CN108330178A - It is a kind of detection tomato early blight bacterium loop-mediated isothermal amplification (LAMP) primer and application - Google Patents
It is a kind of detection tomato early blight bacterium loop-mediated isothermal amplification (LAMP) primer and application Download PDFInfo
- Publication number
- CN108330178A CN108330178A CN201711013849.2A CN201711013849A CN108330178A CN 108330178 A CN108330178 A CN 108330178A CN 201711013849 A CN201711013849 A CN 201711013849A CN 108330178 A CN108330178 A CN 108330178A
- Authority
- CN
- China
- Prior art keywords
- early blight
- lamp
- blight bacterium
- tomato early
- tomato
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of loop-mediated isothermal amplification (LAMP) primers of detection tomato early blight bacterium and its application, the primer to be made of F3, B3, FIP and BIP4 specific primers, and nucleotide sequence is as shown in SEQ ID NO.1 4.The present invention solves the problems, such as that long period needed for the detection method of tomato early blight bacterium in the prior art, time-consuming and laborious, cumbersome, poor specificity and PCR detection techniques need the expensive devices such as thermal cycler instrument, the detection architecture of the present invention is under LAMP amplification conditions, energy is quickly, efficient, height is special, detects tomato early blight bacterium with sensitivity, suitable for the Site Detection of pathogen and disease, it is easy to promote and apply on a large scale, reliable technology and theoretical foundation is provided for prevention early blight of tomato.
Description
Technical field
The invention belongs to corps diseases detection, identification and Prevention Technique fields, and in particular to the ring of tomato early blight bacterium
Mediated isothermality amplification（LAMP）Detection primer and its application can be used for the molecule inspection that tomato early blight bacterium is quick, sensitive and special
It surveys, while can be used for the early diagnosis of early blight of tomato and the monitoring and identification of germ.
Background technology
Tomato（Solanum lycopersicumL.）It is full of nutrition for solanaceous vegetables, it is people universal favorite one
Kind vegetables, have higher edible value, and adaptability is stronger in addition, and all parts of the country are generally cultivated, very popular, economical
Remarkable benefit.With the development of Greenhouse and installation agriculture technology, tomato planting realizes year-round supply production, but in life
There is also some problems in production, wherein pest and disease damage is one of an important factor for influencing tomato production sustainable development.
By sporulation（Alternaria solani）Early blight of tomato is main in tomato production caused by infecting
One of disease and a kind of worldwide disease, it is all very high in the ground incidence such as the U.S., Australia, Israel, India, Greece,
Production loss 35%-78% can be made when serious, in China Heilungkiang, Jilin, Shandong, Hebei, Shanxi, Guangdong, lake since the eighties
The most areas such as north, Jiangsu and Fujian also generally occur, and harm is on the rise, and general time incidence is caused 10% or so
Production loss 10%-30%, popular time incidence up to 100%, production loss up to 30%-40%, or even total crop failure, become open country,
Important disease in tomato in greenhouse production.Tomato early blight bacterium mainly with mycelia and conidium with diseased plant residuum in the soil
It is overwintering, weather conditions suitable for when, generate the source that new conidium is First aggression, the conidium on scab is mainly by wind and rain
Deng propagating, invaded by stomata or wound, condition suitable for when, only need that scab can be formed within 2-3 days after germ intrusion host, then
A large amount of conidium can be generated by 3-4 days, causes to be repeated several times and infect.The disease can cause fallen leaves, fallen flowers, shedding and
Disconnected skill, it is very big to yield effect, 50% or more production loss can be made when serious, with the appearance and its increasingly of early blight of tomato
Seriously, therefore, it is necessary to establish a set of rapid sensitive detection method be used for early blight of tomato early diagnosis, prevent its from
Region of disease is propagated to non-region of disease, is of great significance to the timely control of early blight of tomato.
At present detection tomato early blight bacterium method it is very much, mainly in the conventional way with molecular biology method based on, i.e.,
It is separately cultured, Pathogenicity, Symptom Observation etc. and advanced Protocols in Molecular Biology include DNA probe, round pcr and serum
Immunology detection etc., traditional detection method has played important function to a certain extent, but this method is time-consuming, needs under normal circumstances
5~7 days are taken, sometimes up to 10~15 days, it is difficult to meet the needs of Rapid identification；Although nucleic acid probe hybridization technology is special, spirit
It is quick, but complex steps；It polymerize enzyme-linked formula reaction (polymerase chain reaction, PCR) and real-time fluorescence quantitative PCR
(real-time PCR) technology is although sensitive, quick, but two methods require laboratory to have PCR instrument or fluorescent quantitation
PCR equipment, and height is required to operator quality, and need to obtain result by electrophoresis step after PCR amplification to be also one complicated
The problem of, it is difficult to large-scale promotion application in the agricultural sector of base.
