CN108314739B

CN108314739B - Multi-signal chimeric antigen receptor, expression gene thereof, NK cell modified by multi-signal chimeric antigen receptor and application of NK cell

Info

Publication number: CN108314739B
Application number: CN201810112280.3A
Authority: CN
Inventors: 不公告发明人
Original assignee: Shenzhen Morecell Biomedical Technology Development Co ltd
Current assignee: Shenzhen Morecell Biomedical Technology Development Co ltd
Priority date: 2018-02-05
Filing date: 2018-02-05
Publication date: 2020-07-14
Anticipated expiration: 2038-02-05
Also published as: WO2019148656A1; CN108314739A

Abstract

The invention relates to a multi-signal chimeric antigen receptor, an expression gene thereof, a modified NK cell and application thereof. The chimeric antigen receptor comprises a first segment, a second segment and a self-cleavage polypeptide T2A connecting the first segment and the second segment, wherein the first segment comprises a first signal peptide, a TCR gamma chain and a TCR chain which are sequentially connected, the second segment comprises a second signal peptide SP, a tumor antibody, a CD8 domain, a 41BB intracellular domain and a DAP12-ITAM domain which are sequentially connected, the C end of the self-cleavage polypeptide T2A is connected with the TCR chain, and the N end of the self-cleavage polypeptide T2A is connected with the second signal peptide SP. Experimental results show that the multi-signal chimeric antigen receptor can be stably expressed in NK cells, can more quickly and specifically identify and kill malignant tumor cells, and reduces toxic and side effects of treatment.

Description

Multi-signal chimeric antigen receptor, expression gene thereof, NK cell modified by multi-signal chimeric antigen receptor and application of NK cell

Technical Field

The invention relates to the technical field of biology, in particular to a multi-signal chimeric antigen receptor, an expression gene thereof, a modified NK cell and application thereof.

Background

Metabolism is a fundamental feature of the life activities of the body, including substance metabolism and the accompanying energy metabolism. The process of release, conversion and utilization of energy in an organism during substance metabolism is called energy metabolism. An important feature of malignant tumors is the high metabolic capacity of tumor cells, which can specifically overproduce small molecules of tumor phosphorylated antigens.

In the adoptive cell therapy technology in recent years, the T cell technology modified by Chimeric Antigen Receptor (CAR) makes a significant breakthrough in the clinical application of treating tumors, shows good targeting property, killing property and durability in clinical tests, and shows huge application potential and development prospect. However, in recent clinical trials CAR-T technology was found to have high risk factors causing cytokine storm and systemic neurotoxicity.

Natural Killer cells (NK cells) are a central component of the innate immunity of the human body, are a third group of lymphocytes juxtaposed to T, B cells, are derived from hematopoietic stem cells, and mature within the bone marrow. It accounts for about 10% to 15% of the total number of lymphocytes in peripheral blood, about 3% to 4% in the spleen, and may also occur in lung, liver and intestinal mucosa, but rarely in thymus, lymph nodes and thoracic ducts. NK cells have many characteristics compared to T cells: innate immune cells, nonspecific direct killing of target cells, no need of prior antigen sensitization, no need of antibody participation, no MHC restriction, and early development of immune killing effect. Therefore, researchers hope that NK cells modified by chimeric antigen receptors are useful for treating tumors.

However, the traditional NK cells modified by the chimeric antigen receptor have the problems of insensitive recognition process and more toxic and side effects in treatment.

Disclosure of Invention

Based on the above, there is a need for a multi-signal chimeric antigen receptor and an expression gene thereof, which can be stably expressed in NK cells, are sensitive in tumor cell recognition process, and have few toxic and side effects in treatment.

In addition, an expression vector, a multi-signal chimeric antigen receptor modified NK cell and application thereof are also provided.

A multi-signal chimeric antigen receptor comprises a first segment, a second segment and a self-cleavage polypeptide T2A connecting the first segment and the second segment, wherein the first segment comprises a first signal peptide, a TCR gamma chain and a TCR chain which are sequentially connected, the second segment comprises a second signal peptide SP, a tumor antibody, a CD8 domain, a 41BB intracellular domain and a DAP12-ITAM domain which are sequentially connected, the C end of the self-cleavage polypeptide T2A is connected with the TCR chain, and the N end of the self-cleavage polypeptide T2A is connected with the second signal peptide SP.

In one embodiment, the amino acid sequence of the first fragment is shown as SEQ ID No.1 and the amino acid sequence of the second fragment is shown as SEQ ID No. 2.

In one embodiment, the nucleotide sequence encoding the first fragment is shown as SEQ ID No.3 and the nucleotide sequence encoding the second fragment is shown as SEQ ID No. 4.

In one embodiment, the chimeric antigen receptor is:

(a) a protein consisting of an amino acid sequence shown in SEQ ID No. 5; or the like, or, alternatively,

(b) and (b) a protein derived from (a) by substituting, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID No.5 and having the activity of the chimeric antigen receptor.

In one embodiment, the chimeric antigen receptor is:

(a) protein coded by a nucleotide sequence shown as SEQ ID No. 6; or the like, or, alternatively,

(b) and (b) one or more bases are substituted, deleted or added in the nucleotide sequence shown in SEQ ID No.6, and the protein which has the activity of the chimeric antigen receptor and is derived from the (a) can be coded.

An expression gene for expressing a multi-signal chimeric antigen receptor, wherein the multi-signal chimeric antigen receptor comprises a first segment, a second segment and a self-cleavage polypeptide T2A connecting the first segment and the second segment, the first segment comprises a first signal peptide, a TCR gamma chain and a TCR chain which are sequentially connected, the second segment comprises a second signal peptide SP, a tumor antibody, a CD8 domain, a 41BB intracellular domain and a DAP12-ITAM domain which are sequentially connected, the C end of the self-cleavage polypeptide T2A is connected with the TCR chain, and the N end of the self-cleavage polypeptide T2A is connected with the second signal peptide SP.

In one embodiment, the expression gene is:

(a) a nucleotide sequence shown as SEQ ID No. 6; or the like, or, alternatively,

(b) the nucleotide sequence with the chimeric antigen receptor activity can be obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in SEQ ID No.6 and encoding.

An expression vector, wherein the expression vector contains the expression gene.

A multi-signal chimeric antigen receptor-modified NK cell capable of expressing the chimeric antigen receptor of any one of the above, or into which the expression gene of any one of the above has been introduced, or into which the expression vector of the above has been transfected.

