CN108304932B

CN108304932B - Construction of logic gate based on silver nanocluster and application of logic gate in intelligent detection

Info

Publication number: CN108304932B
Application number: CN201810109764.2A
Authority: CN
Inventors: 张思奇; 韩得满
Original assignee: Taizhou University
Current assignee: Taizhou University
Priority date: 2018-02-05
Filing date: 2018-02-05
Publication date: 2020-04-21
Anticipated expiration: 2038-02-05
Also published as: CN108304932A

Abstract

The invention belongs to the technical field of molecular logic gates of analytical chemistry, and relates to establishment of a marker-free, high-sensitivity and high-selectivity miRNA intelligent detection method. The molecular logic gate is constructed on the basis of silver nanoclusters and graphene oxide, the relative value of fluorescence intensity of the silver nanoclusters is used as a judgment basis, when the relative fluorescence intensity is greater than 0.5, the output is '1', and when the relative fluorescence intensity is less than 0.5, the output is '0'. The molecular logic gate comprises an OR logic gate and an INHIBIT logic gate, and can be used for testing whether two different miRNAs (miR-21 and miR-141) exist in an actual sample respectively. The logical detection method can identify the content of a plurality of target analytes in a complex biological sample, and has potential application value in the aspects of early diagnosis, multiplex detection, clinical treatment and the like of major diseases.

Description

Construction of logic gate based on silver nanocluster and application of logic gate in intelligent detection

Technical Field

The invention belongs to the technical field of molecular logic gates of analytical chemistry, and relates to establishment of a marker-free, high-sensitivity and high-selectivity miRNA intelligent detection method.

Background

Molecular devices were proposed in the 80's of the 20 th century, mainly relating to two fields: molecular scale based devices and molecular material based devices. Among them, the device based on molecular scale is one of several hot areas which are the most active and widely studied at present. The molecular device is important for the development of miniaturization of analytical chemistry instruments, has the characteristics of low cost, quick reaction and the like, and is favorable for the development of portable instruments so as to achieve the aim of real-time and on-line detection. The molecular device mainly comprises a molecular rectifier, a molecular memory, a molecular motor, a molecular logic gate and the like. The intelligent processing of analysis signals is mainly carried out by utilizing a molecular logic gate and a biosensor.

Due to the excellent molecular recognition ability of DNA, DNA-based molecular logic devices have also been developed in the fields of disease diagnosis, biosensing, and the like. An important advantage of the DNA molecular logic gate is that it can generate a response signal to a low concentration of target, thereby completing the detection. However, it is rare to build label-free logic sensors based on molecular level, because the logic sensors need to combine a plurality of logic gates, and the construction process is complicated. The logic sensor can realize the multi-element detection of different target objects in the same sample, and has important significance for promoting the application of molecular logic gates in analytical chemistry. However, until now, only a few examples of molecular logic devices have achieved multiplexed detection of target molecules. A multiple logic gate based on OR and INHIBIT is constructed by utilizing graphene oxide and silver nanoclusters, the multiple intelligent detection of two different miRNAs (miR-21 and miR-141) is realized for the first time, and compared with a traditional sensor, the multiple intelligent detection sensor can detect the existence of multiple analytes and carry out complex logic analysis.

Disclosure of Invention

The invention aims to provide a label-free multi-molecular logic gate based on silver nanoclusters and graphene oxide and application of the logic device in miRNA multi-element intelligent detection. The multiple logic gates of the OR and INHIBIT cascades are combinational logic circuits used for testing whether two different miRNAs (miR-21 and miR-141) exist in actual samples respectively. This logical detection method allows for the identification of the amount of multiple analytes of interest in a complex biological sample.

The invention is realized in such a way that a combinational logic circuit for identifying whether two different miRNAs (miR-21 and miR-141) exist in an actual sample respectively comprises the following steps:

preparation of DNA-stabilized silver nanoclusters: dissolving Ag-DNA1 or Ag-DNA2 serving as a template of the silver nanocluster in a buffer solution of sodium phosphate, heating to 90 ℃, annealing, and cooling to room temperature. Adding 1mM silver ion into the solution, shaking, standing for 30min, and adding NaBH₄And reducing the silver ions, shaking vigorously for 1min again, and storing overnight in a dark place. And obtaining a light yellow silver nanocluster solution protected by DNA after the reaction is completed.

