CN108300761A

CN108300761A - A kind of method of miR-574-5p target genes screening

Info

Publication number: CN108300761A
Application number: CN201810193251.4A
Authority: CN
Inventors: 侯金星; 安小鹏; 曹斌云; 宋宇轩; 李广; 王建刚; 刘育含
Original assignee: Northwest A&F University; Yangling Vocational and Technical College
Current assignee: Northwest A&F University; Yangling Vocational and Technical College
Priority date: 2018-03-09
Filing date: 2018-03-09
Publication date: 2018-07-20

Abstract

The invention discloses a kind of methods of screening 574 5p target genes of miR, and this method is using goat genomic dna sequence as template, in Taq archaeal dna polymerases, buffer environment, Mg²⁺, in the presence of dNTPs, the areas amplification MAP3K9 gene 3'UTR are carried out under the conditions of PCR using MAP3K9 primers；Dual-luciferase reportor systerm is built, uciferase activity is detected, the results show that 574 5p of miR reduce the activity of luciferase, primarily determines that MAP3K9 is the target gene of 574 5p of miR；Using 574 5p of RT qPCR and Western blot method validations miR to MAP3K9 genes mRNA and protein expression influence.As a result it shows：574 5p of miR can inhibit expression of the MAP3K9 genes on mRNA and protein level, further determine that 574 5p of miR can be combined with MAP3K93'UTR, MAP3K9 is the target gene of 574 5p of miR, is laid a good foundation for further influences of research 574 5p of miR to milch goat mammogenesis and lactation function.

Description

A kind of method of miR-574-5p target genes screening

Technical field

The invention belongs to molecular biology fields, are related to molecular cloning, RT-qPCR and Western blot detection techniques, More particularly to a kind of miR-574-5p target genes screening method, this method mainly by build Dual-Luciferase report carrier, The target gene of miR-574-5p is sought and verified with Modern Molecular Biotechnology.

Background technology

MiRNA is a kind of shorter (21-23 nucleotide), evolution conservative, non-coding RNA molecule, has transcription The function of controlling gene expression afterwards, is found in Caenorhabditis elegans, can pass through the 3' non-codings with target gene for the first time (UTR) it combines, mRNA is inhibited to translate into albumen.The regulation and control of miRNA are considerably complicated, each miRNA can be logical by different signals Road regulates and controls multiple target genes, and each target gene may be adjusted by several miRNA simultaneously.MiRNA is as a kind of important Regulatory factor is widely present in animal body, regulates and controls the expression of about 1/3 gene in animal body, is sent out in mammalian growth It educates, play important adjustment effect in the vital movements such as cell differentiation, cell Proliferation, Apoptosis, intracellular environment stable state, grind Study carefully and shows that miRNA has weight by the expression for regulating and controlling target gene to the growth and development of galactophore epithelial cell and the adjusting of lactation function It acts on.

Ripe miRNA is attached to after RISC, its function in vivo is played by two ways：

(1) miRNA and target gene mRNA exactly matches complementary pairing, target gene of degrading, to the expression of suppressor. In plant, almost all miRNA is the expression for carrying out suppressor in this way, this is also animal and plant Important difference between miRNA, and the binding site of miRNA and target gene is not limited solely in 3'UTR in plant, The transcript regions of target gene can also be combined.

(2) miRNA inhibits the table of mRNA genes in translation process by being combined with the not fully complementary pairing of target gene It reaches, to preventing gene to form functional protein from normal accurate translation, gene expression regulation is achieved the purpose that with this.This be Main regulative mode in animal body matches the adjusting to target gene of degrading there certainly exist mRNA and target gene complete complementary Mode.

The study found that most of miRNA by make its said target mrna Translational repression or degradation come inhibition of gene expression. MiRNA is combined with target gene, is sent out in a variety of bioprocess such as Apoptosis, proliferation, metabolism, differentiation, metastases, development Wave important role.The target gene for fast and accurately identifying miRNA, for the interaction between research miRNA and target gene The bioprocess of relationship and participation and the effect played in signal path have prodigious researching value.Research at present The method of miRNA mainly has bioinformatics method and BiologicalAssays Procedures.

Animal sources miRNA is mainly combined by the 3'UTR base complementrities with target gene mRNA, to regulate and control the table of target gene Reach, therefore the target site of animal sources miRNA is predominantly located at the 3'UTR of target gene mRNA, at the same these regions usually contain it is multiple Multiple target sites of miRNA, these target sites often have conservative between species, and without apparent secondary structure.It finds at present The method of miRNA target genes mainly has bioinformatics and BIOLOGICAL TEST METHODS.Bioinformatics method is mainly using The rule being mutually matched through determining miRNA sequence and their target-gene sequence designs according to several principles of biology and has Targetedly software carries out, such as TargetScan, miRanda, RNAhybrid, TargetScanS, PicTar, DIANA- The softwares such as microT, FindTar and RNA22.The method of bioinformatics provides possibility simply by algorithm for researcher Maximum reference information, it is also necessary to by being verified.Interaction between miRNA and target gene has certain rule Property.

Conventional algorithm mainly follows following common principle at present：

(1) complementarity of miRNA and target gene；

(2) conservative of the miRNA target sites between different plant species；

(3) thermal stability between miRNA-mRNA double-strands；

(4) miRNA target sites do not have complicated secondary structure；

(5) ends 5' of miRNA and the binding ability of target gene are better than the ends 3'.