Loop-mediated isothermal amplification technique (Loop-mediated isothermal amplification, LAMP) is a kind of
Novel nucleic acid amplification technologies.Amplified reaction carries out (60-65 DEG C) at a constant temperature, is a kind of special, efficient, quickly amplification
The technology of DNA.Since the amplification efficiency of LAMP is very high, amplified reaction result can be by visually seeing after fluorescent dyeing
It examines；Amplified reaction can generate a large amount of magnesium pyrophosphate and make reaction that muddiness be presented, can be straight without electrophoresis after LAMP is expanded
The PCR instrument for visually observing whether reaction has turbid phenomenon to judge, and not needing be expensive is connect, the base of cause of disease is can be widely applied to
Detection.Have not yet to see the related technology reports for being used to detect tomato early blight bacterium using LAMP technology.
Invention content
The object of the present invention is to provide a kind of loop-mediated isothermal amplification (LAMP) primer of detection tomato early blight bacterium and application, needles
To being based primarily upon morphological feature to tomato early blight bacterium detection and identification in the prior art, time-consuming for method, program is cumbersome, warp
The property tested is strong, accuracy is low, it is difficult to accomplish the timely propagation that pathogen is monitored and controlled that disease occurs, popular problem, with
And existing PCR Molecular Detections are needed by the expensive instruments such as amplification instrument, and the problems such as detection time is longer, provide tomato early epidemic
The new molecular detecting method of germ carries out LAMP detections to tomato early blight bacterium, detection cycle is short, accuracy is high, sensitivity is high,
Visually observe testing result.
It achieves the object of the present invention and includes the following steps（Technical solution）：
1. the design of tomato early blight bacterium LAMP detection specific primers：
By measuring tomato early blight bacterium（Alternaria solani）With the ribosomes transcribed spacer of other pathogens
（ITS）Gene belongs to different inter-species ITS gene orders to chain lattice and is compared, utilizes online LAMP primer design software
Primer software Explorer V4 (http://primerexplorer.jp/elamp4.0.0/index.html;
Eiken Chemical Co., Japan) a set of tomato early blight bacterium specificity LAMP primer group of design, by F3, B3, FIP and
BIP is formed, and primer sequence is as follows：F3:5 '-TCTCTTGGTTCTGGCATCGA-3 ', B3:5’-TTAAGGCGAGTCTCC CGC-
3 ', FIP:5 '-GGCGCAATGTGCGTTCAAAGAT-GAACGCAGCGAAATGC GATA-3 ', BIP: 5’-
TGGTATTCCAAAGGGCATGCCT-CCCAACACCAAGCAAA GCT-3’ 。
2. the foundation of tomato early blight bacterium LAMP detection method, includes the following steps：
（1）Extract sample to be tested genomic DNA.
When for detecting pathogen pure culture, genomic DNA is extracted using CTAB methods, the specific method is as follows：It takes
A small amount of hypha powder is in 1.5 mL centrifuge tubes（Hypha powder, which had just covered semicircular base, to be advisable）, 900 μ L 2%CTAB are added（16
Alkyl trimethyl ammonium bromide）Extracting solution（2% CTAB；100 mmol/L Tris-HCl, pH 8.0；20 mmol/L EDTA,
pH8.0；1.4 mol/L NaCl）With 90 μ L SDS（Neopelex）【Note：CTAB, SDS need 60 DEG C of preheatings】, make
Mixing, 60 DEG C of water-bath 1h are vibrated with oscillator（DNA is discharged into buffer solution）, 12000 rmin-1Centrifuge 15 min；Take supernatant
700 μ L of liquid, add isometric phenol, chloroform, isoamyl alcohol mixed liquor（Volume ratio is 25:24:1）, gently vibrate mixing, 12000 r
min-1Centrifuge 9 min；500 μ L of supernatant are taken, isometric chloroform is added and extracts again once, 12000 rmin-1Centrifugation 5
min；350 μ L of supernatant are taken, 3 molL of 1/10 supernatant volume are added-1NaAc and 2 times of anhydrous second of supernatant volume
Alcohol, -20 DEG C of precipitations 30 min, 12000 rmin-1Centrifuge 5 min；Liquid is discarded supernatant, 700 μ L ice, 70% ethyl alcohol is added and carries out
Washing（Slightly centrifuge；Incline and falls supernatant）, dried on superclean bench to alcohol-free taste, 30 ~ 60 μ L TE be added（10 mmol/
L Tris-HCl, 0.1 mmol/L EDTA, pH 8.0）Solution is dissolved, and is obtained DNA solution, is used ultraviolet specrophotometer
Detection DNA concentration and to be diluted to 100 ng/ μ L for use.
