CN108315477A - A kind of fluorescence quantification PCR primer, probe, kit and the method for detection Coxsackie virus - Google Patents
A kind of fluorescence quantification PCR primer, probe, kit and the method for detection Coxsackie virus Download PDFInfo
- Publication number
- CN108315477A CN108315477A CN201810145257.4A CN201810145257A CN108315477A CN 108315477 A CN108315477 A CN 108315477A CN 201810145257 A CN201810145257 A CN 201810145257A CN 108315477 A CN108315477 A CN 108315477A
- Authority
- CN
- China
- Prior art keywords
- pipes
- pcr
- coxsackie virus
- probe
- added
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to technical field of biological, and in particular to a kind of fluorescence quantification PCR primer, probe, kit and the method for detection Coxsackie virus, the sequence of primer described in the primer are as follows：VP1F：5’‑TTCGGGTGTACATGAGAATTAAG‑3’；VP1R：5’‑CGCCTTCATAATCCGTGGTGGTT‑3’.The sequence of the probe is as follows：VP1P：5’‑TTGGGTACCTAGACCCCTTC‑3’.The kit includes primer described above and probe described above.The kit of the present invention is specifically bound using the probe of fluorescent marker with Virus target sequence to indicate the presence or absence of amplified production, Coxsackie virus can be detected to whether there is, the size of the copy number of virus can also be calculated by the control of gradient standard items, accuracy is good, high sensitivity.
Description
Technical field
The present invention relates to technical field of biological, and in particular to it is a kind of detection Coxsackie virus quantitative fluorescent PCR draw
Object, probe, kit and method.
Background technology
Hand-foot-and-mouth disease (HFMD) is to seriously threaten the important communicable disease of one kind of children's health, causes HFMD's in the past
Main pathogens are its virus A 16-type (CA16) of Ke's Sa and enterovirns type 71 (EV71), in recent years its virus A6 type of Ke's Sa
(CA6) have become Major Epidemic strain.In, in 2011 in 2013 in 2015 hand-foot-and-mouth disease caused by CA6 occurs for Osaka, Japan
It is very popular；The hand-foot-and-mouth disease prevalence principal causative that French 2014-2015 occurs was CA6 originally；CA6 leads to U.S.'s moral gram within 2015
The outbreak of epidemic of hand-foot-and-mouth disease in the military camp of the states Sa Si.In recent years Chinese scholar also strengthens the prison of the non-EV71 enteroviruses of non-CA16
It surveys, it is found that CA6 has become main epidemic strain in national most area, in Dongguan (2015), Chongqing (2011-2015
Year), Shenzhen (2015-2016) even lead to the most important cause of disease of hand-foot-and-mouth disease.At present to brothers caused by most of cause of disease
For stomatosis without effective vaccine and treatment means, research and develop related method of early diagnosis has important meaning to the prevention of hand-foot-and-mouth disease
Justice.Currently used virology laboratory diagnostic method includes the methods of immunological method, virus purification culture, but all there is hardly possible
With early diagnosis, the defects such as susceptibility is low.Fluorescent quantitative PCR technique method is detected virus in the level of nucleic acid, right
Possessed corresponding nucleic can reach the purpose of early detection in human body, for hand-foot-and-mouth disease early diagnosis provide it is accurate, fast
Speed, efficient, sensitive method.
Invention content
In order to overcome shortcoming and defect existing in the prior art, the purpose of the present invention is to provide a kind of detection Coxsack
The fluorescence quantification PCR primer of virus, the primer specificity is good, detects sensitive accurate.
It is another object of the present invention to provide a kind of quantitative fluorescent PCR probe of detection Coxsackie virus, the probes
Specificity is good, detects sensitive accurate.
The present invention's further an object is that provide a kind of PCR kit for fluorescence quantitative of detection Coxsackie virus, the examination
Agent box is specifically bound with Virus target sequence using the probe of fluorescent marker to indicate the presence or absence of amplified production, and Coxsack can be detected
Virus whether there is, and the size of the copy number of virus can also be calculated by the control of gradient standard items, accuracy is good, sensitivity
It is high.
It is yet a further object of the present invention to provide a kind of fluorescence quantifying PCR method of detection Coxsackie virus, this method
Have many advantages, such as that accurate, sensitive, window phase is short, efficient, operates relative ease.
The purpose of the invention is achieved by the following technical solution：It is a kind of detection Coxsackie virus quantitative fluorescent PCR draw
Object, the sequence of the primer are specific as follows as shown in SEQ ID 6 and SEQ ID 7：
SEQ ID 6 Coxsackievirus A6-VP1F：5’-TTCGGGTGTACATGAGAATTAAG-3’
SEQ ID 7 Coxsackievirus A6-VP1R：5’-CGCCTTCATAATCCGTGGTGGTT-3’.
The design procedure of the primer is as follows：Since Coxsackie virus has more variant, and there are more SNP
Site, thus we select different virus strain conserved domain section carry out relevant primer design.As shown in Figure 1, Rhv is Ke
The virus genomic conserved domains of Sa Qi, sequence are comparatively conservative, it is ensured that design of primers is for Coxsackie virus
Specificity.And VP1 protein gene has overlapping region to related conserved sequence, therefore conservative region section can be found from VP1
Design primer.It is downloaded from NCBI or Coxsackievirus A6 isolate 2017-CA6-538 VP1 is obtained by sequencing,
Coxsackievirus A6 isolate 2017-CA6-603 VP1, Coxsackievirus A6 isolate 2017-
CA6-627 VP1, Coxsackievirus A6 isolate 2017-CA6-638 VP1, Coxsackievirus A6
The coded sequence of isolate 2017-CA6-703VP1, respectively as shown in SEQ ID 1-5.By to five sequences described above
Sequence analysis is carried out, the design that the consistent sequence section of homologous sequence on conserved domain carries out primer is selected.By preferred,
Obtain above-mentioned primer Coxsackievirus A6-VP1F and Coxsackievirus A6-VP1R.