Other than these basic principles, different prediction techniques can also limit algorithm according to the rule respectively summarized System and optimization.

In the presence of very high false positive when due to calculating prediction miRNA target genes, it is therefore necessary to utilize the side of biological experiment Method verifies the target gene of prediction.Most common experimental method is the work using Dual-Luciferase system detectio luciferase Property, and the variation of target gene mRNA level in-site and protein level is detected using quantitative fluorescent PCR and Western blot methods respectively, So that it is determined that the correspondence of miRNA and target gene, or the target gene using Immunoprecipitation screening miRNA.

Mitogen-activated protein kinase (MAPK) kinase kinase 9 (MAP3K9) is a member in MAP3K families, and overall length has 1104 amino acid, by SRC-HOMOLOGY-3 (SH3) structural domain, serine/threonine kinase structural domain and CRIB (Cdc42/ Rac interactive binding) structural domain composition.MAP3K9 is the kinase molecule of most upstream in MAPK signal pathways, it It can receive the multi-signal on cell-membrane receptor, activate the MAP2K in downstream, the MAP2K of activation activates MAPK downstream again, most MAPK signal paths in whole active cell adjust various physiological processes in cell.

Invention content

The object of the present invention is to provide the method using a kind of screening of miR-574-5p target genes, this method is mainly adopted With the tune between molecular cloning, RT-qPCR and Western blot detection techniques verification miR-574-5p and target gene MAP3K9 Control relationship.

In order to realize that above-mentioned task, the present invention take following technical solution：

A kind of method of miR-574-5p target genes screening, which is characterized in that include the following steps：

1) using goat genomic DNA as template, in Taq archaeal dna polymerases, buffer environment, Mg²⁺, dNTPs there are the case where Under, it is expanded under the conditions of PCR using primer MAP3K9, determines that obtained PCR product is the sequence in the areas MAP3K9 gene 3'UTR Row；

2) Dual-luciferase reportor systerm is built, uciferase activity, the target gene of Preliminary Identification miR-574-5p are detected；

3) use RT-qPCR methods detection miR-574-5p to MAP3K9 genes mRNA level in-site influence；

4) use Western blot methods detection miR-574-5p to MAP3K9 genes protein level influence.

According to the present invention, in step 1), the primer MAP3K9 is as follows, and underscore therein is XhoI and NotI The restriction enzyme site of restriction endonuclease；

Sense primer F：5'-CGGCTCGAGCCCATCTCCAGCTCCTTTCC-3'；

Downstream primer R：5'-TTGCGGCCGCTCCTCTCTGCACCTGCTACT-3'。

The condition of the PCR amplification is：

15 μ L reaction systems, including DNA profiling 0.5 μ l, the sense primer F of the MasterMix of 7.5 μ l, primer MAP3K9 With each 0.5 μ l of downstream primer R, add aqua sterilisa to 15 μ l；

Described is using the PCR response procedures of primer MAP3K9：94 DEG C of pre-degeneration 4min, 94 DEG C are denaturalized 30s, annealing temperature Degree is 60 DEG C, and annealing time 30s, 72 DEG C of extension 30s carry out 30 cycles altogether, and last 72 DEG C fully extend 10min, 4 DEG C of guarantors It deposits.

Further, in step 2), the structure Dual-luciferase reportor systerm detects uciferase activity, tentatively Identify that the specific method of the target gene of miR-574-5p is：

Wild type and saltant type reporter plasmid are built respectively；

The 293T cells for collecting exponential phase respectively will according to liposome Lipofectamine2000 transfections specification MiR-574-5p analogies, negative control and MAP3K9 luciferase reporter vector corotation enter 293T cells, are divided into 4 groups：It is wild Type+miR-574-5p analogies, wild type+negative control, saltant type+miR-574-5p analogies and saltant type+negative control；

After culture for 24 hours, the intensity of different group firefly luciferases and renilla luciferase is detected, with firefly fluorescence The activity of plain enzyme and the ratio calculation relative fluorescence element enzyme of renilla luciferase intensity.

In step 3), using RT-qPCR methods detect miR-574-5p to MAP3K9 genes the influence of mRNA level in-site tool Body method is：

According to GenBank goat MAP3K9 genes, i.e. XM_018054019.1 and the i.e. NM_ of reference gene β-actin 001314342.1 mRNA sequence designs the real-time quantitative primer of MAP3K9 genes and reference gene β-actin, will be negative right It is transferred to galactophore epithelial cell according to miR-574-5p analogies, RNA is extracted in culture afterwards for 24 hours, is then carried out reverse transcription and is obtained cDNA, The mRNA relative expression quantities of MAP3K9 genes are detected by real-time quantitative PCR；

The MAP3K9 gene real-time quantitative primers are as follows：

Sense primer F：5'-TGAAGCTCAAGGACGGAAAT-3'；

Downstream primer R：5'-CGCCTGGTGTCAACTGGATG-3'.

Reference gene β-actin real-time quantitative the primers are as follows：

Sense primer F：5'-GCAAGTTCCACGGCACAG-3'；

Downstream primer R：5'-GGTTCACGCCCATCACAA-3'.