Use of the chimeric antigen receptor of any one of the above, the expression gene of any one of the above, the expression vector of any one of the above, or the multi-signal chimeric antigen receptor-modified NK cell of any one of the above, in the preparation of an anti-tumor medicament.

The experimental result shows that the multi-signal chimeric antigen receptor can be stably expressed in the NK cell, so that the chimeric antigen receptor modified NK cell is formed. After the multi-signal chimeric antigen receptor is expressed, the high-metabolism malignant tumor phosphorylation antigen small molecule can be identified through the TCR gamma chain and the TCR chain in the first segment, so that the CAR-NK cell is combined with a tumor cell in a targeted mode, and the signal is a first signal. If the tumor cell surface expresses the tumor antigen corresponding to the tumor antibody in the chimeric antigen receptor, the downstream signal of CAR is further activated, thereby killing the tumor cell, and the signal is the second signal. The generated first signal is matched with the second signal, so that the chimeric antigen receptor modified NK cell (CAR-NK) can more quickly and specifically identify and kill malignant tumor cells, and the toxic and side effects of treatment are reduced.

Drawings

FIG. 1 is a schematic diagram showing the structure of a third group of chimeric antigen receptors in example 1;

FIG. 2 is a map of the p L enti7.3- γ TCR/c-Met-CAR lentiviral expression vector constructed in example 1;

FIG. 3 is a graph comparing the flow scatter plot results of in vitro killer cells under different conditions for the chimeric antigen receptor-modified NK cells obtained in example 1.

Detailed Description

In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with examples are described in detail below. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein, but rather should be construed as broadly as the present invention is capable of modification in various respects, all without departing from the spirit and scope of the present invention.

The multi-signal chimeric antigen receptor of one embodiment comprises a first fragment, a second fragment, and a self-cleaving polypeptide T2A linking the first fragment and the second fragment. Wherein, the first segment comprises a first signal peptide, a TCR gamma chain and a TCR chain which are connected in sequence, and the second segment comprises a second signal peptide SP, a tumor antibody, a CD8 structural domain, a 41BB intracellular structural domain and a DAP12-ITAM structural domain which are connected in sequence. The C-terminal of the self-cleaving polypeptide T2A was linked to the TCR chain and the N-terminal of the self-cleaving polypeptide T2A was linked to the second signal peptide SP.

After the multi-signal chimeric antigen receptor is expressed, the high-metabolism malignant tumor phosphorylation antigen small molecule can be identified through the TCR gamma chain and the TCR chain in the first segment, so that the CAR-NK cell is targeted and combined with a tumor cell, and the signal is a first signal. If the tumor cell surface expresses the tumor antigen corresponding to the tumor antibody in the chimeric antigen receptor, the downstream signal of CAR is further activated, thereby killing the tumor cell, and the signal is the second signal. The generated first signal is matched with the second signal, so that the chimeric antigen receptor modified NK cell (CAR-NK) can more quickly and specifically identify and kill malignant tumor cells, and the toxic and side effects of treatment are reduced.

In one embodiment, the amino acid sequence of the first fragment is shown in SEQ ID No.1, wherein amino acids No.1 to No. 22 in SEQ ID No.1 are the first signal peptide sequence, amino acids No. 23 to No. 296 are the TCR γ chain sequence, and amino acids No. 297 to No. 556 are the TCR chain sequence.

Further, the nucleotide sequence encoding the first fragment obtained by codon optimization is shown in SEQ ID No. 3.

Specifically, the tumor antibody in the second fragment is at least one selected from the group consisting of a CD19 antibody, a CD20 antibody, a NY-ESO-1 antibody, a MUC1 antibody, a VEGFR1 antibody, a VEGFR2 antibody, an EGFR antibody, an EGFRvIII antibody, a c-Met antibody, and a Meso antibody.

In this embodiment, the tumor antibody is a c-Met antibody, and the sequence of VH and V L is selected by using the sequence of the selected monoclonal antibody against c-Met, and used for designing scFv sequence in CAR vector, so as to obtain the amino acid sequence of c-Met single-chain antibody.

Specifically, the amino acid sequence of the second fragment is shown as SEQ ID No.2, wherein amino acids No.1 to No. 22 in the SEQ ID No.2 are a second signal peptide sequence, amino acids No. 23 to No. 119 are a VH (heavy chain) sequence of a c-Met antibody, amino acids No. 120 to No. 134 are linking amino acids, amino acids No. 135 to No. 240 are a V L (light chain) sequence of the c-Met antibody, amino acids No. 241 to No. 244 are enzyme cleavage sites, amino acids No. 245 to No. 315 are CD8 domains (including a hinge region and a transmembrane domain), amino acids No. 316 to No. 357 are 41BB intracellular domains (costimulatory signal intracellular domains), and amino acids No. 358 to No. 405 are DAP12-ITAM domains (DAP12 ITAM domains).

Further, the nucleotide sequence encoding the second fragment obtained by codon optimization is shown in SEQ ID No. 4.

In this embodiment, the chimeric antigen receptor is: (a) a protein consisting of an amino acid sequence shown in SEQ ID No. 5; or (b) a protein which is derived from the protein (a) and has chimeric antigen receptor activity by substituting, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID No. 5.

Specifically, in the amino acid sequence shown in SEQ ID No.5, amino acids No.1 to No. 556 are the first fragment, and amino acids No. 556 are the terminator. The No. 558 to No. 578 amino acids are self-splitting polypeptide T2A, and the No. 579 to No. 983 amino acids are second fragments.

Further, the chimeric antigen receptor is: (a) protein coded by a nucleotide sequence shown as SEQ ID No. 6; or (b) one or more bases are substituted, deleted or added in the nucleotide sequence shown in SEQ ID No.6, and the protein which has the activity of a chimeric antigen receptor and is derived from the protein (a) can be coded.

It will be appreciated that, since there are many codons encoding the same amino acid, the coding sequence of the polypeptide is characterized by polymorphism and variation. Therefore, the protein which has the activity of the chimeric antigen receptor and is obtained by substituting, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID No.5, or the protein which has the activity of the multi-signal chimeric antigen receptor and is obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in SEQ ID No.6 and can be coded to obtain a derivative protein with the activity of the multi-signal chimeric antigen receptor has no obvious functional difference with the chimeric antigen receptor and is also included in the scope of the invention.

Through continuous research and exploration, the multi-signal Chimeric Antigen Receptor (CAR) with the functional structure is successfully designed. Experiments prove that the multi-signal Chimeric Antigen Receptor (CAR) can rapidly and specifically recognize malignant tumor cells and kill the malignant tumor cells, so that the toxic and side effects of treatment are reduced.