Another object of the present invention is achieved through the following technical solutions：A kind of fluorescent quantitation of detection Coxsackie virus
PCR probes, the sequence of the probe are specific as follows as shown in SEQ ID 8：
SEQ ID 8 Coxsackievirus A6-VP1P：5’-TTGGGTACCTAGACCCCTTC-3’.
Preferably, 5 ' ends of the probe are marked with fluorophor, and 3 ' ends are marked with quenching group.
Preferably, the fluorophor be FAM, VIC, CY5 or JOE in one kind, the quenching group be BHQ or
One kind in ECLIPSE.
The design procedure of the probe is as follows：According to selected sequence, in the sequence between section design probe sequence, due to
The present invention is to embody result according to fluorescence signal, it is therefore desirable to probe is marked, mark fluorescent group is held in 5 ' in probe,
3 ' label quenching groups.By preferred, above-mentioned probe Coxsackievirus A6-VP1P are obtained.
The also purpose of the present invention is achieved through the following technical solutions：A kind of fluorescent quantitation of detection Coxsackie virus
PCR kit, the kit include primer described above and probe described above.
The operation principle of the kit of the present invention：The quantitative fluorescent PCR reagent of detection Coxsackie virus provided by the invention
In box, there is the specificity fluorescent probe that fluorophor is marked, when probe is complete, two groups distance on space structure is mutual
Close, the fluorescence that 5 ' end reporter groups generate is quenched because of fluorescence resonance energy transfer (FRET) by 3 ' end non-fluorescence quenching groups
It goes out, therefore there is no the variation of fluorescence signal in system and background is low.During PCR anneals and extends, probe and template specificity
In conjunction with the extension of primer, Taq archaeal dna polymerases carry out cutting release to 3 ' ends are exo-acting using its 5 ' end to probe
Go out reporter group, destroys the fluorescence resonance energy transfer (FRET) between two groups, the fluorescence that reporter group is discharged in this way
The fluorimeter detection that can be built in instrument, the increase of fluorescence volume and the accumulation of PCR product are in proportionate relationship.
To Coxsackie virus quantitatively can comparing obtains by the cycle thresholding (Ct, Threshold Cycle) with standard items.Ct values
It is during PCR, the accumulation of fluorescence volume is more than the cycle number of substrate fluorescence volume, and Ct values are with initial profiling number in certain proportion pass
System, Ct values are smaller, and initial profiling number is more, on the contrary, Ct values are bigger, initial profiling number is fewer.Utilize positive gradient standard form
Ct values standard curve is made, the starting copy number of the sample can be accurately measured further according to the Ct values of sample to be tested.
In the PCR kit for fluorescence quantitative of detection Coxsackie virus provided by the invention, detected for Coxsackie virus
In particularity, carry out the optimization of reaction system to different target segment, and by quantitative fluorescent PCR technology and quantitative detection system
System is combined, and is used it for Coxsackie virus and is quantitatively detected.By prioritization scheme, repetition test develops detection Coxsack disease
The sensitivity of malicious PCR kit for fluorescence quantitative, the kit can detect 10 in each reaction system1A copy can meet
The quickly requirement of detection Coxsackie virus.
Another object of the present invention is achieved through the following technical solutions：A kind of above-mentioned institute of use for non-treatment purpose
The fluorescence quantifying PCR method for the kit detection Coxsackie virus stated, includes the following steps：
(1) sample to be tested is taken, viral RNA is extracted using paramagnetic particle method；
(2) it measures A260 with ultraviolet specrophotometer to quantify standard items, to a concentration of 108Copy/mL standard positive moulds
10 times of plate progress is serially diluted, and it is respectively 10 to prepare concentration8Copy/mL, 107Copy/mL, 106Copy/mL and 105Copy/
The positive criteria product of mL；By the viral RNA of sample to be tested, negative standards' product of same amount and the positive criteria product be serially diluted point
It is not added in PCR reaction systems and carries out PCR detections with fluorescence quantitative PCR instrument；
(3) by comparing the Ct values of sample to be tested and respective standard product, the starting copy number of sample to be tested is quantified.
Preferably, the step (1) is specially：
A, sample treatment：Sample to be tested is transferred in superclean bench in no enzyme EP pipes, 1mL lysates, and vortex is added
Oscillation is to without apparent particulate matter, the static 4-6min of room temperature.
B, RNA layers are detached：180-220 μ L chloroforms are added into EP pipes, EP pipe lids are covered tightly, with forced oscillation mixed solution to breast
Turbid, the static 4-6min of room temperature；With 10000-14000g centrifugal forces 8-12min at a temperature of 3-5 DEG C；It is taken from centrifuge
Go out EP pipes, internal homogenate is divided into three layers, draws top layer's colourless solution and is transferred in new EP pipes；
C, nucleic acid combines：350-450 μ L isopropanols are added into EP pipes and 15-25 μ L rock uniform magnetic bead and suspend in advance
Liquid, high speed vortex vibrate 4-6min；
D, Magnetic Isolation：EP pipes are placed on magnetic frame to stand 15-25s complete to magnetic bead absorption, if having magnetic in EP pipes
Pearl raffinate, can keep EP pipes on magnetic frame, and integrally turning upside down 2-3 times keeps magnetic bead absorption complete, then removes supernatant.