The condition of the reverse transcription is：

20 μ L reaction systems include：5 × Prime Script Buffer of the Reaction solution, 4 μ l of 10 μ l, Prime Script RT Enzyme Mix I and RT Prime each 1 μ l of Mix, add aqua sterilisa to 20 μ l；

The reverse transcription program is as follows：

37 DEG C of incubation 15min, 85 DEG C of incubation 5s, 4 DEG C preserve；

The condition of the RT-qPCR is：

20 μ L reaction systems：Platinum RTS SYBR Super Mix, MAP3K9 genes including 12.5 μ L and internal reference Each 1 μ L of sense primer F and downstream primer R of gene β-actin, the cDNA templates of 1 μ L add aqua sterilisa to 20 μ l；

The RT-qPCR response procedures that the utilization quantifies primer MAP3K9 are：95 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 15s, annealing temperature are 60 DEG C, and annealing time 20s, 72 DEG C of extension 20s carry out 35 cycles, 4 DEG C of preservations altogether.

MiR-574-5p is detected to MAP3K9 genes in protein level using Western blot methods described in step 4) The specific method of influence is：

Negative control and miR-574-5p analogies are transferred to galactophore epithelial cell, cell is collected after cultivating 48h, using thin Born of the same parents' protein lysate extracts total protein, and albumen concentration is detected using BCA methods；

Negative control group and miR-574-5p transfection group cell protein samples are subjected to lauryl sodium sulfate polyacrylamide Albumen in gel electrophoresis is gone to Kynoar (PVDF) film and with corresponding rabbit-anti by amine gel electrophoresis (SDS-PAGE) The goat-anti rabbit secondary antibody that MAP3K9, rabbit-anti GAPDH and HRP are marked is incubated, and is exposed, is clapped after the reaction of ECL luminescent solutions is added According to using Image J image analysis softwares to gray scale progress quantitative analysis, using β-actin as internal reference.

The method of the miR-574-5p target genes screening of the present invention has the following technical effects compared with prior art：

It specifies that the areas MAP3K9 3'UTR have the binding site with miR-574-5p, is tested using Modern Molecular Biotechnology The target target gene that MAP3K9 is miR-574-5p is demonstrate,proved, miR-574-5p can inhibit MAP3K9 genes in mRNA and albumen water Expression on flat.Further confirm that MAP3K9 is the target gene of miR-574-5p.Specify miR-574-5p and target gene The Targeted-control relationship of MAP3K9 is established for further influences of the research miR-574-5p to milch goat mammogenesis and lactation function Basis is determined.

Description of the drawings

Fig. 1 is 2% agarose gel electrophoresis figure in the areas primer MAP3K9 amplification MAP3K9 gene 3'UTR, and M1 is indicated in figure： Marker1。

Fig. 2 is Dual-Luciferase report carrier structure as a result, in figure：

A：MAP3K9-3 ' UTR double digestion gel electrophoresis figures (target fragment 210bp)；

B：Insertion position figures of the MAP3K9-3 ' UTR in psiCHECK-2 carriers；

C：MiR-574-5p target position point mutation；

Fig. 3 is miR-574-5p analogies (mimic) to wild type (MAP3K9-Wt) carrier, saltant type (MAP3K9- Mut) the influence of the uciferase activity of carrier；

Fig. 4 is MAP3K9 gene mRNA expression amounts；

Fig. 5 is MAP3K9 gene protein relative expression quantities, in figure：

A：Western Blotting testing results；

B：MAP3K9 albumen relative expression quantities；

Below by way of the structure and luciferase assays to goat sample collection and Dual-Luciferase report carrier, RT-qPCR and Western blotting analyses are implemented further to elaborate to the present invention.

Specific implementation mode

The present embodiment provides a kind of method of screening miR-574-5p target genes, includes the following steps：

The primer MAP3K9 following (underscore is the restriction enzyme site of XhoI and NotI restriction endonucleases)：

Sense primer F：5'-CGGCTCGAGCCCATCTCCAGCTCCTTTCC-3'；

Downstream primer R：5'-TTGCGGCCGCTCCTCTCTGCACCTGCTACT-3'。

The condition of the PCR amplification is：

15 μ L reaction systems, including 0.5 μ l of DNA profiling, 7.5 μ l MasterMix, each 0.5 μ l of 1 upstream and downstream primer add and go out Bacterium water is to 15 μ l；

2) Dual-luciferase reportor systerm is built, uciferase activity, the target gene of Preliminary Identification miR-574-5p are detected

Wild type (MAP3K9-Wt) and saltant type (MAP3K9-Mut) reporter plasmid is built respectively；

The 293T cells for collecting exponential phase respectively will according to liposome Lipofectamine2000 transfections specification MiR-574-5p analogies (mimic), negative control (Negative control, NC) and MAP3K9 luciferase reporter vectors Corotation enters 293T cells, is divided into 4 groups：Wild type (MAP3K9-Wt)+miR-574-5p analogies (mimic), wild type (MAP3K9-Wt)+negative control (Negative control, NC), saltant type (MAP3K9-Mut)+miR-574-5p analogies (mimic) and saltant type (MAP3K9-Mut)+negative control (Negative control, NC).

3) use RT-qPCR methods detection miR-574-5p to MAP3K9 genes mRNA level in-site influence

According to GenBank goat MAP3K9 genes (XM_018054019.1) and reference gene β-actin (NM_ 001314342.1) mRNA sequence designs the real-time quantitative primer of MAP3K9 genes and reference gene β-actin, is given birth to by Shanghai Object Engineering Co., Ltd synthesizes.

Negative control (Negative control, NC) and miR-574-5p analogies (mimic) are transferred to breast epithelium RNA is extracted in cell, culture afterwards for 24 hours, is then carried out reverse transcription and is obtained cDNA, and MAP3K9 genes are detected by real-time quantitative PCR MRNA relative expression quantities.

