CN108315448A - The primer and its detection method of detection Prospect on Kiwifruit Bacterial Canker opportunistic pathogen and application - Google Patents
The primer and its detection method of detection Prospect on Kiwifruit Bacterial Canker opportunistic pathogen and application Download PDFInfo
- Publication number
- CN108315448A CN108315448A CN201810138685.4A CN201810138685A CN108315448A CN 108315448 A CN108315448 A CN 108315448A CN 201810138685 A CN201810138685 A CN 201810138685A CN 108315448 A CN108315448 A CN 108315448A
- Authority
- CN
- China
- Prior art keywords
- primer
- detection
- pcr
- prospect
- added
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of group-specific primers of high sensitivity detection Prospect on Kiwifruit Bacterial Canker opportunistic pathogen Pseudomonas syringae pv.actinidae, and forward primer and reverse primer composition, the forward primer are：5 ＇ AAAACCGCTGTGATACAATTCG, 3 ＇, as shown in SEQ ID NO.1, the reverse primer is：5 ＇ GATAGCCCTGAATGGTTTCCGAA, 3 ＇, as shown in SEQ ID NO.2.The present invention also provides based on the specific primer detection method and application.
Description
Technical field
The invention belongs to agricultural and technical field of plant quarantine, and in particular to for detecting Prospect on Kiwifruit Bacterial Canker opportunistic pathogen
The highly sensitive specific primer and detection method of Pseudomonas syringae pv.actinidae and application.
Background technology
Kiwi berry is referred to as the king of fruit and the hat of vitamin C, has higher economic benefit, domestic main growing area
There are the ground such as Sichuan, Shaanxi and Guizhou.Detection, prevention and control for Kiwi berry disease are to improve its economic value, promote regional macaque
The necessary means of peach industrial economy development.
Canker is a kind of mortality bacterial disease seriously threatening Kiwi berry production, is listed in national forest plants inspection
Epidemic disease object.Pseudomonas syringae is the main pathogenic fungi of Kiwi berry disease, is presently believed that one of the main pathogenic fungi is that Kiwi berry causes
Lesion kind (Pseudomonas syringae pv.Actinidiae, Psa).The pathogen is very high to having by the end of September in mid-June
Production spore ability can seriously affect the growth of fruit when Kiwi berry young fruit infects the bacterium, when infecting June, be easy to happen and adopt
Preceding shedding.The pathogen in the middle part of fruit bottom and fruit for having stronger infection ability.
The identification of cause of disease seedling, tool can be only realized by PCR amplification result using specific primer detection pathogen
Have the advantages that it is simple and efficient, disease early diagnosis and timely prevention and control field in be widely used.Currently, for macaque
The PCR context of detection of peach ulcer bacteria, the prior art have also carried out some beneficial trials, and such as application No. is 201610230023.0
Chinese patent provide a kind of detection method, avoid the false positive issue of conventional PCR method appearance, and when shortening detection
Between.
In actually detected work, other than there are specific requirements to primer, also require primer that there is the sensitivity of height
Property.The specificity of primer can ensure the accuracy to specific detection of pathogens, and sensibility can be easier to the essence of pathogen
Really detection, can detect pathogen, the more conducively diagnosis at disease initial stage at low levels.However, according to the inventors knowledge, in this respect
Research still in blank.
Invention content
In view of the shortcomings of the prior art, one of the objects of the present invention is to provide a kind of high sensitivities to detect Kiwi berry ulcer
A group-specific primers of pathogen Pseudomonas syringae pv.actinidae, a group-specific primers by
Forward primer and reverse primer composition, the forward primer are：5 ＇-AAAACCGCTGTGATACAATTCG-3 ＇, such as SEQ ID
Shown in NO.1, the reverse primer is：5 ＇-GATAGCCCTGAATGGTTTCCGAA-3 ＇, as shown in SEQ ID NO.2；
The detection sensitivity of one group-specific primers is 1pg thallus DNAs.