The multi-signal Chimeric Antigen Receptor (CAR) can be applied to anti-tumor drugs.

In addition, the present application also provides an expressed gene of an embodiment for expressing a multi-signal chimeric antigen receptor.

Specifically, the characteristics of the chimeric antigen receptor are described above, and are not described herein.

Specifically, the expression gene is: (a) a nucleotide sequence shown as SEQ ID No. 6; or (b) one or more bases are substituted, deleted or added in the nucleotide sequence shown in SEQ ID No.6 and the nucleotide sequence with the activity of the chimeric antigen receptor can be obtained through coding.

The expression gene can express a multi-signal Chimeric Antigen Receptor (CAR), and the chimeric antigen receptor can be stably expressed in NK cells through experimental verification, can rapidly and specifically identify and kill malignant tumor cells, and can reduce toxic and side effects of treatment.

The expression gene can be applied to antitumor drugs.

The present application also provides an expression vector of an embodiment, which contains the expression gene.

In one embodiment, the expression vector is a lentivirus comprising the above-described expression gene.

The expression vector can be used for expressing the chimeric antigen receptor, has high expression efficiency and stable expression quantity, and can be applied to antitumor drugs.

In addition, the present application also provides an embodiment multi-signal chimeric antigen receptor modified NK cell. The NK cell can express the chimeric antigen receptor, or the expression gene is introduced into the NK cell, or the expression vector is transfected into the NK cell.

Experimental results show that the NK cell modified by the multi-signal chimeric antigen receptor has specific efficient killing effect on tumors.

The patent applies a genetic engineering method to clone gamma TCR (comprising TCR gamma chain and TCR chain) and a chimeric antigen receptor targeting a tumor antigen to NK cells, wherein the tumor antigen can be selected from one or more of CD19, CD20, NY-ESO-1, MUC1, VEGFR1, VEGFR2, EGFR, EGFRvIII, c-Met and Meso, and the gamma TCR and the chimeric antigen receptor structures are respectively expressed on the surfaces of the NK cells by self-lysis polypeptides T2A. The gamma TCR and the NK cell of the chimeric antigen receptor recognize high-metabolism malignant tumor phosphorylation antigen small molecule through the gamma TCR, so that the CAR-NK cell is targeted and combined with a tumor cell, and the signal is a first recognition signal. If the tumor cell surface expresses a tumor antigen corresponding to the chimeric antigen receptor, which is the second recognition signal, the downstream signal of CAR is activated, thereby killing the tumor cell. The multi-signal chimeric antigen receptor modified NK cell (CAR-NK) can more rapidly and specifically identify and kill malignant tumor cells, and reduces toxic and side effects of treatment.

The following is a detailed description of the embodiments.

In the following examples, unless otherwise specified, the experimental procedures without specifying the specific conditions are generally carried out according to conventional conditions, for example, the conditions described in the molecular cloning instructions [ M ] (Beijing: scientific Press, 1992) by SammBruke, EF Friech, T Mannich et al (gold winter goose, Li Benghang et al) or the recommended procedures by the kit manufacturer.

Example 1

1. Construction of Lentiviral expression vectors

1.1c-Met scFv sequences

The laboratory screened anti-c-Met monoclonal antibody sequences were used to select VH and V L sequences for designing scFv sequences in CAR vectors.

1.2 sequence Synthesis and vector construction

According to experimental requirements, three sequences are respectively synthesized for constructing a lentivirus expression vector:

the expression vector I (first group) is p L enti 7.3-gamma TCR lentivirus expression vector, the sequence is shown in SEQ ID No.3, and the expression vector comprises signal peptide SP, TCR gamma chain and TCR chain.

And the expression vector II (the second group) is a p L enti7.3-c-Met-CAR lentivirus expression vector, the sequence of which is shown as SEQ ID No.4, and comprises a c-Met single-chain antibody (scFv), a CD8 hinge region and transmembrane domain, a 41BB intracellular domain and a DAP12-ITAM domain.

And the expression vector III (third group) is p L enti 7.3-gamma TCR/c-Met-CAR lentivirus expression vector, the sequence is shown as SEQ ID No.6, and the expression vector comprises a signal peptide SP, a TCR gamma chain, a TCR chain, T2A, a signal peptide SP, a c-Met single-chain antibody (scFv), a CD8 hinge region and transmembrane domain, a 41BB intracellular domain and a DAP12-ITAM domain, the structure of the artificially constructed gene fragment is shown as figure 1, and the plasmid spectrogram is shown as figure 2.

The three sequences were committed to Nanjing Kingsrey Biotech, Inc. to synthesize the entire expression cassette, which was cloned into p L enti7.3 lentiviral expression vectors, respectively.

2. Packaging preparation of lentiviruses

2.1Day1, 5 × 10⁶293FT cells (Invitrogen, Cat. No. R700-07), centrifuged and the supernatant discarded, resuspended in 10m L37 deg.C pre-warmed complete medium (D-MEM + 10% FBS +2mM L-glutamine +0.1mM non-essential amino acids +1mM sodium pyruvate + 1% P/S) and plated in 10cm dishes at 37 deg.C with 5% CO₂Incubate overnight in the incubator.

2.2Day2 culture medium was discarded from the dish and 5m L Opti-

I broth (Invitrogen, Cat. No. 31985-062).

2.3DNA-

2000 preparation of the complex:

a) 1.5m L serum-free Opti-

I culture medium was added to a 5m L centrifuge tube and 9. mu.g ViraPower was added^TMThe plasmid mixture and 3. mu.g of lentiviral expression plasmid were packaged and mixed gently.

b) 1.5m L serum-free Opti-

I culture solution is added into another 5m L centrifuge tube, and 36 mu L is added

2000, incubation at room temperature for 5min after gentle mixing.

c) Transferring the solution obtained in the two steps of a) and b) into a centrifuge tube, and gently and uniformly mixing.

d) Incubating for 20min at room temperature to obtain DNA-

2000 of the complex.

2.4 DNA obtained

2000 complexes were added dropwise slowly to the petri dish and the dish was gently shaken back and forth. 37 ℃ and 5% CO₂Incubate overnight in the incubator.

2.5Day3 Petri dishes were removed, the culture medium was discarded, 10m L DMEM complete medium was added, 37 ℃ C., 5% CO₂And (5) incubating for 48-72h in the incubator.

2.6Day5 or Day6 the culture broth in the dish was transferred to 15m L centrifuge tubes and centrifuged at 2000g for 15min at 4 ℃.

2.7 absorbing the supernatant, collecting the lentivirus, and placing into 1m L freezing tubes for long-term storage at-80 ℃.