E, primary cleaning：600 μ L cleaning solution A are added into EP pipes, dispel magnetic bead with liquid-transfering gun, vortex vibrates 1.5-
2.5min carries out Magnetic Isolation with reference to step D；
F, secondary cleaning：Using 600 μ L cleaning solution B, twice with reference to step E operations；
G, it elutes：The EP pipes for abandoning most supernatant are held on magnetic frame, EP pipe room temperatures is opened and dries 6-10min to nothing
Apparent ethanol flavor；30-100 μ L eluents are added into EP pipes, vortex is vibrated to magnetic bead and is all scattered in liquid phase, 56-60 DEG C
Warm bath 4-6min；After elution, eluent is transferred in another clean EP pipes with liquid-transfering gun, the RNA extracted is reacted
It is for use that liquid is placed in ultra low temperature freezer.
More preferably, the step (1) is specially：
A, sample treatment：Sample to be tested is transferred in superclean bench in no enzyme EP pipes, 1mL lysates, and vortex is added
Oscillation is to without apparent particulate matter, the static 5min of room temperature.
B, RNA layers are detached：200 μ L chloroforms are added into EP pipes, cover tightly EP pipe lids, with forced oscillation mixed solution to milkiness
Liquid, the static 5min of room temperature；With 12000g centrifugal forces 10min at a temperature of 4 DEG C；EP pipes are taken out from centrifuge, it is internal even
Slurries are divided into three layers, draw top layer's colourless solution and are transferred in new EP pipes；
C, nucleic acid combines：400 μ L isopropanols are added into EP pipes and 20 μ L rock uniform bead suspension in advance, high speed
Vortex vibrates 5min；
D, Magnetic Isolation：EP pipes are placed on magnetic frame to stand 20s complete to magnetic bead absorption, if there is magnetic bead residual in EP pipes
Liquid, can keep EP pipes on magnetic frame, and integrally turning upside down 2-3 times keeps magnetic bead absorption complete, then removes supernatant.
E, primary cleaning：600 μ L cleaning solution A are added into EP pipes, dispel magnetic bead with liquid-transfering gun, vortex vibrates 1.5-
2.5min carries out Magnetic Isolation with reference to step D；
F, secondary cleaning：Using 600 μ L cleaning solution B, twice with reference to step E operations；
G, it elutes：The EP pipes for abandoning most supernatant are held on magnetic frame, EP pipe room temperatures is opened and dries 8min to without apparent
Ethanol flavor；30-100 μ L eluents are added into EP pipes, vortex is vibrated to magnetic bead and is all scattered in liquid phase, 58 DEG C of warm bath
5min；After elution, eluent is transferred in another clean EP pipes with liquid-transfering gun, the RNA reaction solutions extracted are placed in
Ultra low temperature freezer is for use.
Preferably, in the step (2), PCR reaction systems are calculated as with 27.0 μ L：10 × PCR buffer solutions： 2.5μL、
25mM MgCl2：2.0μL、2.5mM dNTP：2.0μL、10μM VP1F：2.0μL、10μM VP1R：2.0μL、10μM VP1P：
2.0 μ L, 5U/ μ L Taq enzymes：0.5 μ L, 2.0 μ L of template ribonucleic acid, 1 μ L of PCR reinforcing agents, 11 μ L of pure water.
Preferably, in the step (2), the reaction condition of PCR detections is：95 DEG C of pre-degeneration 5min, 60 DEG C of reverse transcriptions
15min, cyclic process are expanded using three-step approach：95 DEG C of denaturation 1min, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, 36 cycles, 72
DEG C thoroughly extend 5min.
The beneficial effects of the present invention are：The primer specificity of the present invention is good, detects sensitive accurate.
The probe specificity of the present invention is good, detects sensitive accurate.
The kit of the present invention is specifically bound with Virus target sequence using the probe of fluorescent marker to indicate amplified production
The presence or absence of, Coxsackie virus can be detected and whether there is, the copy number of virus can also be calculated by the control of gradient standard items
Size, accuracy is good, high sensitivity.
The method of the present invention has many advantages, such as that accurate, sensitive, window phase is short, efficient, operates relative ease.
Description of the drawings
Fig. 1 is amplification curve diagram (the moon of the sample to be tested of the present invention, negative standards' product and the positive criteria product being serially diluted
Property sample does not embody curve).
Specific implementation mode
For the ease of the understanding of those skilled in the art, the present invention is made with reference to embodiment and attached drawing 1 further
Illustrate, the content that embodiment refers to is merely to illustrate the present invention rather than limitation the scope of protection of present invention.
Specific experiment condition and method are not specified in the following example, usually according to normal condition such as：J. Pehanorm Brooker
Deng chief editor, Science Press, 1992, Molecular Cloning:A Laboratory guide (second edition)：D.L. Spector etc., Science Press,
2001, cell experiment guide：Lv Hongsheng, Science Press, 1982, or according to the normal condition proposed by manufacturer.
A kind of fluorescence quantification PCR primer of detection Coxsackie virus, the sequence of the primer are as follows：
Coxsackievirus A6-VP1F：5’-TTCGGGTGTACATGAGAATTAAG-3’
Coxsackievirus A6-VP1R：5’-CGCCTTCATAATCCGTGGTGGTT-3’.
A kind of quantitative fluorescent PCR probe of detection Coxsackie virus, the sequence of the probe are as follows：
Coxsackievirus A6-VP1P：5’-TTGGGTACCTAGACCCCTTC-3’.