For detecting in plant tissue there are when tomato early blight bacterium, DNA, specific mistake are extracted using NaOH rapid cleavage methods
Journey is as follows：10 μ L, 0.5 mol/L NaOH are added into every milligram of plant tissue, after tissue is fully milled to paste in mortar
It is transferred in 1.5mL centrifuge tubes, 12,000 rpm centrifuge 6 min, take 5 μ L of supernatant that 495 μ L, 0.1 mol/L Tris- are added
HCl（pH=8.0）It is uniformly mixed, 1.0 μ L is taken to be expanded as pcr template；
For detecting in pedotheque there are when tomato early blight bacterium, using soil DNA extracts kit, DNA is extracted.
（2）The foundation of LAMP reaction systems：With step（1）The DNA of extraction is template, and 25 μ L reactions are prepared in PCR pipe
System, including 5 μM of primers Fs 3 and each 1.0 μ L, LAMP reaction mixture of B3 each 1.0 μ L, 40 μM of primers Fs IP and BIP【40
MM Tris-HCl, 20 mM (NH4)2SO4, 20 mM KCl, 16 mM MgSO4, 1.6 mol/L glycine betaines (Betaine), 2.0
MM dNTPs, 0.2wt.% Trion X-100】12.5 μ L, 8 UBst1.0 μ L of polymerase, 1.0 μ L of DNA profiling, with sterilizing
Ultra-pure water complements to 25 μ L；
（3）LAMP reaction conditions：By prepared PCR pipe in 64 DEG C of water-baths isothermal reaction 60min；
（4）The measurement of reaction result：It is measured using fluorescent dye visual observations method or agarose gel electrophoresis method.Using
Fluorescent dye visual observations method, waits for LAMP after reaction, and color developing agent SYBR is added in the amplified production of LAMP reactions
I 1.0 μ L of green, ordinary light colour developing result observe that the judgement of green fluorescence is the positive, i.e., sample is tomato early blight bacterium, orange
（Crocus）It is judged as feminine gender, i.e. sample is not tomato early blight bacterium, and ultraviolet light colour developing result observes sentencing for muddy shape precipitation
Break as the positive, i.e., sample is tomato early blight bacterium, and the judgement of clear, colorless shape is feminine gender, i.e., sample is not tomato early blight bacterium.
Using agarose gel electrophoresis method, takes 2.0 μ L LAMP amplified productions to be detected with 2% agarose gel electrophoresis, trapezoidal item such as occur
Shape is judged as the positive, i.e. sample is tomato early blight bacterium, trapezoidal bar shaped does not occur and is judged as feminine gender, i.e., is not early blight of tomato
Bacterium.
Beneficial effects of the present invention：The present invention establishes the quick, easy of tomato early blight bacterium, high specificity, sensitivity
High LAMP detection technique systems, the detection of tomato early blight bacterium in can be used for carrying disease germs plant tissue and soil, or it is used for tomato
Morbidity early period of early blight, initial stage detection, for determining that the best period of disease control has a very important significance.
Compared with prior art, the present invention having technical advantage below and good effect：
1, high specificity, result are reliable：The present invention analyzes tomato early blight bacterium and other pathogen rDNA-ITS in sequence
Difference, choose 6 specific regions, devise 4 specific LAMP primers, any region and primer be not in 6 regions
With cannot carry out nucleic acid amplification, there is very strong specificity.It is established on the basis of the LAMP primer gone out designed by present invention utilization
Tomato early blight bacterium LAMP detection method, only tomato early blight bacterium can detected, and other pathogens do not detect, more
Secondary test result is consistent, illustrates LAMP detection method high specificity of the present invention, as a result reliably.
2, high sensitivity：The present invention can reach 10fg/ μ L to the detection sensitivity of tomato early blight bacterium on DNA level,
With very high sensitivity.
3, quickly：Using detection method, in 1~1.5h testing result can be obtained, and previous PCR or nido
PCR detections need 4~6h that testing result just can be obtained, and the method for the invention substantially reduces operating time, fast and easy.
4, at low cost, easy to operate, simple：Biggest advantage of the present invention is not need previous PCR to detect required PCR
The special instrument of the costliness such as instrument, electrophoresis apparatus, gel imaging system, it is only necessary to which a cheap thermostatical instrument, such as water-bath eliminate
Cumbersome operating procedure and regulation, it is simple and practicable.
5, testing result is intuitive, visually can determine whether：Amplified production of the present invention can be by adding color developing agent to be dyed, and green is
The positive contains tomato early blight bacterium that is, in sample to be tested, orange is feminine gender, illustrates to be free of tomato early blight bacterium, meat in sample to be tested
Eye can determine whether testing result, be not necessarily to electrophoresis detection and gel imaging.
