PCR mixtures of table.

Table 5. is verified using primer ADV451,452 and 453 pairs of methods to detect the existence of wild type prfA sequences PCR schemes.

^aPGG55 WT (1ng in pipe 3；100pg in pipe 4；10pg in pipe 5；1Pg in pipe 6；100fg in pipe 7；In pipe 8 10fg；1fg in pipe 9；0.1fg in pipe 10).

^bIn pipe 1,0.5 μ l water and 0.5 μ l primers ADV451 (20 μM of storing solutions) are added；1 μ l water is added in pipe 2.

Table 6. detects the PCR cycle condition of the existence of wild type prfA sequences using primer ADV451,452 and 453.

Sequencing：

The sequencing of plasmid has been carried out using dideoxy sequencing method.By plasmid pGG55 D133V and pGG55WT with different ratios Rate (1: 1,1: 10,1；100,1: 1,000 and 1: 10,000) mixing.The total amount of plasmid in mixture is kept constant into (500 μ g), And the plasmid comprising wild-type sequence is carried out 10 times about D133V plasmids and is serially diluted to determine the sensitivity of method.

As a result

Example 6：Sequencing is not the sensitive method for the reply for detecting D133V mutation.

In order to estimate the sensitivity being sequenced in detecting wild type prfA sequences, by pGG55 D133V and WT plasmids with not Same ratio is mixed and is sequenced.As a result it is shown in FIG. 12, and disclose sequencing there is height in distinguishing prfA D133V mutation Specific (Figure 12).On the other hand, sensitivity is relatively low, and the wild type prfA pGG55 with detectable peak in the sequence The greatest dilution of plasmid is 1/10 (Figure 12).Although in short, sequencing have very high specificity, this method it is sensitive It spends relatively low, and is unsuitable for screening depositing for rare events (such as prfA D133V be mutated revertant) in Lm-LLO-E7 samples Property.

Example 7：Exploitation high degree of specificity and sensitive PCR method come detect D133V mutation reply.

The muting sensitivity of rare events is detected in view of with sequencing, it is necessary to which developing has the more sensitive of similar specificity Method detects the reply of wild type D133V mutation.In order to realize the target, we devise a kind of method of based on PCR, should In 10,000,000 D133V mutant nucleotide sequences copies of method specific amplification wild-type sequence and enough Sensitive Detections at least 1 wild type prfA copy.We devise 3 primers for this method：ADV451, ADV452 and ADV453 (table 1). ADV451 and ADV452 is forward primer, and difference is the last one nucleotide of 3 ' positions to distinguish the position of prfA genes Set A → T (D133V) mutation at 398.ADV453 primers be positioned at ADV451 and ADV452 primers annealing site downstream about Reverse primer (Figure 13) at 300bp.Expection PCR bands obtained by primer ADV451 or ADV452 and ADV453 are 326bp. Under stringent condition, ADV451 primers should not expand pGG55 D133V plasmids, and ADV452 will be wild type prfA sequence-specifics 's.

Example 8：The specificity of PCR method.

There is very high specificity using the reaction of primer ADV451, and expanded the D133V prfA sequences of mutation (swimming lane 1 to 3), but wild-type sequence (swimming lane 4 to 6) is not expanded.However, when the template DNA for using 5ng rather than using 1ng When, very weak band (Figure 14) can be detected in swimming lane 4.

As shown in Figure 15, wild type prfA sequences (swimming lane 4,5 and 6) have only been expanded using the reaction of ADV452 primers, Band (swimming lane 1,2 and 3) is not detected when the pGG55 for carrying D133V prfA mutation is used as template, or even works as and is reacting It is also such (Figure 16) when middle use 5ng plasmids.In short, being had using the PCR reactions of primer ADV451 and ADV452 very high Specificity, and can distinguish at the positions 398 of prfA genes in pGG55 plasmids(D133V) it is mutated.Base In these as a result, we select the amount of 1ng as the standard volume that will use template DNA in the reaction.

Example 9：The sensitivity of PCR method.