2. Constructing a molecular logic platform based on silver nanoclusters and graphene oxide: the silver nanoclusters protected by 100nM Ag-DNA1 and 100 nAg-DNA 2 are mixed with 15 mug/mL graphene oxide for 15 minutes to serve as a logic operation platform.

Construction of OR logic gates: and (3) adding miR-21 and miR-141 with different combinations to construct an OR logic gate by taking a molecular logic platform as a substrate. When nucleic acid sequences (miR-21 and miR-141) are added, the input is "1", otherwise "0". And (3) judging whether the relative fluorescence intensity value is greater than 0.5 or not, wherein the output is 1 when the relative fluorescence intensity is greater than 0.5, and the output is 0 when the relative fluorescence intensity is less than 0.5. miR-21 and miR-141 can construct an OR logic gate on a molecular logic platform. When any one of miR-21 or miR-141 is input, the output signal is 1.

4. Construction of INHIBIT logic gate based on miR-21 and P1: a molecular logic platform is used as a substrate, and miR-21 and P1 in different combinations are added to construct an INHIBIT logic gate. miR-21 and P1 can construct an INHIBIT logic gate on a molecular logic platform. When P1 is input, the output signal is '0' regardless of whether miR-21 is input in the system at the same time. Only when miR-21 is input into the system but not P1 is input into the system, the output signal is '1'.

5. Construction of INHIBIT logic gate based on miR-141 and P2: a molecular logic platform is used as a substrate, and miR-141 and P2 in different combinations are added to construct an INHIBIT logic gate. miR-141 and P2 can construct an INHIBIT logic gate on a molecular logic platform. When P2 is input, the output signal is '0' regardless of whether miR-141 is input in the system at the same time. Only when miR-141 is input into the system but not P2 is input, the output signal is '1'.

Multivariate detection of miRNA: to be able to determine whether two different mirnas (miR-21 and miR-141) were present in the sample, respectively, we divided the same sample into four portions. Firstly, four identical samples are respectively added into a GO/Ag-DNA1/Ag-DNA2 molecular logic platform and are marked as sample 1, sample 2, sample 3 and sample 4. For the first sample, no further input was added. For the second sample, 1 μ M P1 was added. For the third sample, 1 μ M P2 was added. For the fourth sample, 1 μ M P1 and 1 μ M P2 were added. And (3) outputting '1' and '0' according to the relative fluorescence intensity values of the samples 1, 2, 3 and 4, and judging whether miR-21 and miR-141 exist in the samples by using a truth table.

Drawings

FIG. 1(A) is a schematic diagram of an OR logic gate. (B) Fluorescence spectra of OR logic gates. (C) Relative fluorescence intensity histogram of OR logic gate. (D) A truth table of OR logic gates;

FIG. 2(A) is a schematic diagram of the construction of an INHIBIT logic gate based on miR-21 and P1. (B) Fluorescence spectra of the INHIBIT logic gate based on miR-21 and P1. (C) Relative fluorescence intensity histograms for miR-21 and P1 based INHIBIT logic gates. (D) Truth table of INHIBIT logic gate;

FIG. 3(A) is a schematic diagram of the construction of INHIBIT logic gate based on miR-141 and P2. (B) Fluorescence spectra of the INHIBIT logic gate based on miR-141 and P2. (C) Relative fluorescence intensity histograms for miR-141 and P2-based INHIBIT logic gates. (D) Truth table of INHIBIT logic gate;

FIG. 4(A) schematic of the INHIBIT-OR cascade logic gate for the intelligent detection of miR-21 and miR-141. (B) Truth table of INHIBIT-OR cascaded logic gates. "\" means that this situation is negligible;

Detailed Description

The present invention will be further described with reference to the following examples, which are only for illustrating the technical solutions of the present invention and are not to be construed as limiting the present invention.