3. Preparation of gamma TCR-NK cells, c-Met-CAR-NK cells, gamma TCR/c-Met-CAR-NK cells

3.1 isolation of PBMC cells from healthy volunteers

(1) Collecting peripheral blood 25m L from healthy volunteers, anticoagulating with heparin, centrifuging at room temperature (700g, 20min), sucking upper layer plasma, placing in water bath at 56 deg.C for 30min, standing at 4 deg.C for 15min, centrifuging (900g, 30min), and storing at 4 deg.C.

(2) Collecting 700g of the above, centrifuging for 20min, adding D-PBS to 50m L, mixing, slowly adding into a 50m L centrifuge tube containing 20m L human lymphocyte separation liquid, and centrifuging at room temperature (800g, 15 min).

(3) The buffy coat cells were aspirated and added to a 50m L centrifuge tube containing 5m L RPMI 1640.

(4) RPMI 1640 was washed twice (600g, 10min centrifugation) and the cells collected were PBMC cells.

3.2 preparation of cells

(1) PBMC cell density was adjusted to 1 × 10 by using Alys505 culture medium containing 50ng/m L CD16 monoclonal antibody, 1000U/m L I L-2, 100ng/m L I L-15 and 0.5% autologous plasma⁶And/m L, transferring the cells into a six-hole plate, wherein each 2m L cell is cultured in a 5.0% CO2 incubator at 37 ℃ under saturated humidity.

(2) Adjusting the cell density to 1 × 10 every 3 days⁶M L, adding Alys505 culture solution containing 1000U/m L I L-2 and 0.5% autologous plasma.

(3) On day 7, NK cells were divided into four groups, each group being as follows1×10⁵The density per well was transferred to a 24 well plate at 100. mu. L per well, with each set of three duplicate wells.

Group 1 p L enti 7.3-gamma TCR transfected lentiviruses were designated as gamma TCR group.

Group 2 p L enti 7.3-c-Met-CAR-transfected lentiviruses, designated as group c-Met-CAR.

Group 3 p L enti 7.3-gamma TCR/c-Met-CAR was transfected and named as the gamma TCR/c-Met-CAR group.

Group 4: blank NK cell control group, named NC group.

Adding stock solution containing lentivirus particles into groups 1 to 3 according to the MOI value of 20 (the MOI represents the ratio of the number of viruses to the number of cells), taking lentivirus solution and the complete culture medium of Alys505 to prepare 100 mu L, adding the lentivirus solution into the cells by using a pipette, gently blowing and uniformly mixing, adding blank Alys505 complete culture medium 100 mu L into group 4, adding Polybrene with the final concentration of 6 mu g/m L into each group of the cells, gently shaking and uniformly mixing, placing at 37 ℃ and 5% CO₂Incubate in incubator for 24 h.

(4) On day 8, cells were centrifuged, the lentivirus-containing supernatant discarded, resuspended in 200. mu. L Alys-505 medium, and placed in 24-well plates for fluid replacement depending on cell growth.

(5) On day 10, mature cells were harvested for subsequent analysis.

Test one

Dual-signal CAR-NK cell in-vitro anti-tumor activity detection

Taking the above groups of cells as effector cells, taking CFSE labeled liver cancer cell HepG-2 as target cell, mixing effector cells and target cells according to an effective target ratio of 20:1, mixing, and placing in 5% CO₂Incubate at 37 ℃ in an incubator.

After 24h, adding 1 mu g/m L PI dye solution, mixing uniformly, incubating at room temperature in dark for 15min, and detecting CFSE by using a flow cytometer⁺PI⁺Percentage of cells (dead HepG-2 cells). The results are shown in figure 3, the killing rate of the gamma TCR group cells to the liver cancer HepG-2 cells is about 27.93 percent, the killing rate of the c-Met-CAR group cells to the liver cancer HepG-2 cells is about 34.87 percent, and the gamma TCR/c-Met-CAR group cells are fineThe killing rate of the cells to the liver cancer HepG-2 cells is about 65.2 percent, and the killing rate of the NC group cells to the liver cancer HepG-2 cells is about 13.31 percent. It is demonstrated that the dual-signal CAR-NK cells prepared in the third group of example 1 have a highly effective killing effect on hepatoma cells.

Test two

Dual-signal CAR-NK cell in vivo anti-tumor activity detection in animals

Taking human liver cancer HepG-2 cells in logarithmic growth phase, digesting with pancreatin to prepare single cell suspension containing 1 × 10⁷0.1m L suspension of cancer cells is injected subcutaneously at the scapular part of nude mice, experimental grouping and treatment conditions are shown in the following table, changes in diet, activity and the like of animals in each group are observed daily, the body weight of the nude mice is measured every other day, the change condition of the body weight is observed, the maximum longitudinal diameter (a) and the maximum transverse diameter (b) of a tumor are measured every 2 days, the growth condition of the tumor is observed, and the tumor volume is 1/12 pi × a × b according to a formula²Tumor inhibition rates of the groups of nude mice were calculated on day 13 after the treatment of group (3), wherein the tumor inhibition rate was × 100 (1-mean tumor volume of treatment group/mean tumor volume of negative control group) 100%.

Table 1: experimental grouping and treatment

FAC chemotherapy regimen: fluorouracil 500 mg/M2; doxorubicin 50 mg/M2; cyclophosphamide 500mg/M2, administered on the first day for 21 days as a course of treatment. The comparison of body weight, tumor volume and tumor inhibition rate of each group of nude mice is shown in table 2.

Table 2: body weight, tumor volume and tumor inhibition rate of each group of nude mice

The results of in vivo anti-tumor experiments on the CAR-NK cells show that all groups of nude mice survive, and the weight of the nude mice in the chemotherapy group is reduced, the tumor volume is reduced, but the feeding and activities are reduced by taking the nude mice in the negative control group as a reference. The survival condition of the gamma TCR-NK treatment group nude mice is general, the body weight is not obviously reduced, and the tumor inhibition rate reaches 34.11 percent. The survival condition of c-Met-CAR-NK treatment group nude mice is good, the body weight is not reduced obviously, and the tumor inhibition rate reaches 49.42%. The survival condition of the gamma TCR/c-Met-CAR-NK treatment group nude mice is good, the body weight is not reduced obviously, the tumor volume is smaller obviously, and the tumor inhibition rate reaches 74.38%. The third group of dual-signal CAR-NK cells in example 1 can more effectively inhibit the growth of malignant tumors in vivo, and have the advantages of less treatment side effects and high specificity.