The sensitivity of reaction is tested using the template DNA of 1ng.For carrying the plasmid of wild type prfA sequences, will also The amount of DNA of reduction (corresponds to from 10^-1To 10^-710 times dilution) include in the reaction to estimate sensitivity.In these reactions In, it only used primer ADV452 and ADV453.With 30 cycle (10 cycle annealing temperatures be 53 DEG C, another 20 The annealing temperature of cycle is 50 DEG C) PCR reactions in, the sensitivity of method is 1/100,000 (data are not shown).In Fig. 5 Shown, PCR cycle number is increased to 37 and improves the visual sensitivity of method to 10 by the detection for D133V revertants^-6, without Apparent damage specificity.When 1ng plasmids are used as initial amount of DNA, 10^-6Visible apparent band under dilution, this corresponds to The detection level that 1 wild-type sequence copies in 1000000 D133V mutant.After longer exposure in swimming lane 1 and 9 only Very weak band can be observed, again ensured that method is reliably specific.On the other hand, when being started with 5ng DNA, 10^-7Band is can easily detect under dilution, to improve the sensitivity of PCR.However, using pGG55 D133V plasmids Also the band that can detect similar strength, to show the specific limit (Figure 17) of method.It is seen by pGG55 D133V plasmids The band observed may be the non-specific amplification due to being mutated to D133V with primer ADV452, by increased recurring number, The mutation can obviously accumulate.These the result shows that unobvious damage specificity in the case of this method sensitivity limit position Between 1: 1,000,000 and 1: 10,000,000.

Example 10：Express the recombinant listeria bacterium of the fusion protein (LM-LLO-E7) of LLO and E7

The attenuation degree of the bacterial strain secretes fusion egg than about 4-5 order of magnitude of wild-type parent bacterial strain 10403S high White tLLO-E7.The immunotherapy is based on skeleton XFL7, passes through the irreversible missing in virulence gene activating transcription factor prfA And it is derived from 10403S.PrfA regulates and controls several virulence gene such as Listeriolysin O (LLO), ActA, PlcA (phosphatidases A), the transcription of PlcB (phospholipase B) etc., these genes are the growth of internal intracellular and existence of listerisa monocytogenes in mjme Required.Plasmid pGG55 is kept by the selection of " chloramphenicol " by Lm-LLO-E7 in vitro.However, for Lm-LLO-E7 For the internal holding of plasmid, the copy of the prfA (D133V) of mutation is carried, it is had proven to and combines and activate poison in DNA Activity in terms of the transcription of power gene is not so good as wild type PrfA.We have observed that causing with the complementation of the prfA of mutation Compared with wild-type strain 10403S about 40 times are reduced from the amount of the Lm-LLO-E7 LLO secreted.This is implied：Bacterial strain Lm-LLO- E7 may show the expression of virulence gene actA, inlA, inlB, inlC, plcB for being regulated and controled by PrfA for reducing etc.. In Lm-LLO-E7, the table by the PrfA different virulence genes regulated and controled may be led to the prfA of the mutation complementations copied Up to reduction, the about 4-5 order of magnitude is attenuated so as to cause overall.

Example 11：High dose ADXS11-001 (listerisa monocytogenes in mjme (LM)-Listeriolysin O (LLO) immunotherapy) treatment women cervical carcinoma

Method

This is an I phase, dosage escalation, open label research (NCT02164461), has been selected in age >=18 year old and has suffered from Duration, metastatic or recurrent squamous cervical carcinoma/adenocarcinoma of the uterine cervix simultaneously record progression of disease (being not suitable for operation/standard radiotherapy) Women.

Other criterion of acceptability include：In the presence of can measure according to response evaluation criteria in solid tumors (RECIST v1.1) And/or appreciable disease；Eastern United States tumour cooperative groups (ECOG) physical state is 0-1；It is directed to transfer with receiving≤2 times Property disease the past treatment.There is patient measurable disease (RECIST v1.1), record to have progression of disease/to the past therapy It does not tolerate, and ECOG PS are 0-1.Primary Endpoint is safety and the tolerance of ADXS11-001；Secondary endpoints include that evaluation is swollen Tumor is reacted and progression free survival phase, and the relevant immunological investigation result of assessment.In 12 weeks treatment cycles, patient every 3 Week receives ADXS11-001.It is designed using 3+3 and carries out dosage escalation with 2 dosage：5×10⁹A colony forming unit (CFU；Agent Amount level 1 (DL1)) and 1 × 10¹⁰A CFU (dosage level 2 (DL2)).The dose-limiting toxicity observed based on ＜ 33% (DLT) rate come select recommend II phase dosage.Using RECIST v1.1 curative effect is assessed to immune related RECIST.Only at the 1st Period acquires blood sample, and for immunologic surveillance and cell factor/chemotactic factor (CF) analysis.