Example 1

Preparing silver nanoclusters: mu.M Ag-DNA1 or Ag-DNA2 was dissolved in a buffered sodium phosphate solution (10mM Na)₂HPO₄/NaH₂PO₄,100mM CH₃COONa,5mM Mg(CH₃COO)₂pH 7.5), then heated at 90 ℃ for 10 minutes, then slowly cooled to room temperature. Then 30 μ M AgNO was added₃Adding into 5 μ M Ag-DNA1 or Ag-DNA2 solution, mixing, and standing for 30min in dark to make Ag⁺Ions react well with C bases. Finally, 30. mu.M NaBH was added again to the buffer system₄The solution was shaken vigorously for 1 minute. And reacting at 4 ℃ in a dark place overnight to obtain the fluorescent silver nanocluster.

Example 2

Constructing an OR logic gate based on the silver nanoclusters and the graphene oxide: and (3) adding miR-21 and miR-141 with different combinations to construct an OR logic gate by taking a molecular logic platform as a substrate. When nucleic acid sequences (miR-21 and miR-141) are added, the input is "1", otherwise "0". And (3) judging whether the relative fluorescence intensity value is greater than 0.5 or not, wherein the output is 1 when the relative fluorescence intensity is greater than 0.5, and the output is 0 when the relative fluorescence intensity is less than 0.5. When there is no input, the fluorescence of the silver nanoclusters is quenched by graphene oxide, and the relative fluorescence intensity is less than 0.5, which is recorded as output of "0". Due to the fact that sequences of miR-21 and Ag-DNA1 are partially complementary, when miR-21 is added, Ag-DNA1 and miR-21 are hybridized to form a DNA/RNA double-stranded structure, and the double-stranded structure is detached from the surface of graphene oxide. Therefore, the silver nanoclusters protected by the Ag-DNA1 can also leave the surface of the graphene oxide, the fluorescence intensity is enhanced, the relative fluorescence intensity is greater than 0.5, and the output is recorded as 1. Similarly, due to the fact that sequences of the miR-141 and the Ag-DNA2 are partially complementary, when the miR-141 is added, the Ag-DNA2 and the miR-141 are hybridized to form a DNA/RNA double-stranded structure, and the double-stranded structure is desorbed from the surface of the graphene oxide. Therefore, the silver nanoclusters protected by the Ag-DNA2 can also leave the surface of the graphene oxide, the fluorescence intensity is enhanced, the relative fluorescence intensity is greater than 0.5, and the output is recorded as 1. Certainly, when the silver nano-cluster and the graphene oxide coexist, the silver nano-cluster protected by the Ag-DNA1 and the silver nano-cluster protected by the Ag-DNA2 are desorbed from the surface of the graphene oxide, the relative fluorescence intensity is greater than 0.5, and the output is recorded as 1. Therefore, miR-21 and miR-141 can construct an OR logic gate on a molecular logic platform. When the platform inputs any one value of miR-21 or miR-141, the output signal is 1.