Description of the drawings
Fig. 1 is the LAMP specific detections of tomato early blight bacterium of the present invention.A is the Ago-Gel electricity after LAMP amplifications
Swimming figure, b are the ordinary light irradiation visualization colour developing after LAMP amplifications, and c is the ultraviolet light visualization colour developing after LAMP amplifications,
Wherein 1-3 is tomato early blight bacterium, and 4-8 is respectively tobacco brown spot pathogen, carrot rod method, green onion rod method, melon rod method and Huang
Melon anthrax bacteria, 9 be negative control, and 1-3 shows green fluorescence.
Fig. 2 is tomato early blight bacterium LAMP detection sensitivities of the present invention.A is the agarose gel electrophoresis after LAMP amplifications
Figure, b are the ordinary light irradiation visualization colour developing after LAMP amplifications, and c is the ultraviolet light visualization colour developing after LAMP amplifications,
Middle 1-9 template DNAs concentration is respectively 1ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg, 1 fg, 100ag, 10 ag, and 10
For negative control, 1-6 shows green fluorescence.
Fig. 3 is detection of the detection method to tomato early blight bacterium in incidence of leaf.A is the fine jade after LAMP amplifications
Sepharose electrophoretogram, b are the ordinary light irradiation visualization colour developing after LAMP amplifications, and c is that the ultraviolet light after LAMP amplifications can
It develops the color depending on changing, wherein 1 is positive control, 2-4 is early blight of tomato incidence of leaf, and 5-7 is healthy tomato leaf, and 8 be negative right
According to 1-4 shows green fluorescence.
Specific implementation mode
Below in conjunction with specific embodiment, the present invention is further elaborated, but is not limited to the scope of the present invention.Below
Embodiment is according to conventional laboratory conditions, or has delivered the operating technology regulation described in pertinent literature, or is built according to manufacturer
The experiment condition of view.
Embodiment 1：Tomato early blight bacterium ring mediated isothermal amplification（LAMP）Design and the primer for detecting specific primer are special
Opposite sex verification
1. the extraction of strains tested genomic DNA
Strains tested is extracted using CTAB methods（Table 1）Genomic DNA, the specific method is as follows：Take a small amount of hypha powder in 1.5 mL
In centrifuge tube（Hypha powder, which had just covered semicircular base, to be advisable）, 900 μ L 2%CTAB are added（Cetyl trimethylammonium bromide）
Extracting solution（2% CTAB；100 mmol/L Tris-HCl, pH 8.0；20 mmol/L EDTA, pH8.0；1.4 mol/L
NaCl）With 90 μ L SDS（Neopelex）【Note：CTAB, SDS need 60 DEG C of preheatings】, mixing is vibrated using oscillator,
60 DEG C of water-bath 1h（DNA is discharged into buffer solution）, 12000 r.min-1Centrifuge 15 min；700 μ L of supernatant are taken, are added isometric
Phenol, chloroform, isoamyl alcohol mixed liquor（Volume ratio 25:24:1）, gently vibrate mixing, 12000 rmin-1Centrifuge 9 min；It takes
500 μ L of clear liquid are added isometric chloroform and extract again once, 12000 rmin-1Centrifuge 5 min；350 μ L of supernatant are taken, are added
Enter 3 molL of 1/10 supernatant volume-1NaAc and 2 times of supernatant volume absolute ethyl alcohol, -20 DEG C of 30 min of precipitation,
12000 r·min-1Centrifuge 5 min；Liquid is discarded supernatant, 700 μ L ice, 70% ethyl alcohol is added and is washed（Slightly centrifuge；Incline and falls supernatant
Liquid）, dried on superclean bench to alcohol-free taste, 30 ~ 60 μ L TE be added（10 mmol/L Tris-HCl, 0.1 mmol/
L EDTA, pH 8.0）Solution is dissolved, and DNA solution is obtained, and with UV spectrophotometer measuring DNA concentration and is diluted
It is for use to 100 ng/ μ L.