5 ' ends of the probe are marked with fluorophor, and 3 ' ends are marked with quenching group.
The fluorophor is one kind in FAM, VIC, CY5 or JOE, and the quenching group is in BHQ or ECLIPSE
One kind.
A kind of PCR kit for fluorescence quantitative of detection Coxsackie virus, the kit include primer described above and upper
State the probe.
A kind of quantitative fluorescent PCR side that Coxsackie virus is detected using kit described above for non-treatment purpose
Method includes the following steps：
(1) sample to be tested is taken, viral RNA is extracted using paramagnetic particle method；
(2) it measures A260 with ultraviolet specrophotometer to quantify standard items, to a concentration of 108Copy/mL standard positive moulds
10 times of plate progress is serially diluted, and it is respectively 10 to prepare concentration8Copy/mL, 107Copy/mL, 106Copy/mL and 105Copy/
The positive criteria product of mL；By the viral RNA of sample to be tested, negative standards' product of same amount and the positive criteria product be serially diluted point
It is not added in PCR reaction systems and carries out PCR detections with fluorescence quantitative PCR instrument；
(3) by comparing the Ct values of sample to be tested and respective standard product, the starting copy number of sample to be tested is quantified.
The step (1) is specially：
A, sample treatment：Sample to be tested is transferred in superclean bench in no enzyme EP pipes, 1mL lysates, and vortex is added
Oscillation is to without apparent particulate matter, the static 5min of room temperature.
B, RNA layers are detached：200 μ L chloroforms are added into EP pipes, cover tightly EP pipe lids, with forced oscillation mixed solution to milkiness
Liquid, the static 5min of room temperature；With 12000g centrifugal forces 10min at a temperature of 4 DEG C；EP pipes are taken out from centrifuge, it is internal even
Slurries are divided into three layers, draw top layer's colourless solution and are transferred in new EP pipes；
C, nucleic acid combines：400 μ L isopropanols are added into EP pipes and 20 μ L rock uniform bead suspension in advance, high speed
Vortex vibrates 5min；
D, Magnetic Isolation：EP pipes are placed on magnetic frame to stand 20s complete to magnetic bead absorption, if there is magnetic bead residual in EP pipes
Liquid, can keep EP pipes on magnetic frame, and integrally turning upside down 2-3 times keeps magnetic bead absorption complete, then removes supernatant.
E, primary cleaning：600 μ L cleaning solution A are added into EP pipes, dispel magnetic bead with liquid-transfering gun, vortex vibrates 1.5-
2.5min carries out Magnetic Isolation with reference to step D；
F, secondary cleaning：Using 600 μ L cleaning solution B, twice with reference to step E operations；
G, it elutes：The EP pipes for abandoning most supernatant are held on magnetic frame, EP pipe room temperatures is opened and dries 8min to without apparent
Ethanol flavor；30-100 μ L eluents are added into EP pipes, vortex is vibrated to magnetic bead and is all scattered in liquid phase, 58 DEG C of warm bath
5min；After elution, eluent is transferred in another clean EP pipes with liquid-transfering gun, the RNA reaction solutions extracted are placed in
Ultra low temperature freezer is for use.
In the step (2), PCR reaction systems are calculated as with 27.0 μ L：10 × PCR buffer solutions：2.5μL、 25mM
MgCl2：2.0μL、2.5mM dNTP：2.0μL、10μM VP1F：2.0μL、10μM VP1R： 2.0μL、10μM VP1P：2.0μ
L, 5U/ μ L Taq enzymes：0.5 μ L, 2.0 μ L of template ribonucleic acid, 1 μ L of PCR reinforcing agents, 11 μ L of pure water.
In the step (2), the reaction condition of PCR detections is：95 DEG C of pre-degeneration 5min, 60 DEG C of reverse transcription 15min are followed
Ring process is expanded using three-step approach：95 DEG C of denaturation 1min, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, 36 cycles, 72 DEG C thoroughly
Extend 5min.
After reaction, instrument automatically save as a result, also can manually recorded result CT values and as a result, and by standard song
The generation parametric equation of line calculates correlated virus copy number size.See the amplification curve of Fig. 1 positive criteria products and sample to be tested,
Smooth S types are presented, display amplification efficiency is preferable.
The kit of the present invention is specifically bound with Virus target sequence using the probe of fluorescent marker to indicate amplified production
The presence or absence of, Coxsackie virus can be detected and whether there is, the copy number of virus can also be calculated by the control of gradient standard items
Size, accuracy is good, high sensitivity.
Above-described embodiment is the preferable implementation of the present invention, and in addition to this, the present invention can be realized with other manner,
Any obvious replacement is not departed under the premise of present inventive concept within protection scope of the present invention.