The MAP3K9 gene real-time quantitative primers are as follows：

Sense primer F：5'-TGAAGCTCAAGGACGGAAAT-3'；

Downstream primer R：5'-CGCCTGGTGTCAACTGGATG-3'.

Reference gene β-actin real-time quantitative the primers are as follows：

Sense primer F：5'-GCAAGTTCCACGGCACAG-3'；

Downstream primer R：5'-GGTTCACGCCCATCACAA-3'.

The condition of the reverse transcription is：

20 μ L reaction systems include 5 × Prime Script Buffer of the Reaction solution, 4 μ l of 10 μ l,

The RT Prime Mix of Prime the Script RT Enzyme Mix I and 1 μ l of 1 μ l, add aqua sterilisa to 20 μ l.

The reverse transcription program is as follows：

37 DEG C of incubation 15min, 85 DEG C of incubation 5s, 4 DEG C preserve；

The condition of the RT-qPCR is：

20 μ L reaction systems include Platinum RTS SYBR Super Mix, the MAP3K9 genes and internal reference of 12.5 μ l Each 1 μ L of sense primer F and downstream primer R of gene β-actin, the cDNA templates of 1 μ L, the cDNA templates of 1 μ l add aqua sterilisa extremely 20μl。

4) use Western blot methods detection miR-574-5p to MAP3K9 genes protein level influence

Negative control (Negative control, NC) and miR-574-5p analogies (mimic) are transferred to breast epithelium Cell collects cell after cultivating 48h, and total protein is extracted using cell protein lysate, and albumen concentration is detected using BCA methods.

Negative control (Negative control, NC) group and miR-574-5p transfection group cell protein samples are carried out ten Albumen in gel electrophoresis is gone to Kynoar by sodium dialkyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) (PVDF) it film and is incubated with the goat-anti rabbit secondary antibody of corresponding rabbit-anti MAP3K9, rabbit-anti GAPDH and HRP label, ECL is added and shines It is exposed, takes pictures after liquid reaction, quantitative analysis is carried out to gray scale using Image J image analysis softwares, is interior with β-actin Ginseng.

It is the specific embodiment that inventor provides below.

Below in an example, the conventional molecular biologicals such as digestion, connection, recycling, conversion, RNA extractions, PCR amplification Laboratory operating procedures can refer to《Molecular cloning (third edition)》.

Below in an example, primer MAP3K9 expands 2% agarose gel electrophoresis figure in the areas MAP3K9 gene 3'UTR Referring to Fig. 1, the results are shown in Figure 2 for Dual-Luciferase report carrier structure, and miR-574-5p analogies (mimic) are to wild type (MAP3K9-Wt) carrier, saltant type (MAP3K9-Mut) carrier uciferase activity influence referring to Fig. 3, MAP3K9 genes Mrna expression amount is referring to Fig. 4, and MAP3K9 gene protein relative expression quantities are referring to Fig. 5.

1, the acquisition and processing of goat sample

Breast tissue and blood sample pick up from the goat slaughterhouse of Lip river head on Yu Yangling, are put into and have gone out at once after tissue sample acquisition In the PBS solution of bacterium, blood and tissue sample are put into the bubble chamber equipped with ice bag and take back laboratory.Blood samples use ACD Anti-freezing, -20 DEG C of preservations, for extracting gene DNA, tissue sample is directly separated galactophore epithelial cell after taking back.

2, the culture of galactophore epithelial cell

(1) original cuiture of galactophore epithelial cell

Breast tissue is rinsed repeatedly with 3 times of dual anti-D-Hankk's liquid, until tissue whitens.It is removed in super-clean bench The acinar tissue of white granular is cut into about 1mm by adipose tissue and connective tissue³Size is spaced in pre- according to 1.5cm or so Be inoculated in the culture dish of processing, set 37 DEG C, the CO2 of concentration 5%, saturated humidity incubator in 20-30 minutes or so, then to It is gently added in culture dish after 1mL culture solutions continue culture 1-2 hours and mends 1ml culture solutions again, replaced within every 2 to 3 days later primary Culture solution.

(2) secondary culture of galactophore epithelial cell

When the cell growth of diameter 60mm ware cultures converges to 95% or so (about 1.6 × 10⁶-2.0×10⁶It is a) when, it will train It supports base to be sucked out, pancreatin digestive juice is added, set 37 DEG C of digestion 3-5min in incubator；It is observed under inverted microscope, waits for major part Digestive juice is sucked out when being rounded, will fall off for cell retraction, continues to place 2-3min at 37 DEG C；Culture medium is added, uses pipettor Piping and druming culture dish bottom makes most cells fall off repeatedly, and 2/3rds or so culture medium (about 0.7 × 10 is sucked out⁶-1.0× 10⁶A cell), it is inoculated into new culture dish after centrifugation or freezes；

Fresh culture is supplied in former ware to continue to cultivate.3rd day or the 4th day, cell, which can be grown, converged to 95% or so, It repeats the above process.

3, the extraction of genomic DNA

(1) it takes 290 μ l that freezing or the new blood of anti-coagulants is added, is put into 1.5ml centrifuge tubes；

(2) Proteinase K Solution of the 20mg/ml of 29 μ l is added, room temperature 15 minutes (period overturns mixing several times) is added 300 μ l mixed liquor CB, violent reverse jog, mixes well at once, and 70 DEG C are placed 10 minutes, and solution strain is limpid, and (but color is inclined Black)；

(3) 145 μ l isopropanols (outmoded blood adds 290 μ l isopropanols) are added, acutely overturns jog, mixes well, at this time may be used Flocculent deposit can be will appear.