As a result

The selected of dosage level 1 (DL1) is completed (n=6).Initially, 3 patient selections are to the first dose cohort；1 trouble There are 3 grades of low blood pressure as DLT in person, causes in addition to be selected in 3 patients.Average age is 51.3 years old, 66.7% (n=4) ECOG in baseline is 0, and the patient of 83.3% (n=5) has flaser texture.All patients receive based on cis-platinum The past Concurrent chemoradiotherapy+average 1.5 (range 0-5) items treatment line systemic chemotherapy.16 doses of ADXS11- of safely use in total 001；The group that enters of dosage level 2 (DL2) starts.When giving the maximum tolerated dose and curative effect of determining ADXS11-001 through more New data.

There are 9 to receive treatment (DL1, n=6 in 10 selected patients；DL2, n=3).The median age be 53 years old, 78% ECOG PS be 0, and 33% receive >=3 treatment line the past systemic therapies.In general, it applied 36 times ADXS11-001 dosage, including 8 times under DL2.All patient experiences >=1 time adverse events (AE), in 8/9 patient It reports and treatment-related AE (TRAE).Betide TRAE in >=3 patients be shiver, vomit, low blood pressure, mistake aroused in interest Speed, fever and nausea.Wherein 99% is 1-2 grades, and 1 patient (DL1) experienced 3 grades of DLT (low blood pressure), not report 4- 5 grades of TRAE.One DL2 patient maintaining treatment >=9 month.Treatment is still continuing, and partial reaction has been recorded.

Example 12：ADXS11-001 Immuno Suppressive Therapies duration/recurrent metastatic squamous or non-squamous cell uterine neck Cancer：The result of the stage I studied from the II phases

Research and design and criterion of acceptability and intervening measure

2 stage designs of subject N=~67Simon；Single armed II 2 stage, multicenter studies phase (NCT01266460)

Age：>=18 years old

Criterion of acceptability：Duration/recurrent metastatic (PRmCC) squamous or non-squamous cervical carcinoma, received to be directed to PRmCC >=1 whole-body dose chemotherapy, do not include the case where receiving the component part of main radical cure sex therapy.Allow the past shellfish Monoclonal antibody is cut down, but is not required.

The measurable disease (RECIST 1.1) of >=1 target lesion

It was applied on day 1 with 1 × 10 in the form of 250-mL is transfused through 60 minutes within every 28 days⁹A colony forming unit is given ADXS11-001.Patient initially receives most 3 dosage, and tracks its clinical progress, the radiology progression of disease of confirmation, difficulty With the toxicity or treatment refusal endured.

After the preliminary analysis in stage 1, modification research is to allow to use with 28 days intervals continuous (3 dosage of ＞) ADXS11-001 is treated, until clinical progress, the radiology progression of disease of confirmation, insufferable toxicity or treatment refusal

All patients receive antihistamine, anti-inflammatory agent and antiemetic before infusion, and are transfused in each ADXS11-001 About 72 hours 7 days oral antibiotic courses for the treatment of started afterwards

Research approach, terminal and crucial criterion of acceptability are as shown in figure 28.Common Primary Endpoint：12 months of ADXS11-001 Survival rate and tolerance/safety.Secondary endpoints：Progression free survival phase (PFS), overall survival (OS) and objective reactivity (ORR)

Statistical method

Sample size calculates the expected empty ratio (null proportion) based on the patient to survive 12 months in history experiment =20%.

Detect that 12 months survival rates improve 15% (extremely under 0.10 one-sided significance level with 90% power of test 35%)

Target sample amount=27 in stage 1, target sample amount=36 in stage 2

After condition power of test at the end of stage 1 is confirmed as >=20%, it is selected that experiment enters the stage 2

- N=29 patient selection's stages 1, and 26 patients receive at least 1 dose of ADXS 11-001 treatment.

Table 7：Baseline demographic counts

FIGO, International Association for Obstetrics；GOG, gynecological tumor group；PS, physical state.

The research treatment exposure of table 8.