The above-mentioned embodiments only express one or several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Shenzhen Murashel biomedical science and technology development Limited

<120> multi-signal chimeric antigen receptor, expression gene thereof, NK cell modified by multi-signal chimeric antigen receptor and application of multi-signal chimeric antigen receptor

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>556

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro

1 5 10 15

Ala Phe Leu Leu Ile Pro Met Leu Ser Leu Leu His Ala Ser Thr Leu

20 25 30

Ala Val Leu Gly Ala Leu Cys Val Tyr Gly Ala Gly His Leu Glu Gln

35 40 45

Pro Gln Ile Ser Ser Thr Lys Thr Leu Ser Lys Thr Ala Arg Leu Glu

50 55 60

Cys Val Val Ser Gly Ile Thr Ile Ser Ala Thr Ser Val Tyr Trp Tyr

65 70 75 80

Arg Glu Arg Pro Gly Glu Val Ile Gln Phe Leu Val Ser Ile Ser Tyr

85 90 95

Asp Gly Thr Val Arg Lys Glu Ser Gly Ile Pro Ser Gly Lys Phe Glu

100 105 110

Val Asp Arg Ile Pro Glu Thr Ser Thr Ser Thr Leu Thr Ile His Asn

115 120 125

Val Glu Lys Gln Asp Ile Ala Thr Tyr Tyr Cys Ala Leu Trp Glu Ala

130 135 140

Gln Gln Glu Leu Gly Lys Lys Ile Lys Val Phe Gly Pro Gly Thr Lys

145 150 155 160

Leu Ile Ile Thr Asp Lys Gln Leu Asp Ala Asp Val Ser Pro Lys Pro

165 170 175

Thr Ile Phe Leu Pro Ser Ile Ala Glu Thr Lys Leu Gln Lys Ala Gly

180 185 190

Thr Tyr Leu Cys Leu Leu Glu Lys Phe Phe Pro Asp Val Ile Lys Ile

195 200 205

His Trp Glu Glu Lys Lys Ser Asn Thr Ile Leu Gly Ser Gln Glu Gly

210 215 220

Asn Thr Met Lys Thr Asn Asp Thr Tyr Met Lys Phe Ser Trp Leu Thr

225 230 235 240

Val Pro Glu Lys Ser Leu Asp Lys Glu His Arg Cys Ile Val Arg His

245 250 255

Glu Asn Asn Lys Asn Gly Val Asp Gln Glu Ile Ile Phe Pro Pro Ile

260 265 270

Lys Thr Asp Val Ile Thr Met Asp Pro Lys Asp Asn Cys Ser Lys Asp

275 280 285

Ala Asn Asp Thr Leu Leu Leu Gln Met Gln Arg Ile Ser Ser Leu Ile

290 295 300

His Leu Ser Leu Phe Trp Ala Gly Val Met Ser Ala Ile Glu Leu Val

305 310 315 320

Pro Glu His Gln Thr Val Pro Val Ser Ile Gly Val Pro Ala Thr Leu

325 330 335

Arg Cys Ser Met Lys Gly Glu Ala Ile Gly Asn Tyr Tyr Ile Asn Trp

340 345 350

Tyr Arg Lys Thr Gln Gly Asn Thr Met Thr Phe Ile Tyr Arg Glu Lys

355 360 365

Asp Ile Tyr Gly Pro Gly Phe Lys Asp Asn Phe Gln Gly Asp Ile Asp

370 375 380

Ile Ala Lys Asn Leu Ala Val Leu Lys Ile Leu Ala Pro Ser Glu Arg

385 390 395 400

Asp Glu Gly Ser Tyr Tyr Cys Ala Cys Asp Thr Leu Gly Met Gly Gly

405 410 415

Glu Tyr Thr Asp Lys Leu Ile Phe Gly Lys Gly Thr Arg Val Thr Val

420 425 430

Glu Pro Arg Ser Gln Pro His Thr Lys Pro Ser Val Phe Val Met Lys

435 440 445

Asn Gly Thr Asn Val Ala Cys Leu Val Lys Glu Phe Tyr Pro Lys Asp

450 455 460

Ile Arg Ile Asn Leu Val Ser Ser Lys Lys Ile Thr Glu Phe Asp Pro

465 470 475 480

Ala Ile Val Ile Ser Pro Ser Gly Lys Tyr Asn Ala Val Lys Leu Gly

485 490 495

Lys Tyr Glu Asp Ser Asn Ser Val Thr Cys Ser Val Gln His Asp Asn

500 505 510

Lys Thr Val His Ser Thr Asp Phe Glu Val Lys Thr Asp Ser Thr Asp

515 520 525

His Val Lys Pro Lys Glu Thr Glu Asn Thr Lys Gln Pro Ser Lys Ser

530 535 540

Cys His Lys Pro Lys Ala Ile Val His Thr Glu Lys

545 550 555

<210>2

<211>405

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro

1 5 10 15

Ala Phe Leu Leu Ile Pro Ile Gln Met Thr Gln Ser Pro Ser Ser Leu

20 25 30

Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln

35 40 45

Ser Ile Arg Asn Tyr Leu Asn Trp Tyr Gln Gln Glu Pro Gly Lys Ala

50 55 60

Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro

65 7075 80

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Ile Leu Thr Ile

85 90 95

Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser

100 105 110

Tyr Val Thr Pro Leu Thr Phe Gly Gly Gly Gly Ser Gly Gly Gly Gly

115 120 125

Ser Gly Gly Gly Gly Ser Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys

130 135 140

Ala Ala Ser Gly Phe Thr Phe Ser Lys Tyr Asp Met Leu Trp Val Arg

145 150 155 160

Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Tyr Ile Tyr Pro Ser

165 170 175

Gly Gly Leu Thr Glu Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile

180 185 190

Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu

195 200 205

Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Arg Ala Pro Arg

210 215 220

Ser Leu Ser Phe Asp Ile Trp Gly Gln Gly Thr Met Val Thr Val Ser

225 230235 240

Pro Lys Leu Gly Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg Pro Pro

245 250 255

Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu

260 265 270

Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp

275 280 285

Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly

290 295 300

Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Lys Arg Gly Arg Lys

305 310 315 320

Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr

325 330 335

Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu

340 345 350

Gly Gly Cys Glu Leu Arg Leu Val Pro Arg Gly Arg Gly Ala Ala Glu

355 360 365