1 strains tested of table
2. the design of tomato early blight bacterium LAMP detection specific primers：
By measuring tomato early blight bacterium（Alternaria solani）With the ribosomes transcribed spacer of other pathogens
（ITS）Gene belongs to different inter-species ITS gene orders to chain lattice and is compared, utilizes online LAMP primer design software
Primer software Explorer V4 (http://primerexplorer.jp/elamp4.0.0/index.html;
Eiken Chemical Co., Japan) a set of tomato early blight bacterium specificity LAMP primer group of design, by F3, B3, FIP and
BIP is formed, and primer sequence is as follows：F3:5 '-TCTCTTGGTTCTGGCATCGA-3 ', B3:5’- TTAAGGCGAGTCTCCC
GC-3 ', FIP:5 '-GGCGCAATGTGCGTTCAAAGAT-GAACGCAGCGAAATGCGA TA-3 ', BIP: 5’-
TGGTATTCCAAAGGGCATGCCT-CCCAACACCAAGCAAAG CT - 3’。
3. the foundation of tomato early blight bacterium LAMP detection method and primer specificity verification
Using the DNA of 1 strains tested of table as template, LAMP amplifications are carried out using F3, B3, FIP and BIP, LAMP detects reaction system
For 25 μ L, including 5 μM of primers Fs 3 and each 1.0 μ L, LAMP reaction mixture of B3 each 1.0 μ L, 40 μM of primers Fs IP and BIP
【40 mM Tris-HCl, 20 mM (NH4)2SO4, 20 mM KCl, 16 mM MgSO4, 1.6 mol/L glycine betaines, 2.0 mM
DNTPs, 0.2% Trion X-100】12.5 μ L, 8 UBst1.0 μ L of polymerase, 1.0 μ L of DNA profiling, with sterilizing ultra-pure water
Complement to 25 μ L；LAMP reaction conditions：64 DEG C of 60 min of incubation；
The measurement of reaction result：It is measured using fluorescent dye visual observations method or agarose gel electrophoresis method.Using fluorescence
Dyestuff visual observations method, waits for LAMP after reaction, and color developing agent SYBR green I are added in the amplified production of LAMP reactions
1.0 μ L, ordinary light colour developing result observe that the judgement of green fluorescence is the positive, i.e., sample is tomato early blight bacterium, orange（It is orange
Color）It is judged as feminine gender, i.e. sample is not tomato early blight bacterium, and ultraviolet light colour developing result observes that the judgement of muddy shape precipitation is sun
Property, i.e. sample is tomato early blight bacterium, and the judgement of clear, colorless shape is feminine gender, i.e., sample is not tomato early blight bacterium.Using fine jade
Sepharose electrophoresis takes 2.0 μ L LAMP amplified productions to be detected with 2% agarose gel electrophoresis, trapezoidal bar shaped such as occurs and judges
For the positive, i.e. sample is tomato early blight bacterium, trapezoidal bar shaped does not occur and is judged as feminine gender, i.e., is not tomato early blight bacterium.
4. primer specificity verification result
LAMP amplifications show only have tomato early blight bacterium colour developing result that green fluorescence, muddy can be observed in the bacterial strain for examination
There is the trapezoid belt of LAMP features in turbid shape precipitation or agarose gel electrophoresis, and other disease fungus colour developing results are orange, clarification
Transparence or agarose gel electrophoresis do not occur amplified band（Fig. 1）, illustrate designed tomato early blight bacterium F3, B3, FIP and
BIP can distinguish tomato early blight bacterium and other pathogens, have the specificity of kind, it is fast to can be used for tomato early blight bacterium
The reliable detection and identification of speed.
Embodiment 2：Tomato early blight bacterium ring mediated isothermal amplification（LAMP）Detection sensitivity measures
1. the preparation of various concentration genomic DNA
Tomato early blight bacterium genomic DNA is diluted with sterile ultra-pure water, the series concentration for being configured to 10 times of orders of magnitude is standby
With；
2. LAMP detection method sensitivity determination and result observation
Using the tomato early blight bacterium genomic DNA of various concentration as template, LAMP amplifications are carried out using F3, B3, FIP and BIP,
LAMP detects reaction system as 25 μ L, including 5 μM of primers Fs 3 and B3 each 1.0 μ L, 40 μM of each 1.0 μ L of primers F IP and BIP,
LAMP reaction mixtures【40 mM Tris-HCl, 20 mM (NH4)2SO4, 20 mM KCl, 16 mM MgSO4, 1.6 mol/L
Glycine betaine (Betaine), 2.0 mM dNTPs, 0.2wt.% Trion X-100】12.5 μ L, 8 UBst1.0 μ L of polymerase,
1.0 μ L of DNA profiling complement to 25 μ L with sterilizing ultra-pure water；LAMP reaction conditions：64 DEG C of 60 min of incubation；
The measurement of reaction result：It is measured using fluorescent dye visual observations method or agarose gel electrophoresis method.Using fluorescence
Dyestuff visual observations method, waits for LAMP after reaction, and color developing agent SYBR green I are added in the amplified production of LAMP reactions
1.0 μ L stand 5min, and ordinary light colour developing result observes that the judgement of green fluorescence is the positive, i.e., sample is tomato early blight bacterium,
It is orange（Crocus）It is judged as feminine gender, i.e. sample is not tomato early blight bacterium, and ultraviolet light colour developing result observes muddy shape precipitation
Judgement be the positive, i.e., sample is tomato early blight bacterium, and the judgement of clear, colorless shape is feminine gender, i.e., sample is not early blight of tomato
Bacterium.Using agarose gel electrophoresis method, 2.0 μ L LAMP amplified productions is taken to be detected with 2% agarose gel electrophoresis, ladder such as occurs
Shape bar shaped is judged as the positive, i.e. sample is tomato early blight bacterium, trapezoidal bar shaped does not occur and is judged as feminine gender, i.e., is not tomato morning
Epidemic disease bacterium.