<110>The 8th the People's Hospital of Dongguan City；Dongguan City institute of pediatrics
<120>A kind of fluorescence quantification PCR primer, probe, kit and the method for detection Coxsackie virus
<160> 8
<210> 1
<211> 915
<212> RNA
<213>Artificial sequence
<400> 1
aatgacccca ttacaaatgc agtggaaagc gctgtgagcg cgcttgctga caccacaata 60
tcccgggtga ccgcagccaa cactgcagct agcacccact ccctgggaac agggcgtgta 120
ccagcattgc aagccgcaga aacgggagca agctctaatg ccagtgatga gaaccttatt 180
gagacccgct gtgtgatgaa tcgaaacggg gttaatgagg cgagtgtgga acacttttac 240
tctcgtgcag ggctggtagg agttgtggag gtaaaggact cgggcactag cctggatggg 300
tacacagttt ggcccataga tgtgatgggc ttcgtgcaac agcggcgcaa gctagagtta 360
tcaacataca tgcgctttga tgccgagttc acttttgtgt ccaacctcaa tgacagcacg 420
acacccggga tgctgctgca gtacatgtat gtgccaccag gggcccctaa gccagatagc 480
aggaaatcat atcaatggca gactgctact aacccgtcga tattcgcaaa attgagtgat 540
ccaccccccc aggtatctgt cccgttcatg tcgccagcaa cggcttatca gtggttttat 600
gatggatacc ctacatttgg tgaacacaaa caagccacca atttgcaata tgggcaatgt 660
cctaataaca tgatgggcca ttttgctatc cgaacagtca gtgaatctac caccgggaaa 720
aacgtccaca ttcgggtgta catgagaatt aagcacgtga gagcttgggt acctagaccc 780
cttcgatccc aagcatatat ggtcaagaac tacccgacat acagccaaac aataactaac 840
actgcagctg accgtgcaag cataaccacc acggattatg aaggcggggt accagcaaac 900
ccacagagga catct 915
<210> 2
<211> 915
<212> RNA
<213>Artificial sequence
<400> 2
aatgatccca ttacaaatgc agtggaaagc gctgtgagcg cgcttgctga caccacaata 60
tcccgggtga ccgcagccaa cactgctgct agcacccact ccctgggaac agggcgtgta 120
ccagcattgc aagccgcaga aacgggagca agctctaatg ccagtgatga gaaccttatt 180
gagacccgct gtgtgatgaa tcgaaacggg gttaatgagg cgagtgtgga acacttttac 240
tctcgtgcag ggctggtagg agttgtggag gtgaaggact cgggcactag cctggatggg 300
tacacagttt ggcccataga tgtgatgggc ttcgtgcaac agcggcgcaa gctagagttg 360
tcaacataca tgcgctttga tgccgagttc acttttgtgt ccaacctcaa tgacagcacg 420
acacccggga tgctgctgca gtatatgtat gtgccaccag gggcccctaa gccagatagc 480
aggaaatcat accaatggca gactgctact aacccgtcga tattcgcaaa attgagtgac 540
ccaccccccc aggtatctgt cccgttcatg tcgccagcaa cggcttatca gtggttctat 600
gatggttacc ctacatttgg tgaacacaaa caagccacca atttgcaata tgggcaatgt 660
cctaataaca tgatgggcca ttttgctatc cgaacagtca gtgaatctac caccgggaaa 720
aacgtccacg ttcgggtgta catgagaatt aagcatgtga gagcttgggt acctagaccc 780
cttcgatccc aagcatatat ggtcaagaac tacccgacat acagccaaac aataactaac 840
actgcagctg atcgtgcaag cataaccacc acggattatg aaggcggggt accagcaaac 900
ccacagagga catct 915
<210> 3
<211> 915
<212> RNA
<213>Artificial sequence
<400> 3
aatgatccca ttacaaacgc agtggaaagc gctgtgagcg cgcttgctga caccacaata 60
tcccgggtga ccgcagccaa cactgcagct agcacccact ccctgggaac agggcgtgta 120
ccagcattgc aagctgcaga aacgggagca agctctaatg ccagtgatga aaaccttatt 180
gagacccgct gtgtgatgaa tcgaaacggg gttaatgagg cgagtgtgga acacttttac 240
tctcgtgcag ggctggtagg agttgtggag gtgaaggact cgggcactag cctggatggg 300
tacacagttt ggcccataga tgtgatgggc ttcgtgcaac agcggcgcaa gctagagttg 360
tcaacataca tgcgctttga tgccgagttc acttttgtgt ccaacctcaa tgacagcacg 420
acacccggga tgctgctgca gtatatgtat gtgccaccag gggcccctaa gccagatagc 480
aggaaatcat accaatggca gactgctact aacccgtcga tattcgcaaa attgagtgat 540
ccaccccccc aggtatctgt cccgttcatg tcgccagcaa cggcctatca gtggttttat 600
gatggttacc ctacatttgg tgaacacaaa caagccacca atttgcaata tgggcaatgt 660
cctaataaca tgatgggcca ttttgctatc cgaacagtca gtgaatctac caccgggaag 720
aacgtccacg ttcgggtgta catgagaatt aagcacgtga gagcttgggt acctagaccc 780
cttcgatccc aagcatatat ggtcaagaac tacccgacat acagccagac aataactaac 840
actgcagctg accgtgcaag cataaccacc acggattatg aaggcggggt accagcaaac 900
ccacagagga catct 915
<210> 4
<211> 915
<212> RNA
<213>Artificial sequence
<400> 4
aatgatccca ttacaaatgc agtggaaagc gctgtgagcg cgcttgctga caccacaata 60
tcccgggtga ccgcagccaa cactgcagct agcacccact ccctgggaac agggcgtgta 120
ccagcattgc aagccgcaga aacgggagca agctctaatg ccagtgatga gaaccttatt 180
gagacccgct gtgtgatgaa tcgaaacggg gttaatgagg cgagtgtgga acacttttac 240
tctcgtgcag ggctggtagg agttgtggag gtgaaggact cgggcactag cctggatggg 300
tacacagttt ggcccataga tgtgatgggc ttcgtgcaac agcggcgcaa gctagagttg 360
tcaacataca tgcgctttga tgccgagttc acttttgtgt ccaacctcaa tgacagcacg 420
acacccggga tgctgctgca gtacatgtat gtgccaccag gggcccctaa gccagatagc 480
aggaaatcat accaatggca gactgctact aacccgtcga tattcgcaaa attgagtgat 540
ccaccccccc aggtatctgt cccgttcatg tcgccagcaa cggcttatca gtggttttat 600