Ala Ala Thr Arg Lys Gln Arg Ile Thr Glu Thr Glu Ser Pro Tyr Gln

370 375 380

Glu Leu Gln Gly Gln Arg Ser Asp Val Tyr Ser Asp Leu Asn Thr Gln

385 390 395400

Arg Pro Tyr Tyr Lys

405

<210>3

<211>1671

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg 60

atcccaatgc tgtcactgct ccacgcatca acgctggcag tccttggggc tctgtgtgta 120

tatggtgcag gtcacctaga gcaacctcaa atttccagta ctaaaacgct gtcaaaaaca 180

gcccgcctgg aatgtgtggt gtctggaata acaatttctg caacatctgt atattggtat 240

cgagagagac ctggtgaagt catacagttc ctggtgtcca tttcatatga cggcactgtc 300

agaaaggaat ccggcattcc gtcaggcaaa tttgaggtgg ataggatacc tgaaacgtct 360

acatccactc tcaccattca caatgtagag aaacaggaca tagctaccta ctactgtgcc 420

ttgtgggagg cccagcaaga gttgggcaaa aaaatcaagg tatttggtcc cggaacaaag 480

cttatcatta cagataaaca acttgatgca gatgtttccc ccaagcccac tatttttctt 540

ccttcaattg ctgaaacaaa gctccagaag gctggaacat acctttgtct tcttgagaaa 600

tttttccctg atgttattaa gatacattgg gaagaaaaga agagcaacac gattctggga 660

tcccaggagg ggaacaccat gaagactaat gacacataca tgaaatttag ctggttaacg 720

gtgccagaaa agtcactgga caaagaacac agatgtatcg tcagacatga gaataataaa 780

aacggagttg atcaagaaat tatctttcct ccaataaaga cagatgtcat cacaatggat 840

cccaaagaca attgttcaaa agatgcaaat gatacactac tgctgcagat gcagaggatc 900

tcctccctca tccatctctc tctcttctgg gcaggagtca tgtcagccat tgagttggtg 960

cctgaacacc aaacagtgcc tgtgtcaata ggggtccctg ccaccctcag gtgctccatg 1020

aaaggagaag cgatcggtaa ctactatatc aactggtaca ggaagaccca aggtaacaca 1080

atgactttca tataccgaga aaaggacatc tatggccctg gtttcaaaga caatttccaa 1140

ggtgacattg atattgcaaa gaacctggct gtacttaaga tacttgcacc atcagagaga 1200

gatgaagggt cttactactg tgcctgtgac accttgggga tgggggggga atacaccgat 1260

aaactcatct ttggaaaagg aacccgtgtg actgtggaac caagaagtca gcctcatacc 1320

aaaccatccg tttttgtcat gaaaaatgga acaaatgtcg cttgtctggt gaaggaattc 1380

taccccaagg atataagaat aaatctcgtg tcatccaaga agataacaga gtttgatcct 1440

gctattgtca tctctcccag tgggaagtac aatgctgtca agcttggtaa atatgaagat 1500

tcaaattcag tgacatgttc agttcaacac gacaataaaa ctgtgcactc cactgacttt 1560

gaagtgaaga cagattctac agatcacgta aaaccaaagg aaactgaaaa cacaaagcaa 1620

ccttcaaaga gctgccataa acccaaagcc atagttcata ccgagaagta a 1671

<210>4

<211>1215

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg 60

atcccaatccagatgaccca gtctccatcc tccctgtctg catctgtagg agacagagtc 120

accatcactt gtcgggcaag tcagagcatt aggaactatt taaattggta tcagcaggaa 180

ccagggaaag cccctaagct cctgatctat gctgcatcca gtttgcaaag tggggtccca 240

tcaaggttca gtggcagtgg atctgggaca gacttcattc tcaccatcag cagtctgcag 300

cctgaagatt ttgcaactta ctactgtcaa cagagttacg ttaccccgct cactttcggt 360

ggtggtggtt ctggcggcgg cggctccggt ggtggtggat ctcagcctgg tggttcttta 420

cgtctttctt gcgctgcttc cggattcact ttctctaagt acgatatgct ttgggttcgc 480

caagctcctg gtaaaggttt ggagtgggtt tcttatatct atccttctgg tggccttact 540

gagtatgctg actccgttaa aggtcgcttc actatctcta gagacaactc taagaatact 600

ctctacttgc agatgaacag cttaagggct gaggacacgg ccgtgtatta ctgtgcgaga 660

cgggctcccc ggtccctttc ttttgatatc tggggccaag ggacaatggt caccgtctcc 720

cccaagcttg gggcgaagcc caccacgacg ccagcgccgc gaccaccaac accggcgccc 780

accatcgcgt cgcagcccct gtccctgcgc ccagaggcgt gccggccagc ggcggggggc 840

gcagtgcaca cgagggggct ggacttcgcc tgtgatatct acatctgggc gcccttggcc 900

gggacttgtg gggtccttct cctgtcactg gttatcaccc tttacaaacg gggcagaaag 960

aaactcctgt atatattcaa acaaccattt atgagaccag tacaaactac tcaagaggaa 1020

gatggctgta gctgccgatt tccagaagaa gaagaaggag gatgtgaact gcggctggtc 1080

cctcgggggc gaggggctgc ggaggcagcg acccggaaac agcgtatcac tgagaccgag 1140

tcgccttatc aggagctcca gggtcagagg tcggatgtct acagcgacct caacacacag 1200

aggccgtatt acaaa 1215

<210>5

<211>983

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>5

Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro

1 5 10 15

Ala Phe Leu Leu Ile Pro Met Leu Ser Leu Leu His Ala Ser Thr Leu

20 25 30

Ala Val Leu Gly Ala Leu Cys Val Tyr Gly Ala Gly His Leu Glu Gln

35 40 45

Pro Gln Ile Ser Ser Thr Lys Thr Leu Ser Lys Thr Ala Arg Leu Glu

50 55 60

Cys Val Val Ser Gly Ile Thr Ile Ser Ala Thr Ser Val Tyr Trp Tyr

65 70 75 80

Arg Glu Arg Pro Gly Glu Val Ile Gln Phe Leu Val Ser Ile Ser Tyr

85 90 95

Asp Gly Thr Val Arg Lys Glu Ser Gly Ile Pro Ser Gly Lys Phe Glu

100 105 110

Val Asp Arg Ile Pro Glu Thr Ser Thr Ser Thr Leu Thr Ile His Asn

115 120 125

Val Glu Lys Gln Asp Ile Ala Thr Tyr Tyr Cys Ala Leu Trp Glu Ala

130 135 140

Gln Gln Glu Leu Gly Lys Lys Ile Lys Val Phe Gly Pro Gly Thr Lys

145 150 155 160

Leu Ile Ile Thr Asp Lys Gln Leu Asp Ala Asp Val Ser Pro Lys Pro

165 170 175

Thr Ile Phe Leu Pro Ser Ile Ala Glu Thr Lys Leu Gln Lys Ala Gly

180 185 190

Thr Tyr Leu Cys Leu Leu Glu Lys Phe Phe Pro Asp Val Ile Lys Ile

195 200 205

His Trp Glu Glu Lys Lys Ser Asn Thr Ile Leu Gly Ser Gln Glu Gly

210 215 220

Asn Thr Met Lys Thr Asn Asp Thr Tyr Met Lys Phe Ser Trp Leu Thr

225 230 235 240

Val Pro Glu Lys Ser Leu Asp Lys Glu His Arg Cys Ile Val Arg His

245 250 255