It is another object of the present invention to provide a kind of Prospect on Kiwifruit Bacterial Canker opportunistic pathogen Pseudomonas syringae
The high-sensitivity detecting method of pv.actinidae, the method includes the steps：
(1) DNA is extracted from Kiwi berry fruit to be detected；
(2) using DNA obtained by step (1) as pcr template DNA, PCR amplification is carried out；
(3) amplified production obtained by agarose gel electrophoresis detecting step (2) is used, target sizes band is such as generated, then proves
Kiwi berry fruit infects canker；
In step (2), when carrying out the PCR amplification, primer used is made of forward primer and reverse primer, it is described just
It is to primer：5 ＇-AAAACCGCTGTGATACAATTCG-3 ＇, as shown in SEQ ID NO.1, the reverse primer is：5 ＇-
GATAGCCCTGAATGGTTTCCGAA-3 ＇, as shown in SEQ ID NO.2.
In actually detected work, in step (3), the position of the band is at 730bp.
Under normal circumstances, in step (1), the optional method for extracting DNA is CTAB methods.
For the present invention, the CTAB methods can be carried out specifically with following step：
1) it takes suitable Kiwi berry fruit to be put into 1.5ml EP pipes, after liquid nitrogen is added, is quickly pulverized with grinding rod
End；
2) the CTAB extracting solutions of 65 DEG C of 550 μ L preheating are added, acutely after oscillation, are put in 1h in 65 DEG C of insulating boxs, therebetween between
It is primary every 10min oscillations mixing
3) 550 μ L chloroform-isoamyl alcohols (24 are added:1v/v), it acutely shakes and mixes well, stand 10min, in
5min is centrifuged under 13000r/min rotating speeds；
4) supernatant is taken, 600 μ L ice ethyl alcohol are added, centrifuges 5min under 13000r/min rotating speeds, outwells supernatant, with 75% second
Alcohol rinses precipitation；Repeat the step at least 1 time；
5) the empty centrifugation 3min under 7500r/min rotating speeds, sucks the extra liquid in bottom with pipettor, is put in room temperature nature
It is dry；
6) after dry, suitable sterilizing ddH is added2O fully dissolves, be then stored in -20 DEG C it is spare.
In general, in step (2), when carrying out the PCR amplification, PCR reaction systems used include 10 × PCR
Buffer, dNTP Mixture, template DNA, Ex Taq, ddH2O and the primer.
As a preferred scheme of the invention, the PCR reaction systems are：Pcr template DNA：1.0 μ L, 2.0mM
dNTP Mixture：2.0μL、10×PCR buffer：The forward primer of 2.0 μ L, 10mM：The reverse primer of 0.5 μ L, 10mM：
The Ex Taq of 0.5 μ L, 5units/ μ L：0.1 μ L, ddH is added2O to PCR reaction system volumes be 20 μ L.
As a preferred scheme of the invention, the program of the PCR amplification is：
1) in the 94 DEG C of pre-degeneration for carrying out template DNA reactions, reaction time 4min；
2) reaction of degeneration (RD) of template DNA, reaction time 30s are carried out in 94 DEG C；
3) it anneals in 60 DEG C, time 30s；
4) extended at 72 DEG C, time 1min；
5) circulation step 1)~4) 30 times；
6) extend 5min in 72 DEG C；
7) 1.5% agarose gel electrophoresis imaging analysis is carried out to amplified production.
Another object of the present invention is to provide the above method in detection by Pseudomonas syringae
Application on Prospect on Kiwifruit Bacterial Canker caused by pv.actinidae.Specifically, the application include to Kiwi berry seedling quarantine,
Soil surface characters detection, the diagnosis of Prospect on Kiwifruit Bacterial Canker early disease and Pseudomonas syringae pv.actinidae
Detection and identification.
Beneficial effects of the present invention：
In terms of existing technologies, the present invention has the advantages that：
(1) detection of the present invention for Prospect on Kiwifruit Bacterial Canker opportunistic pathogen Pseudomonas syringae pv.actinidae
Flow is simple, easy to implement.
(2) detection of the present invention for Prospect on Kiwifruit Bacterial Canker opportunistic pathogen Pseudomonas syringae pv.actinidae
It is specific, E value can be detected whether accurately down to 0.007 containing Prospect on Kiwifruit Bacterial Canker opportunistic pathogen Pseudomonas
syringae pv.actinidae。
(3) specific primer of the invention is for Prospect on Kiwifruit Bacterial Canker opportunistic pathogen Pseudomonas syringae
It is 1pg thallus DNAs that pv.actinidae, which has the detection sensitivity of height, detection sensitivity,.