gatggttacc ctacatttgg tgaacacaaa caagccacca atttgcaata tgggcaatgt 660
cctaataaca tgatgggcca ttttgctatc cgaacagtca gtgaatctac caccgggaaa 720
aacgtccacg ttcgggtgta catgagaatt aagcacgtga gagcttgggt acctagaccc 780
cttcgatccc aagcatatat gctcaagaac tacccgacat acagccaaac aataactaac 840
actgcagctg accgtgcaag cataaccacc acggattatg aaggcggggt accagcaaac 900
ccacagagga catct 915
<210> 5
<211> 915
<212> RNA
<213>Artificial sequence
<400> 5
aatgaaccca ttacaaatgc agtggaaagc gctgtgagcg cgcttgctga caccacaata 60
tcccgggtga ccgcagccaa cactgcagct agcacccact ccctgggaac agggcgtgta 120
ccagcattgc aagccgcgga aacgggagca agctctaatg ccagtgatga gaaccttatt 180
gagacccgct gcgtgatgaa tcgaaacggg gttaatgagg cgagtgtgga acacttttac 240
tctcgtgcag ggttggtagg agttgtggag gtgaaggact cgggcactag cctggatggg 300
tacacagttt ggcccataga tgtgatgggc ttcgtgcaac agcggcgcaa gctagagttg 360
tcaacataca tgcgctttga tgccgagttc acttttgtgt ccaacctcaa tgacagcacg 420
acacccggga tgctgctgca gtacatgtat gtgccaccag gggcccctaa gccagatagc 480
aggaaatcat accaatggca gactgctact aacccgtcga tatttgcaaa actgagtgat 540
ccaccccccc aggtatctgt cccgttcatg tcgccagcaa cggcttatca gtggttttat 600
gatggatacc ctacatttgg tgaacacaaa caagccacca atttgcaata tgggcaatgt 660
cctaataaca tgatgggcca ttttgctatc cgaacagtca gtgaatctac caccgggaaa 720
aacgtccacg ttcgggtgta catgagaatt aagcacgtga gagcttgggt acctagaccc 780
cttcgatccc aagcatatat ggtcaagaac tatccgacat acagccaaac aataactaac 840
actgcagctg accgtgcaag cataaccacc acggattatg aaggcggggt accagcaaac 900
ccacagagga catct 915
<210> 6
<211> 23
<212> RNA
<213>Artificial sequence
<400> 6
ttcgggtgta catgagaatt aag 23
<210> 7
<211> 23
<212> RNA
<213>Artificial sequence
<400> 7
cgccttcata atccgtggtg gtt 23
<210> 8
<211> 20
<212> RNA
<213>Artificial sequence
<400> 8
ttgggtacct agaccccttc 20
Claims (10)
1. a kind of fluorescence quantification PCR primer of detection Coxsackie virus, it is characterised in that：The sequence of the primer is as follows：
Coxsackievirus A6-VP1F：5’-TTCGGGTGTACATGAGAATTAAG-3’
Coxsackievirus A6-VP1R：5’-CGCCTTCATAATCCGTGGTGGTT-3’.
2. a kind of quantitative fluorescent PCR probe of detection Coxsackie virus, it is characterised in that：The sequence of the probe is as follows：
Coxsackievirus A6-VP1P：5’-TTGGGTACCTAGACCCCTTC-3’.
3. a kind of quantitative fluorescent PCR probe of detection Coxsackie virus according to claim 2, it is characterised in that：It is described
5 ' ends of probe are marked with fluorophor, and 3 ' ends are marked with quenching group.
4. a kind of quantitative fluorescent PCR probe of detection Coxsackie virus according to claim 3, it is characterised in that：It is described
Fluorophor is one kind in FAM, VIC, CY5 or JOE, and the quenching group is one kind in BHQ or ECLIPSE.
5. a kind of PCR kit for fluorescence quantitative of detection Coxsackie virus, it is characterised in that：The kit includes claim 1
The primer and claim 2-4 any one of them probes.
6. a kind of fluorescent quantitation for detecting Coxsackie virus using the kit described in claim 5 for non-treatment purpose
PCR method, it is characterised in that：Include the following steps：
(1) sample to be tested is taken, viral RNA is extracted using paramagnetic particle method；
(2) it measures A260 with ultraviolet specrophotometer to quantify standard items, to a concentration of 108Copy/mL standard positive templates carry out
10 times are serially diluted, and it is respectively 10 to prepare concentration8Copy/mL, 107Copy/mL, 106Copy/mL and 105The sun of copy/mL
Property standard items；The viral RNA of sample to be tested, negative standards' product of same amount and the positive criteria product be serially diluted are separately added into
To in PCR reaction systems PCR detections are carried out with fluorescence quantitative PCR instrument；
(3) by comparing the Ct values of sample to be tested and respective standard product, the starting copy number of sample to be tested is quantified.
7. a kind of fluorescence quantifying PCR method of detection Coxsackie virus for non-treatment purpose according to claim 6,
It is characterized in that：The step (1) is specially：
A, sample treatment：Sample to be tested is transferred in superclean bench in no enzyme EP pipes, 1mL lysates are added, and vortex vibrates
To without apparent particulate matter, the static 4-6min of room temperature.