Appropriate dynamics mixes well extremely important in above-mentioned each operating procedure, the insufficient serious reduction yield of mixing, necessary When be added that sample is sticky and can be vortexed when being not easy mixing 15 seconds mixings of concussion, but unavailable hand acutely shakes, in order to avoid shearing DNA.

(4) previous step acquired solution and flocculent deposit are all added in an adsorption column VI, (adsorption column is put into collecting pipe In) 10000rpm centrifuge 30 seconds, outwell the waste liquid in collecting pipe；

(5) 725 μ l mortifiers are added and remove IR, 12000rpm is centrifuged 30 seconds, abandons waste liquid；

(6) the rinsing liquid WB that 750 μ l are added (pays attention to please first checking whether and absolute ethyl alcohol has been added！), 12000rpm centrifugations 30 seconds, discard waste liquid.

(7) rinsing liquid WB, the 12000rpm centrifugation of 750 μ l 30 seconds is added, discards waste liquid.

(8) adsorption column VI being put back in sky collecting pipe, 13000rpm is centrifuged 2 minutes, removes rinsing liquid as possible, in order to avoid rinsing Residual ethanol inhibits downstream reaction in liquid.

(9) adsorption column VI is taken out, is put into a clean centrifuge tube, adds 70 μ l elutions slow at the intermediate position of adsorbed film Fliud flushing EB (elution buffer preheats in 65-70 DEG C of water-bath in advance), is placed at room temperature for 3-5 minutes, and 12000rpm is centrifuged 1 minute. Obtained solution is rejoined in centrifugal adsorbing column, is placed at room temperature for 2 minutes, 12000rpm is centrifuged 1 minute, -20 DEG C of preservations；

Pay attention to：Elution volume is bigger, and elution efficiency is higher, higher if necessary to DNA concentration, can suitably reduce elution body Product, but minimum volume should not be less than 50 μ l, the too small reduction DNA elution efficiencies of volume reduce DNA output.

4, the extraction of galactophore epithelial cell RNA

Galactophore epithelial cell RNA is extracted for 24 hours for transfection：12 orifice plates, PBS wash cell 1~2 time, add the RNAiso of 1ml Plus is blown and beaten 5~6 times, so that cell is all cracked, is gone to later in no enzyme centrifuge tube；5min is stood, the chlorine of 210 μ l precoolings is added It is imitative, centrifuge tube lid is covered tightly, upper and lower fully shaking 2min, until completely dissolved, room temperature stand 5min；12000rpm, 4 DEG C of centrifugations 15min；It draws in supernatant to new no enzyme pipe, middle white albumin layer is never sucked out；Isometric isopropyl is added into supernatant Alcohol mixes well up and down, and -20 DEG C of ice bath 20min centrifuge 10min under the conditions of 12000rpm, 4 DEG C.After centrifugation, RNA is in pipe Bottom is aggregated into white precipitate；Outwell supernatant, a concentration of 75% ethyl alcohol 1ml be slowly added along tube wall, gently overturn up and down from Heart pipe centrifuges 5min under conditions of 12000rpm, 4 DEG C, discards ethyl alcohol, and room temperature carries out the drying precipitated process of 10~15min, Ethyl alcohol is eliminated as possible, finally added the RNAse-free water of 25 μ l, measured concentration after dissolving to be precipitated, be put into -80 DEG C of preservations.

5,293T cell culture

(1) 293T cell recoveries

It is put into rapidly in 37 DEG C of water-baths of sterilizing from 293T is taken out in liquid nitrogen container, waits for that cell melts, be brought into iuntercellular, 1000rpm centrifuges 10min, outwells supernatant, and culture medium suspension cell again is added, is transferred in single ware with pipettor, mixing Cell is cultivated in 37 DEG C of constant incubators.The cell density that culture is needed to experiment.

(2) cell passes on

It is up to 90% single ware cell, absorbs culture solution, PBS is cleaned one time, and the pancreatin of 1ml, 37 DEG C of digestion are added Culture solutions of the 2ml containing fetal calf serum is added when cell is by adherent become round and terminates digestion, 10ml is drawn to liquid-transfering gun by 1min In centrifuge tube, 1000rpm centrifuges 10min, outwells supernatant, retains cell precipitation.Culture solution is added, again suspension cell, etc. Amount is transferred to 24 orifice plates, is cultivated in 37 DEG C of constant incubators.