3. LAMP expands sensitivity technique result
LAMP expand sensitivity technique the result shows that, 1ng, 100pg, 10 pg, 1 pg, 100 fg, 10 fg/ μ L concentration tomato
Early epidemic germ genomic DNA colour developing result can be observed green fluorescence, muddy shape precipitation or agarose gel electrophoresis and LAMP occurs
The trapezoid belt of feature, remaining concentration and negative control colour developing result are that orange, transparence or agarose gel electrophoresis do not expand
Increase band, illustrates that designed tomato early blight bacterium primers F 3, B3, FIP and BIP are expanded by LAMP, to tomato early blight bacterium
Detection sensitivity up to 10 fg/ μ L（Fig. 2）.
Embodiment 3：The LAMP detections of tomato early blight bacterium in incidence tissue
Sample collection：From Zhangzhou, Fujian, Sanming City, Foochow, the typical blade of Xiapu acquisition early blight of tomato disease symptom and health
It is spare that blade takes back laboratory；
The extraction of plant tissue DNA：DNA is extracted using NaOH rapid cleavage methods, detailed process is as follows：To every milligram of plant tissue
Middle addition 10 μ L, 0.5 mol/L NaOH are transferred to after tissue is fully milled to paste in mortar in 1.5mL centrifuge tubes, 12,
000 rpm centrifuges 6 min, takes 5 μ l of supernatant that 495 μ L, 0.1 mol/L Tris-HCl are added（pH=8.0）It is uniformly mixed, takes
1.0 μ L are expanded as pcr template.
Augmentation detection and observation：Using the DNA of said extracted as template, LAMP amplifications are carried out using F3, B3, FIP and BIP,
LAMP detects reaction system as 25 μ L, including 5 μM of primers Fs 3 and B3 each 1.0 μ L, 40 μM of each 1.0 μ L of primers F IP and BIP,
LAMP reaction mixtures【40 mM Tris-HCl, 20 mM (NH4)2SO4, 20 mM KCl, 16 mM MgSO4, 1.6 mol/L
Glycine betaine (Betaine), 2.0 mM dNTPs, 0.2wt.% Trion X-100】12.5 μ L, 8 UBst1.0 μ L of polymerase,
1.0 μ L of DNA profiling complement to 25 μ L with sterilizing ultra-pure water；LAMP reaction conditions：64 DEG C of 60 min of incubation；
The measurement of reaction result：It is measured using fluorescent dye visual observations method or agarose gel electrophoresis method.Using fluorescence
Dyestuff visual observations method, waits for LAMP after reaction, and color developing agent SYBR green I are added in the amplified production of LAMP reactions
1.0 μ L stand 5min, and ordinary light colour developing result observes that the judgement of green fluorescence is the positive, i.e., sample is tomato early blight bacterium,
It is orange（Crocus）It is judged as feminine gender, i.e. sample is not tomato early blight bacterium, and ultraviolet light colour developing result observes muddy shape precipitation
Judgement be the positive, i.e., sample is tomato early blight bacterium, and the judgement of clear, colorless shape is feminine gender, i.e., sample is not early blight of tomato
Bacterium.Using agarose gel electrophoresis method, 2.0 μ L LAMP amplified productions is taken to be detected with 2% agarose gel electrophoresis, ladder such as occurs
Shape bar shaped is judged as the positive, i.e. sample is tomato early blight bacterium, trapezoidal bar shaped does not occur and is judged as feminine gender, i.e., is not tomato morning
Epidemic disease bacterium.
Testing result：Testing result（Fig. 3）Show that the blade of early blight of tomato morbidity is expanded by LAMP, develop the color result
Green fluorescence, muddy shape precipitation or agarose gel electrophoresis can be observed and the trapezoid belt of LAMP features occur, illustrate that there are tomatoes
Early epidemic germ, and healthy leaves and negative control colour developing result are that orange, transparence or agarose gel electrophoresis do not expand
Band illustrates that there is no tomato early blight bacterium, the set technology can be used for the rapid molecular inspection of tomato early blight bacterium in plant tissue
It surveys.
The foregoing is merely presently preferred embodiments of the present invention, all equivalent changes done according to scope of the present invention patent with
Modification should all belong to the covering scope of the present invention.