B, RNA layers are detached：180-220 μ L chloroforms are added into EP pipes, EP pipe lids are covered tightly, with forced oscillation mixed solution to milkiness
Liquid, the static 4-6min of room temperature；With 10000-14000g centrifugal forces 8-12min at a temperature of 3-5 DEG C；It is taken out from centrifuge
EP is managed, and internal homogenate is divided into three layers, is drawn top layer's colourless solution and is transferred in new EP pipes；
C, nucleic acid combines：350-450 μ L isopropanols are added into EP pipes and 15-25 μ L rock uniform bead suspension in advance,
High speed vortex vibrates 4-6min；
D, Magnetic Isolation：EP pipes are placed on magnetic frame to stand 15-25s complete to magnetic bead absorption, if there is magnetic bead residual in EP pipes
Liquid, can keep EP pipes on magnetic frame, and integrally turning upside down 2-3 times keeps magnetic bead absorption complete, then removes supernatant.
E, primary cleaning：600 μ L cleaning solution A are added into EP pipes, magnetic bead is dispelled with liquid-transfering gun, vortex vibrates 1.5-2.5min,
Magnetic Isolation is carried out with reference to step D；
F, secondary cleaning：Using 600 μ L cleaning solution B, twice with reference to step E operations；
G, it elutes：The EP pipes for abandoning most supernatant are held on magnetic frame, EP pipe room temperatures is opened and dries 6-10min to without apparent second
Alcohol taste；30-100 μ L eluents are added into EP pipes, vortex is vibrated to magnetic bead and is all scattered in liquid phase, 56-60 DEG C of warm bath 4-
6min；After elution, eluent is transferred in another clean EP pipes with liquid-transfering gun, the RNA reaction solutions extracted are placed in
Ultra low temperature freezer is for use.
8. a kind of fluorescence quantifying PCR method of detection Coxsackie virus for non-treatment purpose according to claim 6,
It is characterized in that：The step (1) is specially：
A, sample treatment：Sample to be tested is transferred in superclean bench in no enzyme EP pipes, 1mL lysates are added, and vortex vibrates
To without apparent particulate matter, the static 5min of room temperature.
B, RNA layers are detached：200 μ L chloroforms are added into EP pipes, cover tightly EP pipe lids, with forced oscillation mixed solution to emulsion, room
The static 5min of temperature；With 12000g centrifugal forces 10min at a temperature of 4 DEG C；EP pipes, internal homogenate point are taken out from centrifuge
It is three layers, draws top layer's colourless solution and be transferred in new EP pipes；
C, nucleic acid combines：400 μ L isopropanols are added into EP pipes and 20 μ L rock uniform bead suspension, high speed vortex in advance
Vibrate 5min；
D, Magnetic Isolation：EP pipes are placed on magnetic frame to stand 20s complete to magnetic bead absorption, if there is magnetic bead raffinate in EP pipes,
It can keep EP pipes on magnetic frame, integrally turning upside down 2-3 times keeps magnetic bead absorption complete, then removes supernatant.
E, primary cleaning：600 μ L cleaning solution A are added into EP pipes, magnetic bead is dispelled with liquid-transfering gun, vortex vibrates 1.5-2.5min,
Magnetic Isolation is carried out with reference to step D；
F, secondary cleaning：Using 600 μ L cleaning solution B, twice with reference to step E operations；
G, it elutes：The EP pipes for abandoning most supernatant are held on magnetic frame, EP pipe room temperatures is opened and dries 8min to without apparent ethyl alcohol
Taste；30-100 μ L eluents are added into EP pipes, vortex is vibrated to magnetic bead and is all scattered in liquid phase, 58 DEG C of warm bath 5min；It washes
After de-, eluent is transferred in another clean EP pipes with liquid-transfering gun, the RNA reaction solutions extracted are placed in ultralow temperature ice
Case is for use.
9. a kind of fluorescence quantifying PCR method of detection Coxsackie virus for non-treatment purpose according to claim 6,
It is characterized in that：In the step (2), PCR reaction systems are calculated as with 27.0 μ L：10 × PCR buffer solutions：2.5μL、25mM
MgCl2：2.0μL、2.5mM dNTP：2.0μL、10μM VP1F：2.0μL、10μM VP1R：2.0μL、10μM VP1P：2.0μL、
5U/ μ L Taq enzymes：0.5 μ L, 2.0 μ L of template ribonucleic acid, 1 μ L of PCR reinforcing agents, 11 μ L of pure water.