6, the structure of Dual-Luciferase report carrier

According to the binding site of the miR-574-5p of prediction and the areas MAP3K9 3'UTR, milch goat MAP3K9 in NCBI is utilized Gene 3'UTR sequences are as template, and using 5.0 Software for Design upstream and downstream primers of Primer, phase is added at the ends 5' of primer sequence The restriction enzyme site answered.Using psiCHECKTM-2 carriers, corresponding restriction enzyme site is：XhoI and NotI.Primer gives birth to work by Shanghai Bio-engineering corporation synthesizes.By PCR amplification, obtain the areas MAP3K9 3'UTR, purpose piece being recycled after 1.5% agar electrophoresis Section, the target fragment of recycling is connected on pMD19-T carriers, connection product is transferred in Top10 competent cells and is cloned, so Whether sequence verification target fragment is inserted into carrier afterwards.The correct bacterium solution plasmid of sequencing result, profit are extracted using plasmid extraction reagent kit The plasmid of psiCHECK-2 empty carriers and carrier T containing MAP3K9-3'UTR is subjected to double digestion with XhoI and NotI enzymes, always Volume 100 μ l, 37 DEG C of water-bath 4h in thermostat water bath are added 10 × Loading buffer mixings of 10 μ l, digestion are produced Object carries out electrophoresis and glue recycling.The large fragment of MAP3K9-3'UTR small fragments and psiCHECK-2 that above-mentioned purifying is recycled according to 4：1 ratio is connected and is converted with T4 DNA Liase ligases, and clone, bacterium solution PCR, sequencing, result compare, finally Extract correct bacterium solution plasmid.Carrier is named as wild type (MAP3K9-Wt).According to wild type (MAP3K9-Wt) 3'UTR sequences Row, design miRNA target site 3'UTR mutant nucleotide sequences, and enzyme enzyme site XhoI and NotI serves the conjunction of marine growth Engineering Co., Ltd At mutant nucleotide sequence, for building saltant type (MAP3K9-Mut) carrier.The construction method of saltant type (MAP3K9-Mut) carrier with Wild type (MAP3K9-Wt) is identical.

Using goat genomic DNA as template, in Taq archaeal dna polymerases, buffer environment, Mg²⁺, in the presence of dNTPs, It is expanded under the conditions of PCR using primer MAP3K9, determines that obtained PCR product is the sequence in the areas MAP3K9 gene 3'UTR；

Sense primer F：5'-CGGCTCGAGCCCATCTCCAGCTCCTTTCC-3'；

Downstream primer R：5'-TTGCGGCCGCTCCTCTCTGCACCTGCTACT-3'。

The condition of the PCR amplification is：

15 μ l reaction systems：Including DNA profiling 0.5 μ l, the MasterMix of 7.5 μ l, primer MAP3K9 sense primers F and Each 0.5 μ l of downstream primer R, add aqua sterilisa to 15 μ l；

Glue recovery experiment step：

(1) electrophoresis：1.5% Ago-Gel is selected to carry out electrophoresis according to DNA fragmentation size.

(2) glue is cut：After electrophoresis, target fragment is cut rapidly in the UV lamp, remove blob of viscose edge as possible and be free of DNA Part, and blob of viscose is shredded as far as possible.

(3) it weighs：Blob of viscose is fitted into a 1.5ml centrifuge tube weighed in advance, weight is weighed, calculates glue weight.Often 700mg is not to be exceeded in blob of viscose in pipe.

(4) colloidal sol：The ratio (1 of 1 μ l film combination liquid (MB) is added in every 1mg gels：1) film combination liquid (MB) is added, mixes It is even to be placed on 55 DEG C of water-baths, it is primary at interval of 1~2 minute mixing, until blob of viscose is completely dissolved (about 5 minutes).

(5) DNA is combined：It after gel solution is cooled to room temperature, is transferred in the centrifugal adsorbing column for being inserted into collecting pipe, stands 1 minute, at room temperature >=12,000 × g was centrifuged 1 minute, and centrifugal adsorbing column is turned back to collection by the waste liquid in reject collecting pipe again Guan Zhong.

(6) it cleans：The film rinsing liquid (absolute ethyl alcohol is added in MW in advance) of 600 μ l is added in centrifugal adsorbing column, at room temperature >=12,000 × g are centrifuged 30 seconds, and the waste liquid in reject collecting pipe turns back to centrifugal adsorbing column in collecting pipe again.

(7) it cleans again：The film rinsing liquid (MW) of 600 μ l is added in centrifugal adsorbing column, at room temperature >=12,000 × g from The heart 30 seconds, the waste liquid in reject collecting pipe, centrifugal adsorbing column is turned back in collecting pipe again.By centrifugal adsorbing column uncapping again from Heart 2min thoroughly removes remaining rinsing liquid.

(8) it elutes：It is careful to take out centrifugal adsorbing column, it is inserted in a 1.5ml sterile centrifugation tube.To silica gel absorption film Center be added 30 μ l elution buffers (EB), after being stored at room temperature 1 minute, >=12,000 × g centrifuge 1 minute, collect purifying DNA fragmentation.The solution after elution can be added again after centrifugation in centrifugal adsorbing column and repeat to elute once, yield can be improved.

(9) it stores：The DNA fragmentation of acquisition is put in -20 DEG C of long-term preservations by reject centrifugal adsorbing column.

Transformed clone experimental procedure：

(1) the rigid cell suspension that melts can be dispensed into sterile precooling by competent cell as in ice bath if you need to dispense In centrifuge tube, as in ice bath.

(2) target DNA is added into competent cell suspension ,+10 μ l target DNAs of 100 μ l competent cells flick mixed It is even, 30min is stood in ice bath.

(3) centrifuge tube is placed in 60~90sec of placement in 42 DEG C of water-baths, then quickly centrifuge tube is transferred in ice bath, Cell is set to cool down 4min, which can not shake centrifuge tube.

(4) the liquid LB cultures (being free of antibiotic) of 900 μ l are added into each centrifuge tube, mixing is placed on 37 DEG C of shaking tables Shake culture 45min, it is therefore an objective to make relevant resistant maker gene expression on plasmid, thalline is made to recover.