9. safety of table (1)

10. safety of table (2)

As a result

The II phases, which are studied, to be represented in group's history to duration or recurrent metastatic (squamous or non-squamous cell) Second 2 step-by-step test of Simon that cervical carcinoma (PRmCC) is carried out, to meet scheme specifically required efficacy and saferry mark Standard is to enter the stage 2.It is immune that the research further provides the leading Lm TechnologyTM of the ongoing Advaxis The stage 1 of 2 phase of the two benches research of therapy axalimogene filolisbac (ADXS-HPV, also referred to as ADXS11-001) Data carry out in the PRmCC patient that the research is in progress after the past systemic therapy for receiving at least one treatment line.

In the patient being in progress after the past systemic therapy for treating line with PRMCC and at >=1, ADXS11-001 is shown 12 months survival rates are 38.5% (n=10/26) (Figure 23).In addition, middle position progression free survival phase (PFS) is 3.1 months (figures 24)。

ADXS11-001 well-tolerateds, 1-2 grades of fatigues, to shiver and generate heat be the AE most often reported.

Only 5 patient experiences with treatment-related 3 grades or 4 grades of AE (n=4,3 grades；N=1,4 grades).

Among 26 patients receiving treatment, 18 complete and (are received in 3 months according to the entire treatment of scheme 3 doses of axalimogene filolisbac), middle position overall survival phase is more than 1 year (12.1 months), 12 months overall survivals Reach 55.6% (Figure 26).Degree (1-3 items treat line) regardless of the past therapy, realizes 12 months life cycles (Figure 27), and axalimogene filolisbac well-tolerateds, 1 grade or 2 grades of fatigues, shiver and fever be it is most common with Treatment-related adverse events.

CONSORT figures (Figure 29) depict selected and then patient receiving treatment sum in stage 1 and 2 and are connect The ADXS11-001 dosage received is distributed.In 26 patients receiving treatment in stage 1, the middle position agent number received is 3 (models Enclose 1-3), 69% (n=18) receives most 3 doses.In 24 patients receiving treatment in stage 2, the middle position agent that is received Number is 2.5 (range 1-6), and 50% (n=12) receives >=3 doses.At clinical test pause (then continuing) again, 10 Patient actively receives ADXS11-001.Wherein, 4 (40%) patients receive >=3 doses, and 6 (60%) patients receive ＜ 3 Agent.Upper table 7 gives the Baseline demographic's statistics and Clinical symptoms of the patient in selected stage 1 and stage 2.

Safety/tolerance

All patients (26 treated in the stage 1 of research；100%) there is at least 1 adverse events (AE).At 24 (92%) in patient, these AE are related to treatment (TRAE)：19 (73%) only have 1-2 grades of TRAE, and 4 (15%) has 3 grades TRAE, 1 (4%) patient has may relevant 4 grades of TRAE.The TRAE of most common ＞ 30% be fatigue, shiver, generate heat, Nausea and headache (table 10)

Safety results in the patient in selected stage 2 are similar to 1 play-by-play of stage.

Curative effect

For the patient (n=26) treated in the stage 1 of research：

- 12 months survival rates are 38.5% (n=10/26).

The patient (n=10/26) to live at 12 months receives 1 treatment line (3/8 patient), 2 treatment lines (6/14 Patient) or 3 the past whole-body dose treatments for treating line (1/4 patient), show, regardless of the degree of the past treatment, to realize 12 months survival rates.

Middle position OS is 7.7 months (95% confidence intervals [CI]：3.9-12.4), middle position progression free survival phase (PFS) is 3.1 months (95%CI：2.8-3.7；Figure 23 and Figure 24).

20/26 through the patient for the treatment of in report researcher assessment be found that best tumor response

- seven patient's (27%) stable diseases (SD), 10 patients's (38%) have progressive disease (PD).

According to the decision of researcher, remaining 6 patient is unable to evaluation response

The subsequent exploration that 18/26 patient (69%) to receiving all 3 doses of ADXS11-001 according to scheme carries out Analysis shows that middle 1 year (12.1 [95%CI of position OS ＞：6.8- is not up to (NR)] a month), 12 months survival rates are 55.6% (figure 26)。

12 months survival rates of GOG/NRG-0265 are advantageously compared with the history GOG clinical tests series in PRmCC Compared with^3-15,18(Figure 30).