It is examined 10. a kind of quantitative fluorescent PCR of detection Coxsackie virus for non-treatment purpose according to claim 6 is non-
Disconnected method, it is characterised in that：In the step (2), the reaction condition of PCR detections is：95 DEG C of pre-degeneration 5min, 60 DEG C of reverse transcriptions
15min, cyclic process are expanded using three-step approach：95 DEG C of denaturation 1min, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, 36 cycles, 72
DEG C thoroughly extend 5min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810145257.4A CN108315477A (en) | 2018-02-12 | 2018-02-12 | A kind of fluorescence quantification PCR primer, probe, kit and the method for detection Coxsackie virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810145257.4A CN108315477A (en) | 2018-02-12 | 2018-02-12 | A kind of fluorescence quantification PCR primer, probe, kit and the method for detection Coxsackie virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108315477A true CN108315477A (en) | 2018-07-24 |
Family
ID=62904058
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810145257.4A Pending CN108315477A (en) | 2018-02-12 | 2018-02-12 | A kind of fluorescence quantification PCR primer, probe, kit and the method for detection Coxsackie virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108315477A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109487006A (en) * | 2018-12-11 | 2019-03-19 | 东莞市第八人民医院 | A kind of CVA2 specific primer, real-time fluorescence detection kit and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103525950A (en) * | 2013-10-23 | 2014-01-22 | 东南大学 | RT-PCR (reverse transcription-polymerase chain reaction) primer pair for identifying CVA6 (coxsackie virus A6) and non-CVA6 enterovirus and application of primer pair |
| CN104099427A (en) * | 2013-04-14 | 2014-10-15 | 上海市公共卫生临床中心 | Method for detecting CA6 virus with real-time fluorescent quantitative PCR |
| CN104878126A (en) * | 2015-06-24 | 2015-09-02 | 安阳市疾病预防控制中心 | Test kit for coxsackie virus A6 nucleic acid and test method |
-
2018
- 2018-02-12 CN CN201810145257.4A patent/CN108315477A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104099427A (en) * | 2013-04-14 | 2014-10-15 | 上海市公共卫生临床中心 | Method for detecting CA6 virus with real-time fluorescent quantitative PCR |
| CN103525950A (en) * | 2013-10-23 | 2014-01-22 | 东南大学 | RT-PCR (reverse transcription-polymerase chain reaction) primer pair for identifying CVA6 (coxsackie virus A6) and non-CVA6 enterovirus and application of primer pair |
| CN104878126A (en) * | 2015-06-24 | 2015-09-02 | 安阳市疾病预防控制中心 | Test kit for coxsackie virus A6 nucleic acid and test method |
Non-Patent Citations (6)
| Title |
|---|
| 李洋等: "柯萨奇病毒 A6 TaqMan探针实时荧光逆转录PCR检测方法的建立", 《中国病原生物学杂志》 * |
| 李洋等: "柯萨奇病毒A6逆转录PCR检测方法的建立", 《现代预防医学》 * |
| 杜娟: "《医学细胞与分子生物学理论与技术》", 31 July 2012, 吉林大学出版社 * |
| 王志亮等: "《小反刍兽疫》", 31 December 2015, 中国农业出版社 * |
| 程洁萍等: "柯萨奇A组6型病毒TaqMan探针实时荧光RT-PCR的建立", 《热带医学杂志》 * |
| 胡新文等: "《热带植物基因工程原理与操作技术》", 31 December 2006, 中国林业出版社 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109487006A (en) * | 2018-12-11 | 2019-03-19 | 东莞市第八人民医院 | A kind of CVA2 specific primer, real-time fluorescence detection kit and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Arroyo et al. | Next generation sequencing for human papillomavirus genotyping | |
| CN103866034A (en) | Multiple real-time fluorescence quantification PCR (polymerase chain reaction) detection kit and detection method for helicobacter pylori in gastric juice | |
| JP7374377B2 (en) | Test kit for Salmonella typhi, its manufacturing method, and its uses | |
| Zoll et al. | Direct multiplexed whole genome sequencing of respiratory tract samples reveals full viral genomic information | |
| CN111286559B (en) | Primer, probe and kit for detecting African swine fever virus | |
| CN107574261B (en) | Detection primer, detection kit and detection method for detecting hantavirus | |
| ITVT20110002A1 (en) | METHOD OF DETERMINING THE ORIGIN OF FLUIDS OR BIOLOGICAL TRACKS AND REAGENT KITS FOR THEIR IDENTIFICATION IN A SAMPLE. | |
| CN115851926A (en) | Real-time fluorescent nucleic acid isothermal amplification detection kit for prostate cancer and special primer and probe thereof | |
| Xu et al. | A one-tube rapid visual CRISPR assay for the field detection of Japanese encephalitis virus | |
| CN103276099B (en) | Primer and kit for fluorescent quatititive PCR (polymerase chain reaction) detection of helicobacter pylori | |
| CN105779644A (en) | Realtime fluorescent nucleic acid constant temperature amplification detection kit of human cytomegalovirus (HCMV) | |
| CN108531661A (en) | A kind of fluorescence quantification PCR primer, probe, kit and the method for detection CVB3 | |
| WO2015180484A1 (en) | Nucleotides specific to providencia o31, o41, o42, o43 and o50 and uses thereof | |
| CN104342487B (en) | Mycoplasma nucleic acid constant-temperature amplification method | |
| CN108315477A (en) | A kind of fluorescence quantification PCR primer, probe, kit and the method for detection Coxsackie virus | |
| CN113046477A (en) | Specific crRNA for identifying D614G mutation site, system, kit and application | |
| Shen et al. | A Novel, Cleaved Probe-Based Reverse Transcription Loop-Mediated Isothermal Amplification Method for Specific and Sensitive Detection of Porcine Deltacoronavirus | |
| CN109680101B (en) | Rapid detection method for distinguishing strong and weak viruses of H7N9 subtype avian influenza virus | |
| CN111676316A (en) | Primer, probe and detection method for rapidly distinguishing African swine fever virus gene type II from other genotypes | |
| CN106916903A (en) | The real-time fluorescence RT PCR detection methods and kit of mycobacterium tuberculosis 85B mRNA | |
| CN106868217A (en) | A kind of detection primer of zika virus and application | |
| CN105018486A (en) | HDA kit for detecting bacterial leaf streak pathogens of rice and detecting method | |
| CN115896316A (en) | Tuberculosis detection method | |
| CN107937615A (en) | For distinguishing the primer and probe of Latex agglutination test street strain and vaccine strain | |
| CN105256041B (en) | The nucleotide special to aeromonas hydrophila O44, O24, O25 and O28 and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180724 |