Description of the drawings
Fig. 1 is the embodiment of the present invention to Prospect on Kiwifruit Bacterial Canker opportunistic pathogen Pseudomonas syringae pv.actinidae
And the DNA cloning result figure of other bacterium；
Fig. 2 is the experimental result of sensitivity technique of the present invention, wherein the additive amount of the thallus DNA in swimming lane P1 and 2~9
Respectively 500ng, 200ng, 100ng, 10ng, 1ng, 100pg, 10pg, 1pg, 0.1pg.
Specific implementation mode
The present invention is specifically described below by embodiment, it is necessary to which indicated herein is that following embodiment is only used
It is further detailed in the present invention, should not be understood as limiting the scope of the invention, which is skilled in technique
Personnel still fall within protection scope of the present invention according to some nonessential modifications and adaptations that foregoing invention content is made.
Embodiment 1
(1) DNA is extracted from Kiwi berry fruit；Specific method is：
1) it takes suitable Kiwi berry fruit to be put into 1.5ml EP pipes, after liquid nitrogen is added, is quickly pulverized with grinding rod
End；
2) the CTAB extracting solutions of 65 DEG C of 550 μ L preheating are added, acutely after oscillation, are put in 1h in 65 DEG C of insulating boxs, therebetween between
It is primary every 10min oscillations mixing
3) 550 μ L chloroform-isoamyl alcohols (24 are added:1v/v), it acutely shakes and mixes well, stand 10min, in
5min is centrifuged under 13000r/min rotating speeds；
4) supernatant is taken, 600 μ L ice ethyl alcohol are added, centrifuges 5min under 13000r/min rotating speeds, outwells supernatant, with 75% second
Alcohol rinses precipitation；Repeat the step at least 1 time；
5) the empty centrifugation 3min under 7500r/min rotating speeds, sucks the extra liquid in bottom with pipettor, is put in room temperature nature
It is dry；
6) after dry, suitable sterilizing ddH is added2O fully dissolves, be then stored in -20 DEG C it is spare.
(2) using DNA obtained by step (1) as pcr template DNA, PCR amplification is carried out；
PCR reaction systems are：Pcr template DNA：The dNTP Mixture of 1.0 μ L, 2.0mM：2.0μL、10×PCR
buffer：The forward primer of 2.0 μ L, 10mM：The reverse primer of 0.5 μ L, 10mM：The Ex Taq of 0.5 μ L, 5units/ μ L：0.1μ
L, ddH is added2O to PCR reaction system volumes be 20 μ L.
The program of PCR amplification is：
1) in the 94 DEG C of pre-degeneration for carrying out template DNA reactions, reaction time 4min；
2) reaction of degeneration (RD) of template DNA, reaction time 30s are carried out in 94 DEG C；
3) it anneals in 60 DEG C, time 30s；
4) extended at 72 DEG C, time 1min；
5) circulation step 1)~4) 30 times；
6) extend 5min in 72 DEG C.
Primer used is made of forward primer and reverse primer, and the forward primer is：5 ＇-
AAAACCGCTGTGATACAATTCG-3 ＇, as shown in SEQ ID NO.1, the reverse primer is：5 ＇-
GATAGCCCTGAATGGTTTCCGAA-3 ＇, as shown in SEQ ID NO.2.
(3) amplified production obtained by agarose gel electrophoresis detecting step (2) is used, target sizes band is such as generated, then proves
Kiwi berry fruit infects canker.
Experimental result is as shown in Figure 1：In figure, P (P1-P5)：Prospect on Kiwifruit Bacterial Canker bacterium Pseudomonas syringae
pv.actinidae；B(B1-B5)：Kiwi berry Bacteria erwinia；H(H1-H5)：Kiwi berry brown patch germ；M(M1-M3)：Rice rice
Seasonal febrile diseases bacterium；F(F1-F3)：Ustilaginoidea virens.It can be obtained from the figure that：Prospect on Kiwifruit Bacterial Canker specific primer specific detection macaque
Peach ulcer bacteria.Wherein, 5 kinds of different Kiwi berry soft-rot fungi bacterial strains that B1-B5 isolates for inventor, number BC, HM1, JM,
HOD, CM3；H1-H5 is 5 kinds of different Kiwi berry Pathogenic Bacteria Causing Brown Blotch Disease bacterial strains isolating of inventor, number HJ, HH, HC,
PH5、63；3 kinds of different Pathogen of Rice Blast Fungus bacterial strains that M1-M3 isolates for inventor, number Guy-11, ZB-13,
ZA-49；F1-F3 is 3 kinds of different rice green smut cause of disease bacteria strains that inventor isolates, number WJ-1, PJ, JY-3.