Glu Asn Asn Lys Asn Gly Val Asp Gln Glu Ile Ile Phe Pro Pro Ile

260 265 270

Lys Thr Asp Val Ile Thr Met Asp Pro Lys Asp Asn Cys Ser Lys Asp

275280 285

Ala Asn Asp Thr Leu Leu Leu Gln Met Gln Arg Ile Ser Ser Leu Ile

290 295 300

His Leu Ser Leu Phe Trp Ala Gly Val Met Ser Ala Ile Glu Leu Val

305 310 315 320

Pro Glu His Gln Thr Val Pro Val Ser Ile Gly Val Pro Ala Thr Leu

325 330 335

Arg Cys Ser Met Lys Gly Glu Ala Ile Gly Asn Tyr Tyr Ile Asn Trp

340 345 350

Tyr Arg Lys Thr Gln Gly Asn Thr Met Thr Phe Ile Tyr Arg Glu Lys

355 360 365

Asp Ile Tyr Gly Pro Gly Phe Lys Asp Asn Phe Gln Gly Asp Ile Asp

370 375 380

Ile Ala Lys Asn Leu Ala Val Leu Lys Ile Leu Ala Pro Ser Glu Arg

385 390 395 400

Asp Glu Gly Ser Tyr Tyr Cys Ala Cys Asp Thr Leu Gly Met Gly Gly

405 410 415

Glu Tyr Thr Asp Lys Leu Ile Phe Gly Lys Gly Thr Arg Val Thr Val

420 425 430

Glu Pro Arg Ser Gln Pro His Thr Lys Pro Ser Val Phe Val Met Lys

435440 445

Asn Gly Thr Asn Val Ala Cys Leu Val Lys Glu Phe Tyr Pro Lys Asp

450 455 460

Ile Arg Ile Asn Leu Val Ser Ser Lys Lys Ile Thr Glu Phe Asp Pro

465 470 475 480

Ala Ile Val Ile Ser Pro Ser Gly Lys Tyr Asn Ala Val Lys Leu Gly

485 490 495

Lys Tyr Glu Asp Ser Asn Ser Val Thr Cys Ser Val Gln His Asp Asn

500 505 510

Lys Thr Val His Ser Thr Asp Phe Glu Val Lys Thr Asp Ser Thr Asp

515 520 525

His Val Lys Pro Lys Glu Thr Glu Asn Thr Lys Gln Pro Ser Lys Ser

530 535 540

Cys His Lys Pro Lys Ala Ile Val His Thr Glu Lys Xaa Gly Ser Gly

545 550 555 560

Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro

565 570 575

Gly Pro Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro

580 585 590

His Pro Ala Phe Leu Leu Ile Pro Ile Gln Met Thr Gln Ser Pro Ser

595 600605

Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala

610 615 620

Ser Gln Ser Ile Arg Asn Tyr Leu Asn Trp Tyr Gln Gln Glu Pro Gly

625 630 635 640

Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser Gly

645 650 655

Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Ile Leu

660 665 670

Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln

675 680 685

Gln Ser Tyr Val Thr Pro Leu Thr Phe Gly Gly Gly Gly Ser Gly Gly

690 695 700

Gly Gly Ser Gly Gly Gly Gly Ser Gln Pro Gly Gly Ser Leu Arg Leu

705 710 715 720

Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Lys Tyr Asp Met Leu Trp

725 730 735

Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Tyr Ile Tyr

740 745 750

Pro Ser Gly Gly Leu Thr Glu Tyr Ala Asp Ser Val Lys Gly Arg Phe

755 760765

Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn

770 775 780

Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Arg Ala

785 790 795 800

Pro Arg Ser Leu Ser Phe Asp Ile Trp Gly Gln Gly Thr Met Val Thr

805 810 815

Val Ser Pro Lys Leu Gly Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg

820 825 830

Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg

835 840 845

Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly

850 855 860

Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr

865 870 875 880

Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Lys Arg Gly

885 890 895

Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val

900 905 910

Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu

915 920925

Glu Glu Gly Gly Cys Glu Leu Arg Leu Val Pro Arg Gly Arg Gly Ala

930 935 940

Ala Glu Ala Ala Thr Arg Lys Gln Arg Ile Thr Glu Thr Glu Ser Pro

945 950 955 960

Tyr Gln Glu Leu Gln Gly Gln Arg Ser Asp Val Tyr Ser Asp Leu Asn

965 970 975

Thr Gln Arg Pro Tyr Tyr Lys

980

<210>6

<211>2949

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg 60

atcccaatgc tgtcactgct ccacgcatca acgctggcag tccttggggc tctgtgtgta 120

tatggtgcag gtcacctaga gcaacctcaa atttccagta ctaaaacgct gtcaaaaaca 180

gcccgcctgg aatgtgtggt gtctggaata acaatttctg caacatctgt atattggtat 240

cgagagagac ctggtgaagt catacagttc ctggtgtcca tttcatatga cggcactgtc 300

agaaaggaat ccggcattcc gtcaggcaaa tttgaggtgg ataggatacc tgaaacgtct 360

acatccactc tcaccattca caatgtagag aaacaggaca tagctaccta ctactgtgcc 420

ttgtgggagg cccagcaaga gttgggcaaa aaaatcaagg tatttggtcc cggaacaaag 480

cttatcatta cagataaaca acttgatgca gatgtttccc ccaagcccac tatttttctt 540

ccttcaattg ctgaaacaaa gctccagaag gctggaacat acctttgtct tcttgagaaa 600

tttttccctg atgttattaa gatacattgg gaagaaaaga agagcaacac gattctggga 660

tcccaggagg ggaacaccat gaagactaat gacacataca tgaaatttag ctggttaacg 720

gtgccagaaa agtcactgga caaagaacac agatgtatcg tcagacatga gaataataaa 780

aacggagttg atcaagaaat tatctttcct ccaataaaga cagatgtcat cacaatggat 840

cccaaagaca attgttcaaa agatgcaaat gatacactac tgctgcagat gcagaggatc 900

tcctccctca tccatctctc tctcttctgg gcaggagtca tgtcagccat tgagttggtg 960

cctgaacacc aaacagtgcc tgtgtcaata ggggtccctg ccaccctcag gtgctccatg 1020

aaaggagaag cgatcggtaa ctactatatc aactggtaca ggaagaccca aggtaacaca 1080

atgactttca tataccgaga aaaggacatc tatggccctg gtttcaaaga caatttccaa 1140

ggtgacattg atattgcaaa gaacctggct gtacttaaga tacttgcacc atcagagaga 1200