Example 3

Construction of INHIBIT logic gate based on miR-21 and P1: a molecular logic platform is used as a substrate, and miR-21 and P1 in different combinations are added to construct an INHIBIT logic gate. When the nucleic acid sequences (miR-21 and P1) were added, the input was noted as "1", otherwise it was "0". And (3) judging whether the relative fluorescence intensity value is greater than 0.5 or not, wherein the output is 1 when the relative fluorescence intensity is greater than 0.5, and the output is 0 when the relative fluorescence intensity is less than 0.5. When there is no input, the fluorescence of the silver nanoclusters is quenched by graphene oxide, and the relative fluorescence intensity is less than 0.5, which is recorded as output of "0". Due to the fact that sequences of miR-21 and Ag-DNA1 are partially complementary, when miR-21 is added, Ag-DNA1 and miR-21 are hybridized to form a DNA/RNA double-stranded structure, and the double-stranded structure is detached from the surface of graphene oxide. Therefore, the silver nanoclusters protected by the Ag-DNA1 can also leave the surface of the graphene oxide, the fluorescence intensity is enhanced, the relative fluorescence intensity is greater than 0.5, and the output is recorded as 1. And P1, Ag-DNA1 and Ag-DNA2 do not have enough complementary bases, so that when P1 is added, P1 and other DNAs do not undergo a hybridization reaction, so that silver nanoclusters cannot leave the surface of the graphene oxide, a fluorescence signal is unchanged, the relative fluorescence intensity is less than 0.5, and the output is recorded as 0. Of course, in the presence of both miR-21 and P1, miR-21 and P1 will preferentially hybridize because miR-21 and P1 are completely complementary, so that Ag-DNA1 cannot hybridize with miR-21. Therefore, the silver nanoclusters can not leave the surface of the graphene oxide, the fluorescence signal is unchanged, the relative fluorescence intensity is less than 0.5, and the output is recorded as 0. Therefore, miR-21 and P1 can construct an INHIBIT logic gate on a molecular logic platform.

Example 4

Construction of INHIBIT logic gate based on miR-141 and P2: a molecular logic platform is used as a substrate, and miR-141 and P2 in different combinations are added to construct an INHIBIT logic gate. When the nucleic acid sequences (miR-141 and P2) were added, the input was noted as "1", otherwise it was "0". And (3) judging whether the relative fluorescence intensity value is greater than 0.5 or not, wherein the output is 1 when the relative fluorescence intensity is greater than 0.5, and the output is 0 when the relative fluorescence intensity is less than 0.5. When there is no input, the fluorescence of the silver nanoclusters is quenched by graphene oxide, and the relative fluorescence intensity is less than 0.5, which is recorded as output of "0". Due to the fact that sequences of the miR-141 and the Ag-DNA2 are partially complementary, when the miR-141 is added, the Ag-DNA2 and the miR-141 are hybridized to form a DNA/RNA double-stranded structure, and the double-stranded structure is detached from the surface of the graphene oxide. Therefore, the silver nanoclusters protected by the Ag-DNA2 can also leave the surface of the graphene oxide, the fluorescence intensity is enhanced, the relative fluorescence intensity is greater than 0.5, and the output is recorded as 1. And P2, Ag-DNA1 and Ag-DNA2 do not have enough complementary bases, so that when P2 is added, P2 and other DNAs do not undergo a hybridization reaction, so that silver nanoclusters cannot leave the surface of the graphene oxide, a fluorescence signal is unchanged, the relative fluorescence intensity is less than 0.5, and the output is recorded as 0. Of course, when miR-141 and P2 exist at the same time, miR-141 and P2 can be hybridized preferentially because miR-141 and P2 are completely complementary, so that Ag-DNA2 cannot be hybridized with miR-141. Therefore, the silver nanoclusters can not leave the surface of the graphene oxide, the fluorescence signal is unchanged, the relative fluorescence intensity is less than 0.5, and the output is recorded as 0. Therefore, miR-141 and P2 can construct an INHIBIT logic gate on a molecular logic platform.

The OR and INHIBIT logic gates constructed in the embodiment are applied to the intelligent detection of multiple miRNAs in the same sample, and the specific operation method and the result are as follows:

application example 1

In order to be able to determine whether two different mirnas (miR-21 and miR-141) are present in a sample, respectively, we need to use an INHIBIT-OR cascade logic gate to complete signal output. First, we divided the same sample (raw sample) into four. Then, four identical samples (original samples) were added to the GO/Ag-DNA1/Ag-DNA2 molecular logic platform and labeled as sample 1, sample 2, sample 3, and sample 4, respectively. For the first sample, no further input was added. For the second sample, 1 μ MP1 was added. For the third sample, 1 μ M P2 was added. For the fourth sample, 1 μ M P1 and 1 μ M P2 were added. When the first sample has no obvious fluorescence signal, we can consider that no miR-21 and miR-141 exist in the original sample, and the test is finished. If the first sample generates a fluorescent signal, the original sample contains at least one of miR-21 and miR-141. So we performed a fluorescence test on the second sample. If the second sample does not generate a fluorescent signal, the original sample contains miR-21, because the second sample is added with more P1 than the first sample, so that the miR-21 in the original sample is inhibited and cannot be hybridized to generate the fluorescent signal. If the second still has a fluorescence signal, the original sample at least contains miR-141. We need to further test whether the original sample contains only miR-141. This requires a fluorescence test on the third sample, which indicates that the original sample contains only miR-141 if the third sample does not produce a fluorescence signal. This is because the third sample contains more P2 than the first sample, and miR-141 in the original sample is inhibited by P2, and cannot hybridize to generate a fluorescent signal. If the third sample still has a fluorescence signal, the original sample contains two miRNAs of miR-21 and miR-141. Thus, the fluorescence signal was quenched only when both P1 and P2 were added (see fourth sample). The specific truth table is shown in fig. 4B. The detection method combined with logic provides a good conceptual model for the intelligent detection aspect of analytical chemistry.

Claims

1. The construction of the logic gate of the silver nanocluster and the application of the logic gate in intelligent detection are characterized in that the molecular logic gate is constructed on the basis of the principle that the silver nanocluster is subjected to fluorescence quenching after being contacted with graphene oxide and is subjected to fluorescence recovery after being hybridized to form a double chain, the relative value of the fluorescence intensity of the silver nanocluster is taken as a judgment basis, when the relative fluorescence intensity is greater than 0.5, the output is '1', when the relative fluorescence intensity is less than 0.5, the output is '0', the molecular logic gate comprises an OR logic gate, an INHIBIT logic gate and a cascade logic gate formed by connecting the OR logic gate and the INHIBIT logic gate in series, and is applied to logic detection;

(1) OR logic gate: mixing the silver nanoclusters protected by 100nMAG-DNA1 and 100nMAG-DNA2 with 15 mu g/mL graphene oxide for 15 minutes to serve as a logic operation platform, and constructing an OR logic gate by taking RNA chains miR-21 and miR-141 as input signals and the fluorescence intensity of the silver nanoclusters as output signals;

(2) INHIBIT logic gate based on miR-21 and P1: taking the mixed solution of the silver nanoclusters and the graphene oxide used in the step (1) as a molecular logic platform, taking RNA/DNA (ribonucleic acid/deoxyribonucleic acid) chains miR-21 and P1 as input signals, and taking fluorescence intensity as an output signal to construct an INHIBIT logic gate;

(3) an INHIBIT logic gate based on miR-141 and P2: taking the mixed solution of the silver nanoclusters and the graphene oxide used in the step (1) as a molecular logic platform, taking RNA/DNA (ribonucleic acid/deoxyribonucleic acid) chains miR-141 and P2 as input signals, and taking fluorescence intensity as an output signal to construct an INHIBIT logic gate;

(4) multivariate detection of miRNA: judging whether two different miRNAs (miR-21 and miR-141) exist in the sample by using an INHIBIT-OR cascade logic gate, respectively outputting '1' and '0' according to the relative fluorescence intensity value of the sample, and judging whether the miR-21 and miR-141 exist in the sample by using a truth table;

(5) in the construction of the logic gate, the required DNA sequences are as follows:

Ag-DNA1:TGAACATCAGACTGATAACCTAATCCCCCCCCCCCC

Ag-DNA2:CGATCTTTACCTGACAGTCTTAATCCCCCCCCCCCC

P1:TCAACATCAGTCTGATAAGCTA

P2:CCATCTTTACCAGACAGTGTTA

miR-21:UAGCUUAUCAGACUGAUGUUGA

miR-141:UAACACUGUCUGGUAAAGAUGG。

2. the logic gate of claim 1, wherein the ratio of the concentration of input oligonucleotide strands (miR-21, miR-141, P1 and P2) to the concentration of Ag-DNA1/Ag-DNA2 is 10: 1.

3. The silver nanocluster-based molecular logic device of claim 1 can realize a logic detection function for miRNA.