The DNA of extraction is diluted and the Pseudomonas syringae pv.actinidae bacterium to isolating
Suspension is diluted, and tests the detection sensitivity of the method for the present invention, it is found that the detection sensitivity of the present invention is 1pg thallus DNAs, such as
Shown in Fig. 2, when the thallus DNA additive amount in swimming lane 8 is 1pg, band is still clear and legible.
Note：It is that extraction DNA is laggard from Pseudomonas syringae pv.actinidae in detection sensitivity
Row dilution carries out DNA sensitivity tests, and by Pseudomonas syringae pv.actinidae cultivate so
All DNA progress is extracted after being diluted afterwards to culture again.
SEQUENCE LISTING
<110>Mianyang City academy of agricultural science；Inst of Plant Protection, Sichuan Academy of Agricultural Sciences
<120>The primer and its detection method of detection Prospect on Kiwifruit Bacterial Canker opportunistic pathogen and application
<130> 2018
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 22
<212> DNA
<213>（Primer）
<400> 1
aaaaccgctg tgatacaatt cg 22
<210> 2
<211> 23
<212> DNA
<213>（Primer）
<400> 2
gatagccctg aatggtttcc gaa 23
Claims (10)
1. one group of a kind of high sensitivity detection Prospect on Kiwifruit Bacterial Canker opportunistic pathogen Pseudomonas syringae pv.actinidae
Specific primer a, which is characterized in that group-specific primers are made of forward primer and reverse primer, the forward primer
For：5 ＇-AAAACCGCTGTGATACAATTCG-3 ＇, as shown in SEQ ID NO.1, the reverse primer is：5 ＇-
GATAGCCCTGAATGGTTTCCGAA-3 ＇, as shown in SEQ ID NO.2；The detection sensitivity of one group-specific primers is
1pg thallus DNAs.
2. a kind of high-sensitivity detecting method of Prospect on Kiwifruit Bacterial Canker opportunistic pathogen Pseudomonas syringaepv.actinidae,
It is characterized in that, the method includes the steps：
(1) DNA is extracted from Kiwi berry fruit to be detected；
(2) using DNA obtained by step (1) as pcr template DNA, PCR amplification is carried out；
(3) amplified production obtained by agarose gel electrophoresis detecting step (2) is used, target sizes band is such as generated, then proves macaque
Peach fruit infects canker；
In step (2), when carrying out the PCR amplification, primer used is made of forward primer and reverse primer, and the forward direction is drawn
Object is：5 ＇-AAAACCGCTGTGATACAATTCG-3 ＇, as shown in SEQ ID NO.1, the reverse primer is：5 ＇-
GATAGCCCTGAATGGTTTCCGAA-3 ＇, as shown in SEQ ID NO.2.
3. according to the method described in claim 2, it is characterized in that, in step (1), the method for extracting DNA is CTAB methods.
4. according to the method described in claim 3, it is characterized in that, the step of CTAB methods be：
1) suitable Kiwi berry fruit is taken to be put into 1.5ml EP pipes, after liquid nitrogen is added, with the quick grind into powder of grinding rod；
2) the CTAB extracting solutions of 65 DEG C of 550 μ L preheating are added, acutely after oscillation, are put in 1h in 65 DEG C of insulating boxs, therebetween at interval of
It is primary that 10min vibrates mixing；
3) 550 μ L chloroform-isoamyl alcohols (24 are added:1v/v), it acutely shakes and mixes well, 10min is stood, in 13000r/min
5min is centrifuged under rotating speed；
4) supernatant is taken, 600 μ L ice ethyl alcohol are added, centrifuges 5min under 13000r/min rotating speeds, outwells supernatant, is rushed with 75% ethyl alcohol
Wash precipitation；Repeat the step at least 1 time；
5) the empty centrifugation 3min under 7500r/min rotating speeds, sucks the extra liquid in bottom with pipettor, it is naturally dry to be put in room temperature
It is dry；
6) after dry, suitable sterilizing ddH is added2O fully dissolves, be then stored in -20 DEG C it is spare.