SEQUENCE LISTING
<110>Inst. of Plant Protection, fujian Academy of Agricultural Science
<120>It is a kind of detection tomato early blight bacterium loop-mediated isothermal amplification (LAMP) primer and application
<130> 4
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<400> 1
tctcttggtt ctggcatcga 20
<210> 2
<211> 18
<212> DNA
<213>Artificial sequence
<400> 2
ttaaggcgag tctcccgc 18
<210> 3
<211> 42
<212> DNA
<213>Artificial sequence
<400> 3
ggcgcaatgt gcgttcaaag atgaacgcag cgaaatgcga ta 42
<210> 4
<211> 41
<212> DNA
<213>Artificial sequence
<400> 4
tggtattcca aagggcatgc ctcccaacac caagcaaagc t 41
Claims (4)
1. it is a kind of detection tomato early blight bacterium loop-mediated isothermal amplification (LAMP) primer, which is characterized in that the primer by F3, B3,
4 specific primer compositions of FIP and BIP, nucleotide sequence are respectively：F3:5’- TCTCTTGGTTCTGGCATCGA -
3 ', B3:5 '-TTAAGGCGAGTCTCCCGC -3 ', FIP: 5’- GGCGCAATGTGCGTTCAAAGAT-
GAACGCAGCGAAATGCGATA -3 ', BIP: 5’- TGGTATTCCAAAGGGCATGCCT-CCCAACACCAAGCAAAGCT
- 3’。
2. using the method for the tomato early blight bacterium ring mediated isothermal amplification detection that primer described in claim 1 is established, feature
It is, includes the following steps：
1）The extraction of DNA profiling in sample to be tested：With DNA in CTAB methods or DNA extraction kit extraction sample to be tested；
2）LAMP constant-temperature amplifications：Prepare 25 μ L reaction systems in PCR pipe, including 5 μM of primers Fs 3 and B3 each 1.0 μ L, 40 μM
Primers F IP and BIP each 1.0 μ L, LAMP reaction mixture 12.5 μ L, 8 UBst1.0 μ L of polymerase, 1.0 μ L of DNA profiling,
Complement to 25 μ L with sterilizing ultra-pure water, by prepared PCR pipe in 64 DEG C of water-baths isothermal reaction 60min；
3）SYBR Green I fluorescence colours judge reaction result：1 μ L SYBR Green I fluorescence is added in the reaction product
Color developing agent gently mixing, stands 5min and carries out colour developing observation, and shows green is reacted under ordinary light and is then used containing dish in sample to be tested
Tomato early blight bacterium, reaction, which shows, does not contain tomato early blight bacterium in orange then sample to be tested, if observing under ultraviolet light muddy
Turbid shape precipitation then contains tomato early blight bacterium in sample, and clear does not then contain tomato early blight bacterium in sample.
3. the method for tomato early blight bacterium ring mediated isothermal amplification detection according to claim 2, which is characterized in that
LAMP reaction mixtures are by as follows at being grouped as：40 mM Tris-HCl, 20 mM (NH4)2SO4, 20 mM KCl, 16 mM
MgSO4, 1.6 mol/L glycine betaines, 2.0 mM dNTPs, 0.2wt.% Trion X-100.
4. application of the primer as described in claim 1 in the detection of tomato early blight bacterium ring mediated isothermal amplification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711013849.2A CN108330178A (en) | 2017-10-26 | 2017-10-26 | It is a kind of detection tomato early blight bacterium loop-mediated isothermal amplification (LAMP) primer and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711013849.2A CN108330178A (en) | 2017-10-26 | 2017-10-26 | It is a kind of detection tomato early blight bacterium loop-mediated isothermal amplification (LAMP) primer and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108330178A true CN108330178A (en) | 2018-07-27 |
Family
ID=62923016
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711013849.2A Pending CN108330178A (en) | 2017-10-26 | 2017-10-26 | It is a kind of detection tomato early blight bacterium loop-mediated isothermal amplification (LAMP) primer and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108330178A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111197105A (en) * | 2020-03-18 | 2020-05-26 | 福建省农业科学院植物保护研究所 | Application of LAMP primer in detection of alternaria alternata |
| CN112666088A (en) * | 2021-01-21 | 2021-04-16 | 上海菁一科技有限公司 | Spectrophotometry test method sample treatment test capsule |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999029899A1 (en) * | 1997-12-08 | 1999-06-17 | E. & J. Gallo Winery | Detection of fungal pathogens |
| CN105112413A (en) * | 2015-09-16 | 2015-12-02 | 福建省农业科学院植物保护研究所 | Alternaria solani PCR detection specific primer and detection method thereof |
| CN106434989A (en) * | 2016-11-30 | 2017-02-22 | 福建省农业科学院植物保护研究所 | LAMP (Loop-Mediated Isothermal Amplification) quick detection method of alternaria alternata |
| CN106636378A (en) * | 2016-12-06 | 2017-05-10 | 福建省农业科学院植物保护研究所 | LAMP (Loop-mediated Isothermal Amplification) primer combination for detecting tomato phytophthora infestans and application |
-
2017