For the patient (n=24) treated in the stage 2 of research：

Due to 8.7 months limited median follow-up time time, 12 months survival rates of Primary Endpoint can not calculate.

- 6 months survival rates are 42% (10/24), and middle position OS is 4.8 months (95%CI：3.6-NR) (Figure 31 A)

Although 10/24 (42%) patient stops using ADXS11-001 and gets nowhere or extremely since clinical test suspends It dies, but middle position PFS is 2.6 months (95%CI：2.0-3.2) (Figure 31 B), it is similar to being observed in the stage 1.

In 50% patient (12/24) for receiving 3 doses or more agent ADXS11-001, middle position OS is NR (95%CI： 3.5-NR), the median follow-up time time is 9.2 months, and 6 months survival rates are 67% (Figure 31 B).

20/24 through the patient for the treatment of in report researcher assessment be found that best tumor response.

- 1 (4%) patient experience complete reaction (CR), 8 (33%) experienced SD, and 11 (46%) has PD.

The clinical medical history and image for representing lasting CR are shown in Figure 32 and Figure 33.

In the patient being in progress after the past systemic therapy for treating line with PRmCC and at >=1, ADXS11-001 tolerances Well, and show 38.5% 12 months survival rates (n=10/26).Discovery from the stage 2 highlights right in PRmCC The basic principle for the further controlled research that ADXS11-001 carries out, and prompted in the crowd that severe bevacizumab is treated in advance There are consistent existence to benefit (being respectively the 31%vs 83% in stage 1 and stage 2), especially in those 3 doses of receiving or more In the patient of multi-agent immunotherapy.

Although certain features of the present invention have been illustrated and described herein, present those skilled in the art will think To many modifications, displacement, variation and equivalent form.It will thus be appreciated that the appended claims are intended to cover fall in the present invention True spirit in all such modifications and variations.

Claims

1. a kind of side of duration/recurrent metastatic (the squamous or non-squamous) cervical carcinoma (PRmCC) treated in people experimenter Method, the method includes the step of to subject's administered recombinant Listeria bacterial strain, the Listeria bacterial strain includes weight Group nucleic acid, the nucleic acid include the first open reading frame, the first open reading frame encoding recombinant polypeptide, the recombinant polypeptide Including being fused to the N-terminal segment of HPV-E7 antigens or the LLO albumen of its segment.

2. according to the method described in claim 1, the wherein described Listeria bacterial strain is with 5 × 10⁹A colony forming unit (CFU) Predose application, and wherein will be administered to the subject every 3 weeks with the Listeria bacterial strain of post dose and continue three times Dosage repeats the progression of disease confirmed until the patient experience or reaction completely for every three weeks, to treat the people experimenter In the cervical carcinoma.

3. according to the method described in any one of claim 1-2, wherein the subsequent dose includes 5 × 10⁸A CFU is until 1.0 ×10¹⁰The Listeria bacterial strain of a CFU.

4. method according to any one of claim 1-3, wherein the method carry out 12 weeks treatment cycles.

5. according to the method described in claim 4, being wherein single maintenance or the reinforcing dosage of certain intervals after the method.

6. according to the method described in claim 1, the wherein described Listeria bacterial strain is with 1 × 10⁹A colony forming unit (CFU) Predose application, and wherein by with the Listeria bacterial strain of post dose every 3 weeks or 4 weeks are administered to the patient.

7. according to the method described in claim 6, when the wherein described Listeria bacterial strain is applied every time through 15 minutes periods with The form application of 80-250ml infusions.

8. according to the method described in any one of claim 5-6, wherein the Listeria bacterial strain is using 3 months in total or about 12 weeks.

9. according to the method described in any one of claim 1-8, wherein every continue administration for 3-4 weeks until progression of disease or complete Reaction.

10. according to the method described in any one of claim 1-9, wherein the recombinant nucleic acid also includes the second open reading Frame, the second open reading frame encoding mutant body prfA genes.

11. according to the method described in claim 10, the wherein described mutant prfA gene codes D133V mutation.

12. according to the method described in any one of claim 10-11, wherein the mutant prfA genes supplement prfA genes Group mutation or missing.

13. according to the method described in any one of claim 1-11, wherein the application is intravenous or oral administration.