5. used when carrying out the PCR amplification according to the method described in claim 2, it is characterized in that, in step (2)
PCR reaction systems include 10 × PCR buffer, dNTP Mixture, template DNA, Ex Taq, ddH2O and the primer.
6. according to the method described in claim 5, it is characterized in that, the PCR reaction systems are：Pcr template DNA：1.0μL、
The dNTP Mixture of 2.0mM：2.0μL、10×PCR buffer：The forward primer of 2.0 μ L, 10mM：0.5 μ L, 10mM it is anti-
To primer：The Ex Taq of 0.5 μ L, 5units/ μ L：0.1 μ L, ddH is added2O to PCR reaction system volumes be 20 μ L.
7. according to the method described in claim 2, it is characterized in that, the program of the PCR amplification is：
1) in the 94 DEG C of pre-degeneration for carrying out template DNA reactions, reaction time 4min；
2) reaction of degeneration (RD) of template DNA, reaction time 30s are carried out in 94 DEG C；
3) it anneals in 60 DEG C, time 30s；
4) extended at 72 DEG C, time 1min；
5) circulation step 1)~4) 30 times；
6) extend 5min in 72 DEG C；
7) 1.5% agarose gel electrophoresis imaging analysis is carried out to amplified production.
8. according to the method described in claim 2, it is characterized in that, in step (3), the position of the band is at 730bp.
9. any one of claim 2~7 the method is caused in detection by Pseudomonas syringae pv.actinidae
Prospect on Kiwifruit Bacterial Canker on application.
10. application according to claim 9, which is characterized in that the application includes to the quarantine of Kiwi berry seedling, soil disease
Opportunistic pathogen detection, Prospect on Kiwifruit Bacterial Canker early disease diagnosis and Pseudomonas syringaepv.actinidae detection and
Identification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810138685.4A CN108315448A (en) | 2018-02-10 | 2018-02-10 | The primer and its detection method of detection Prospect on Kiwifruit Bacterial Canker opportunistic pathogen and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810138685.4A CN108315448A (en) | 2018-02-10 | 2018-02-10 | The primer and its detection method of detection Prospect on Kiwifruit Bacterial Canker opportunistic pathogen and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108315448A true CN108315448A (en) | 2018-07-24 |
Family
ID=62902756
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810138685.4A Pending CN108315448A (en) | 2018-02-10 | 2018-02-10 | The primer and its detection method of detection Prospect on Kiwifruit Bacterial Canker opportunistic pathogen and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108315448A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114051882A (en) * | 2021-10-22 | 2022-02-18 | 湖北省农业科学院果树茶叶研究所 | Production method of kiwi fruit seedlings without canker pathogenic bacteria |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104762409A (en) * | 2015-04-30 | 2015-07-08 | 四川农业大学 | Method for detecting pseudomonas syringaepv altinidia through recombinase-mediated isothermal amplification technology |
| CN106399578A (en) * | 2016-12-15 | 2017-02-15 | 安发（福建）生物科技有限公司 | Method for detecting kiwifruit bacterial canker pathogenic bacteria |
| CN106591452A (en) * | 2016-12-08 | 2017-04-26 | 浙江万里学院 | Real-time fluorescence PCR method for quantitatively detecting Pseudomonas syringae pv. Actinidiae |
| KR101820088B1 (en) * | 2016-09-09 | 2018-01-19 | 대한민국 | Phytopathogen of tomato, Pseudomonas syringae pv. tomato specific primer and method for detection of Pseudomonas syringae using the same |
-
2018
- 2018-02-10 CN CN201810138685.4A patent/CN108315448A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104762409A (en) * | 2015-04-30 | 2015-07-08 | 四川农业大学 | Method for detecting pseudomonas syringaepv altinidia through recombinase-mediated isothermal amplification technology |
| KR101820088B1 (en) * | 2016-09-09 | 2018-01-19 | 대한민국 | Phytopathogen of tomato, Pseudomonas syringae pv. tomato specific primer and method for detection of Pseudomonas syringae using the same |