(5) it by centrifuge tube content mixing, draws the competent cell that 100 μ l have been converted and is added to the LB containing corresponding antibiotic On solid agar medium, with sterile elbow stick gently cell is uniformly spreadable.Tablet is placed in room temperature until liquid quilt It absorbs, is inverted tablet, 37 DEG C of culture 12-16h.

Plasmid extraction experimental procedure：

(1) column equilibration：Into adsorption column CP3, (adsorption column is put into collecting pipe) is added the equilibrium liquid BL of 500 μ l, and 12, 000rpm centrifuges 1min, outwells the waste liquid in collecting pipe, adsorption column is placed back in collecting pipe.

(2) centrifuge tube is added in the bacterium solution for taking 1ml-6ml to be incubated overnight, using conventional desktop centrifuge, 12,000rpm from Heart 1min absorbs supernatant (bacterial sediment can be collected into a centrifuge tube by repeatedly centrifuging when bacterium solution is more) as possible.

(3) 250 μ l solution P1 (RNaseA has been added) are added into the centrifuge tube there are bacterial sediment, using pipettor or The thorough suspended bacterial precipitation of turbula shaker.

(4) 250 μ l solution P2 are added into centrifuge tube, leniently spinning upside down 6~8 times makes thalline fully crack.

(5) 350 μ l solution P3 are added into centrifuge tube, leniently spins upside down 6~8 times, mixes well immediately, at this time will There is white flock precipitate.12,000rpm centrifugation 15min.

(6) supernatant that previous step is collected is transferred to pipettor in adsorption column CP3, it is heavy to pay attention to trying not to be sucked out It forms sediment.12,000rpm 30~60sec of centrifugation, outwell the waste liquid in collecting pipe, adsorption column CP3 are put into collecting pipe.

(7) the rinsing liquid PW (absolute ethyl alcohol is added in advance) of 600 μ l, 12,000rpm centrifugations 30 are added into adsorption column CP3 ~60sec outwells the waste liquid in collecting pipe, and adsorption column CP3 is put into collecting pipe.

(8) repetitive operation (7).

(9) adsorption column CP3 is put into collecting pipe, 12,000rpm centrifugation 2min, it is therefore an objective to say drift remaining in adsorption column Washing lotion removes.Adsorption column is uncapped, dries remaining rinsing liquid at room temperature.

(10) adsorption column CP3 is placed in a clean centrifuge tube, 50~100 μ L is added dropwise to the intermediate position of adsorbed film DdH2O, is placed at room temperature for 2min, and plasmid solution is collected into centrifuge tube by 12,000rpm centrifugation 2min.

7, cell transfecting

(1) cell density reaches 50% or more, and 12h before transfecting changes dual anti-culture solution without dual anti-culture solution into.

(2) each hole rotaring transfecting mode is as follows：

A, the miR-574-5p analogies (mimic) and negative control (NC) of the plasmid of 0.8 μ g and 100pmol are dissolved in 50 In the opti-mem serum-free mediums of μ l (table 1), 5min is stood；

B, the transfection reagent of 2 μ l is dissolved in the opti-mem serum-free mediums of 50 μ l, stands 5min；

C, A liquid and B liquid are mixed, stands 20min.

(3) during mixed liquor is stood, archaeocyte culture solution is absorbed, blots net, the serum-free of 400 μ l of addition as possible Culture solution opti-mem obtains C mixed liquors.

(4) mixing C liquid is added in every hole, 4-6h is cultivated in 37 DEG C of constant incubators, serum-free medium is changed into There is the culture of serum free culture system liquid for 24 hours containing dual anti-.

1 miRNA sequence of table

8, Dual-Luciferase Activity determination

(1) lytic cell：After 293T cell culture for 24 hours, iuntercellular is taken out, culture solution is absorbed, is added 1ml's per hole PBS is cleaned three times, cleans PBS exhaust as possible.100 μ l of cell pyrolysis liquid are added, rocks oscillating reactions 15min, uses pipettor Pipette tips are blown and beaten, and ensure that cell fully cracks.Pipettor suction is placed in PCR pipe, and 10,000~15,000g centrifuges 3~5min, takes Supernatant is spare.

(2) melt Fluc detection reagent and Renilla luciferase detection buffer solution, and reach room temperature.Sea pansy Luciferase detection substrate (100 ×) is placed in spare on ice chest.

(3) amount that 100 microlitres are needed according to each sample takes appropriate Renilla luciferase detection buffer solution, according to 1：100 add Enter Renilla luciferase detection substrate (100 ×) and is configured to Renilla luciferase detection working solution.Such as 1 milliliter of sea pansy luciferin About 1 milli can be configured to by being added after 10 microlitres of Renilla luciferase detection substrates (100 ×) mix well in enzyme detection buffer solution It rises Renilla luciferase and detects working solution.

(4) it presses instrumentation specification and opens multi-function microplate reader, measuring interval is set as 2 seconds, minute is set as 10 Second.

(5) when each sample measures, 20-100 microlitres of sample is taken.

(6) 100 microlitres of Fluc detection reagents are added, are beaten with rifle or with being surveyed after other appropriate ways mixings Determine RLU (relative light unit).

(7) after completing said determination Fluc step, 100 microlitres of Renilla luciferases is added and detect work Liquid, beaten with rifle or with after other appropriate ways mixings measure RLU (relative light unit).

(8) using Fluc as internal reference, the RLU values that are measured with Renilla luciferase divided by The RLU values that Fluc measures.According to obtained ratio swashing come the different sample room purpose reporter genes of comparison Degree living.