- 2017-10-26 CN CN201711013849.2A patent/CN108330178A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999029899A1 (en) * | 1997-12-08 | 1999-06-17 | E. & J. Gallo Winery | Detection of fungal pathogens |
| CN105112413A (en) * | 2015-09-16 | 2015-12-02 | 福建省农业科学院植物保护研究所 | Alternaria solani PCR detection specific primer and detection method thereof |
| CN106434989A (en) * | 2016-11-30 | 2017-02-22 | 福建省农业科学院植物保护研究所 | LAMP (Loop-Mediated Isothermal Amplification) quick detection method of alternaria alternata |
| CN106636378A (en) * | 2016-12-06 | 2017-05-10 | 福建省农业科学院植物保护研究所 | LAMP (Loop-mediated Isothermal Amplification) primer combination for detecting tomato phytophthora infestans and application |
Non-Patent Citations (5)
| Title |
|---|
| HAMID MOGHIMI等: "Development of a Loop-Mediated Isothermal Amplification Assay for Rapid and Specific Identification of ACT Producing Alternaria alternata, the Agent of Brown Spot Disease in Tangerine", 《APPL BIOCHEM BIOTECHNOL》 * |
| XINYUE ZHANG等: "Development of Loop-Mediated Isothermal Amplification (LAMP) Assay for the Rapid Detection of Alternaria alternata", 《J AOAC INT》 * |
| XINYUE ZHANG等: "Development of Loop-Mediated Isothermal Amplification (LAMP) Assay for the Rapid Detection of Alternaria alternata", 《JOURNAL OF AOAC INTERNATIONAL》 * |
| 柴阿丽等: "加工番茄早疫病病原菌鉴定", 《华北农学报》 * |
| 秦文韬等: "环介导恒温扩增技术在植物病原物检测中的应用", 《中国农业科技导报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111197105A (en) * | 2020-03-18 | 2020-05-26 | 福建省农业科学院植物保护研究所 | Application of LAMP primer in detection of alternaria alternata |
| CN112666088A (en) * | 2021-01-21 | 2021-04-16 | 上海菁一科技有限公司 | Spectrophotometry test method sample treatment test capsule |
| CN112666088B (en) * | 2021-01-21 | 2023-03-28 | 上海菁一科技有限公司 | Spectrophotometry test method sample treatment test capsule |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106434993B (en) | For detecting LAMP primer composition object and its application of cucumber fusarium axysporum | |
| CN106399490B (en) | LAMP primer group for detecting phytoplasma and kit and application thereof | |
| CN106350588A (en) | Device for rapidly detecting benzimidazole fungicide-resistant botrytis cinerea Pers. based on LAMP | |
| CN107760795A (en) | A kind of LAMP primer and detection method of quick detection tea tree anthrax bacteria | |
| CN104789658B (en) | A kind of ring isothermal duplication primer of quick detection citrus Tylenchulus Semipenetrans and its application | |
| CN110117592A (en) | A method of quickly detecting fusarium moniliforme rattan storehouse fusarium based on RPA | |
| CN105238876A (en) | LAMP primer group for ralstonia solanacearum detection and using method thereof | |
| CN106755339B (en) | Cucumber anthracnose LAMP detection primer and its application | |
| CN106434989B (en) | The LAMP rapid detection method of tobacco brown spot pathogen | |
| CN106381340B (en) | Botrytis cinerea LAMP detection primer, detection kit and its application | |
| CN109280715A (en) | LAMP primer group for detecting peanut black rot, and rapid detection method and kit thereof | |
| CN101812541B (en) | Lentinus edodes virus detection kit and method | |
| CN108330178A (en) | It is a kind of detection tomato early blight bacterium loop-mediated isothermal amplification (LAMP) primer and application | |
| CN104962639A (en) | LAMP primer group and detection method for rapidly detecting corynespora cassiicola | |
| CN107881254A (en) | Loop-mediated isothermal amplification method detects the primer and its detection method of ramie mould bacterium | |
| CN104232782A (en) | PCR (polymerase chain reaction) primer for detecting tobacco soil-borne fungal pathogens as well as application and method of PCR primer | |
| CN107828912A (en) | A kind of dosporium cucumerinumand LAMP detection primer and detection method | |
| CN107828905A (en) | Tobacco smoke pollution LAMP detection primer and detection method | |
| CN107723381A (en) | Banana crown rot bacterium LAMP detection primer and its detection method | |
| CN104293957B (en) | A kind of early stage rapid molecular detection method of Botrytis cinerea | |
| CN108018374A (en) | For detecting drug-fast kit of the Botrytis cinerea to benzimidazole germicide | |
| CN106636378A (en) | LAMP (Loop-mediated Isothermal Amplification) primer combination for detecting tomato phytophthora infestans and application | |
| CN110878373A (en) | Recombinase polymerase amplification detection kit for phytophthora infestans and application thereof | |
| CN104328205A (en) | Establishment of rapid detection method for grain sclerospora graminicola by LAMP | |
| CN106434998B (en) | Taro phytophthora ring mediated isothermal amplification detection primer and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180727 |
|
| RJ01 | Rejection of invention patent application after publication |