| CN106591452A (en) * | 2016-12-08 | 2017-04-26 | 浙江万里学院 | Real-time fluorescence PCR method for quantitatively detecting Pseudomonas syringae pv. Actinidiae |
| CN106399578A (en) * | 2016-12-15 | 2017-02-15 | 安发（福建）生物科技有限公司 | Method for detecting kiwifruit bacterial canker pathogenic bacteria |
Non-Patent Citations (1)
| Title |
|---|
| J. REES-GEORGE等: "Detection of Pseudomonas syringae pv. actinidiae using polymerase chain reaction (PCR) primers based on the 16S–23S rDNA intertranscribed spacer region and comparison with PCR primers based on other gene regions", 《PLANT PATHOLOGY》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114051882A (en) * | 2021-10-22 | 2022-02-18 | 湖北省农业科学院果树茶叶研究所 | Production method of kiwi fruit seedlings without canker pathogenic bacteria |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ioos et al. | Sensitive detection of Fusarium circinatum in pine seed by combining an enrichment procedure with a real-time polymerase chain reaction using dual-labeled probe chemistry | |
| CN104774955B (en) | The detection method of a kind of grape seat chamber bacterium | |
| Zhang et al. | Molecular detection of Fusarium oxysporum in the infected cucumber plants and soil | |
| Wang et al. | Agrobacterium tumefaciens-mediated genetic transformation of the phytopathogenic fungus Penicillium digitatum | |
| CN110183521A (en) | Application of the rice blast fungus gene M oRMD1 in regulation rice blast fungus pathogenicity | |
| CN106480227B (en) | A kind of watermelon Acidovorax avenae subsp nested PCR detection method | |
| CN108315448A (en) | The primer and its detection method of detection Prospect on Kiwifruit Bacterial Canker opportunistic pathogen and application | |
| Sharma et al. | PCR based assay for the detection of Alternaria brassicicola in crucifers | |
| CN108107037A (en) | Food-borne pathogens detection method based on nuclease protection procedures and electrochemical luminescence principle | |
| CN102220320B (en) | Specific molecular marker of volvariella volvacea V23 strain as well as obtaining method and application thereof | |
| CN108179219A (en) | A kind of primer and its method of RT-PCR detections Kiwi berry soft rot opportunistic pathogen | |
| CN108315461A (en) | Primer and detection method for detecting Kiwi berry soft rot opportunistic pathogen and application | |
| KR20160057655A (en) | Composition for detecting pepper anthracnose and method of detecting pepper anthracnose using the same | |
| CN108531639A (en) | A kind of specific primer and rapid detection method for detecting Botryodiplodia theo-bromae | |
| CN104328205A (en) | Establishment of rapid detection method for grain sclerospora graminicola by LAMP | |
| CN104745725A (en) | Detection primer pairs for simultaneously detecting CYVCV and CCDaV by one-step method, kit and method | |
| CN107227380A (en) | The primer sequence and method of a kind of synchronous detection PCV2 and PRV infection | |
| YANG et al. | Establishment of Agrobacterium tumefaciens-mediated transformation system for rice sheath blight pathogen Rhizoctonia solani | |
| CN104946637B (en) | A kind of multiple DPO PCR detection kits of two kinds of wheel branch germs of sunflower verticillium wilt and its application | |
| CN114032334A (en) | Primer group and kit for detecting quinoa phomopsis and detection method thereof | |
| CN102417934A (en) | Primers, TaqMan probe and kit used for detecting tomato yellow leaf curl virus | |
| CN108165651A (en) | RT-PCR detects Kiwi berry soft rot opportunistic pathogen primer and its methods and applications | |
| CN106434879A (en) | Method for quickly and efficiently detecting different strain mating types of cordyceps militaris | |
| Mishra et al. | Rapid and sensitive detection of Phytophthora colocasiae associated with leaf blight of taro by species-specific polymerase chain reaction assay | |
| Fu et al. | Molecular detection of Cylindrocarpon destructans in infected Chinese ginseng roots and soil |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180724 |
|
| RJ01 | Rejection of invention patent application after publication |