14. according to the method described in any one of claim 1-13, wherein the N-terminal segment of the LLO albumen includes SEQ ID NO:2。

15. according to the method described in any one of claim 1-14, wherein the recombinant listeria bacterium bacterial strain is recombination monokaryon Monocytogenes Listeria bacterial strain.

16. according to the method described in any one of claim 1-15, wherein the recombinant listeria bacterium bacterial strain is applied described It is passed on by animal reservoir with before step.

Further include with comprising the HPV-16 E7 or the guiding E7 17. according to the method described in any one of claim 1-16 The immunogenic composition of antigen presentation is inoculated with the step of people experimenter.

18. according to the method described in any one of claim 1-17, wherein the recombinant listeria bacterium bacterial strain have been stored in it is cold In jelly or lyophilized cells library.

19. a kind of method for treating the cervical carcinoma in people experimenter, the method includes being put to the subject using including The step for the treatment of the conjoint therapy with recombinant listeria bacterium bacterial strain, the Listeria bacterial strain include recombinant nucleic acid, the nucleic acid packet Containing the first open reading frame, the first open reading frame encoding recombinant polypeptide, the recombinant polypeptide includes to be fused to HPV-E7 The N-terminal segment of antigen or the LLO albumen of its segment, wherein the Listeria bacterial strain is with 5 × 10⁹A colony forming unit (CFU) predose application, and the Listeria bacterial strain with post dose wherein is applied to the patient every 3 weeks, thus control Treat the cervical carcinoma in the people experimenter.

20. according to the method for claim 19, wherein applying three doses of subsequent doses, or wherein every three weeks repeat institute State the progression of disease or reaction completely that subsequent dose confirms until patient experience.

21. according to the method described in any one of claim 1-20, wherein the cervical carcinoma is duration/recurrent metastatic (squamous or non-squamous) cervical carcinoma.

22. according to the method described in any one of claim 19-21, wherein the subsequent dose includes 5.0 × 10⁸-1.0× 10¹⁰The Listeria bacterial strain of a CFU.

23. according to the method described in claim 19-21, wherein the method carries out 12 weeks treatment cycles.

24. according to the method for claim 23, being wherein single maintenance or the hardening agent of certain intervals after the method Amount.

25. according to the method described in any one of claim 19-24, wherein the method further includes applying recombination Lee Subject applies at least one chemoradiotherapy therapy described in the forward direction of this special bacteria strain.

26. according to the method for claim 25, wherein the chemoradiotherapy that the subject receives to be no more than 2 the past dosage is treated Method.

27. according to the method described in claim 25-26, wherein the chemoradiotherapy therapy is cis-platinum.

28. according to the method for claim 27, wherein the chemoradiotherapy therapy include using 2 courses for the treatment of cis-platinum with it is parallel Radiotherapy (54Gy is divided into 30 times, intensity modulated radiation therapy).

29. according to the method for claim 28, wherein the radiotherapy lasts about 6 weeks.

30. according to the method described in claim 19-29, wherein before the application recombinant listeria bacterium bacterial strain, subject Receive the systemic chemotherapy of average 1.5 (range 0-5) items treatment line.

31. according to the method described in claim 19-30, wherein the recombinant nucleic acid also includes the second open reading frame, it is described Second open reading frame encoding mutant body prfA genes.

32. according to the method for claim 31, wherein the mutant prfA gene codes D133V is mutated.

33. according to the method described in any one of claim 31-32, wherein the mutant prfA genes supplement prfA genes Group mutation or missing.

34. according to the method described in claim 19-33, wherein the application is intravenous or oral administration.

35. according to the method described in any one of claim 19-34, wherein the N-terminal segment of the LLO albumen includes SEQ ID NO:2。

36. according to the method described in any one of claim 19-35, wherein the recombinant listeria bacterium bacterial strain is recombination monokaryon Monocytogenes Listeria bacterial strain.

37. according to the method described in any one of claim 19-36, wherein the recombinant listeria bacterium bacterial strain is applied described It is passed on by animal reservoir with before step.

Further include with comprising the HPV-16 E7 or the guiding E7 38. according to the method described in any one of claim 19-37 The immunogenic composition of antigen presentation is inoculated with the step of people experimenter.

39. according to the method described in any one of claim 19-38, wherein the recombinant listeria bacterium bacterial strain have been stored in it is cold In jelly or lyophilized cells library.