gatgaagggt cttactactg tgcctgtgac accttgggga tgggggggga atacaccgat 1260

aaactcatct ttggaaaagg aacccgtgtg actgtggaac caagaagtca gcctcatacc 1320

aaaccatccg tttttgtcat gaaaaatgga acaaatgtcg cttgtctggt gaaggaattc 1380

taccccaagg atataagaat aaatctcgtg tcatccaaga agataacaga gtttgatcct 1440

gctattgtca tctctcccag tgggaagtac aatgctgtca agcttggtaa atatgaagat 1500

tcaaattcag tgacatgttc agttcaacac gacaataaaa ctgtgcactc cactgacttt 1560

gaagtgaaga cagattctac agatcacgta aaaccaaagg aaactgaaaa cacaaagcaa 1620

ccttcaaaga gctgccataa acccaaagcc atagttcata ccgagaagta aggaagcgga 1680

gagggcagag gaagtctgct aacatgcggt gacgtcgagg agaatcctgg acctatgctt 1740

ctcctggtga caagccttct gctctgtgag ttaccacacc cagcattcct cctgatccca 1800

atccagatga cccagtctcc atcctccctg tctgcatctg taggagacag agtcaccatc 1860

acttgtcggg caagtcagag cattaggaac tatttaaatt ggtatcagca ggaaccaggg 1920

aaagccccta agctcctgat ctatgctgca tccagtttgc aaagtggggt cccatcaagg 1980

ttcagtggca gtggatctgg gacagacttc attctcacca tcagcagtct gcagcctgaa 2040

gattttgcaa cttactactg tcaacagagt tacgttaccc cgctcacttt cggtggtggt 2100

ggttctggcg gcggcggctc cggtggtggt ggatctcagc ctggtggttc tttacgtctt 2160

tcttgcgctg cttccggatt cactttctct aagtacgata tgctttgggt tcgccaagct 2220

cctggtaaag gtttggagtg ggtttcttat atctatcctt ctggtggcct tactgagtat 2280

gctgactccg ttaaaggtcg cttcactatc tctagagaca actctaagaa tactctctac 2340

ttgcagatga acagcttaag ggctgaggac acggccgtgt attactgtgc gagacgggct 2400

ccccggtccc tttcttttga tatctggggc caagggacaa tggtcaccgt ctcccccaag 2460

cttggggcga agcccaccac gacgccagcg ccgcgaccac caacaccggc gcccaccatc 2520

gcgtcgcagc ccctgtccct gcgcccagag gcgtgccggc cagcggcggg gggcgcagtg 2580

cacacgaggg ggctggactt cgcctgtgat atctacatct gggcgccctt ggccgggact 2640

tgtggggtcc ttctcctgtc actggttatc accctttaca aacggggcag aaagaaactc 2700

ctgtatatat tcaaacaacc atttatgaga ccagtacaaa ctactcaaga ggaagatggc 2760

tgtagctgcc gatttccaga agaagaagaa ggaggatgtg aactgcggct ggtccctcgg 2820

gggcgagggg ctgcggaggc agcgacccgg aaacagcgta tcactgagac cgagtcgcct 2880

tatcaggagc tccagggtca gaggtcggat gtctacagcg acctcaacac acagaggccg 2940

tattacaaa 2949

Claims

1. A multi-signal chimeric antigen receptor, which comprises a first segment, a second segment and a self-cleavage polypeptide T2A connecting the first segment and the second segment, wherein the first segment comprises a first signal peptide, a TCR gamma chain and a TCR chain which are sequentially connected, the second segment comprises a second signal peptide SP, a tumor antibody, a CD8 domain, a 41BB intracellular domain and a DAP12-ITAM domain which are sequentially connected, the N end of the self-cleavage polypeptide T2A is connected with the TCR chain, and the C end of the self-cleavage polypeptide T2A is connected with the second signal peptide SP; the amino acid sequence of the first fragment is shown as SEQ ID No.1, and the amino acid sequence of the second fragment is shown as SEQ ID No. 2.

2. The multi-signal chimeric antigen receptor according to claim 1, wherein the nucleotide sequence encoding said first fragment is shown in SEQ ID No.3 and the nucleotide sequence encoding said second fragment is shown in SEQ ID No. 4.

3. The multi-signal chimeric antigen receptor of claim 1, wherein the chimeric antigen receptor is a protein consisting of the amino acid sequence shown in SEQ ID No. 5.

4. The multi-signal chimeric antigen receptor of claim 1 or 3, wherein the chimeric antigen receptor is a protein encoded by the nucleotide sequence shown in SEQ ID No. 6.

5. An expression gene for expressing a multi-signal chimeric antigen receptor, wherein the multi-signal chimeric antigen receptor comprises a first segment, a second segment and a self-cleavage polypeptide T2A connecting the first segment and the second segment, the first segment comprises a first signal peptide, a TCR gamma chain and a TCR chain which are sequentially connected, the second segment comprises a second signal peptide SP, a tumor antibody, a CD8 domain, a 41BB intracellular domain and a DAP12-ITAM domain which are sequentially connected, the N end of the self-cleavage polypeptide T2A is connected with the TCR chain, the C end of the self-cleavage polypeptide T2A is connected with the second signal peptide SP, and the expression gene is a nucleotide sequence shown as SEQ ID No. 6.

6. An expression vector comprising the expressible gene of claim 5.

7. A multi-signal chimeric antigen receptor-modified NK cell, wherein the chimeric antigen receptor according to any one of claims 1 to 4 is expressed in the NK cell, or the expression gene according to claim 5 is introduced into the NK cell, or the expression vector according to claim 6 is transfected into the NK cell.

8. Use of the chimeric antigen receptor of any one of claims 1 to 4, the expressed gene of claim 5, the expression vector of claim 6, or the multi-signal chimeric antigen receptor-modified NK cell of claim 7 in the preparation of a medicament for the treatment of liver cancer.