9, RT-qPCR is detected

Using RT-qPCR methods detect miR-574-5p to MAP3K9 genes mRNA level in-site influence.

According to GenBank goat MAP3K9 genes (XM_018066129.1) and reference gene β-actin (NM_ 001314342.1) mRNA sequence designs MAP3K9 genes and reference gene β-actin real-time quantitative primers, by upper marine growth Engineering Co., Ltd synthesizes.

The MAP3K9 gene real-time quantitative primers are as follows：

Sense primer F：5'-TGAAGCTCAAGGACGGAAAT-3'；

Downstream primer R：5'-CGCCTGGTGTCAACTGGATG-3'.

Reference gene β-actin real-time quantitative the primers are as follows：

Sense primer F：5'-GCAAGTTCCACGGCACAG-3'；

Downstream primer R：5'-GGTTCACGCCCATCACAA-3'.

The condition of the reverse transcription is：

20 μ L reaction systems include 5 × Prime Script Buffer of the Reaction solution, 4 μ l of 10 μ l, The RT Prime Mix of Prime the Script RT Enzyme Mix I and 1 μ l of 1 μ l, add aqua sterilisa to 20 μ l.

The reverse transcription program is as follows：

37 DEG C of incubation 15min, 85 DEG C of incubation 5s, 4 DEG C preserve；

The condition of the RT-qPCR is：

20 μ L reaction systems include Platinum RTS SYBR Super Mix, the MAP3K9 genes and internal reference of 12.5 μ l Each 1 μ L of sense primer F and downstream primer R of gene β-actin, the cDNA templates of 1 μ L add aqua sterilisa to 20 μ l；

10, Western Blot are detected

(1) protein sample prepares

It after cell transfecting culture 48h, is washed twice with PBS, 150 μ l is added per hole and contain protease inhibitors and phosphatase The RIPA of inhibitor collects cell in 1.5ml centrifuge tubes, ice bath 30min with cell scraper.It is centrifuged at 12000rpm, 4 DEG C 15min takes supernatant in 1.5ml centrifuge tubes, -80 DEG C of preservations.Using BCA kits, protein sample concentration is measured.According to sample 4 × Loading Buffer albumen sample solutions, 120 DEG C of water-bath 10min are added in volume.

(2) glue

A separation gels：The H of 6.6ml₂The 1.5M Tris-HCL of the Acrylamide of O, 8.0ml a concentration of 30%, 5.0ml (pH8.8), the ammonium persulfate of the SDS of 0.2ml a concentration of 10%, 0.2ml a concentration of 10%, the TEMED mixing of 0.008ml are small Already installed electrophoresis vertical panel is added in the heart, and the isopropanol cover of 1.5~2ml is added to drive bubble away.Gelling to be separated is solid And then use ddH₂O washes off isopropanol completely；

B SDS-PAGE concentrate glue：The H of 4.1ml₂A concentration of 30% Acrylamide of O, 1.0ml, 0.75ml's A concentration of 10% ammonium persulfate of a concentration of 10%SDS of 1.0M Tris-HCL (pH6.8), 0.06ml, 0.06ml, 0.006ml TEMED, be uniformly mixed, comb is quickly put into while being added on separation gel, has prevented bubble appearance.

(3) loading

Glue to be concentrated after natural drying, pulls out comb with caution, and vertical panel is put into electrophoresis tank, adds 1 × Tris-Gly electric Buffer solution of swimming is calculated according to albumen concentration per the empty protein sample being added, 5 μ l of Marker points.

(4) electrophoresis runs glue

60~80V voltages carry out electrophoresis, 110~120V are changed into until Marker separation, then by voltage, until bromophenol blue electricity Swimming terminates to gel lower end and runs glue.According to molecular weight of albumen, suitable section is chosen, cuts purpose glue.

(5) transferring film

For the cathode of transferring film folder under, anode spreads 3 layers of sponge, 3 layers of filter paper, purpose glue, pvdf membrane, 3 layers of filter upper in order Paper, 3 layers of sponge.One layer is often placed, bubble is driven away with glass bar, transferring film folder is disposed vertically in transferring film slot later, pours into transferring film Liquid, 60V ice bath electrophoresis 2h.

(6) it closes

It is equipped with a concentration of 5% skimmed milk power confining liquid, carries out 1~2h closings.

(7) primary antibody is incubated

By corresponding than diluting primary antibody with a concentration of 5% skimmed milk power, it is put into pvdf membrane, 4 DEG C of refrigerator overnights, recycling one Anti-, TBST is cleaned 3 times, a 10min.

(8) secondary antibody is incubated

By 1:1000 dilute secondary antibody with a concentration of 5% skimmed milk power, are placed on shaking table at room temperature and slowly shake 2 hours, return Secondary antibody is received, TBST is cleaned 3 times, a 10min.

(9) glue is shone

According to 1：The A liquid of the super quick luminescent solutions of ECL and B liquid are mixed and are protected from light, dropped on pvdf membrane by 1 ratio, using at As system development is taken pictures.

(10) result treatment

Gray analysis is carried out using ImageJ image analysis softwares, data analyze the significance of difference (* * P with SPSS 18.0 ＜ 0.01, * P ＜ 0.05).

The results show that miR-574-5p reduces the activity of luciferase, primarily determine that MAP3K9 is miR-574-5p's Target gene；Using RT-qPCR and Western blot method validations miR-574-5p to MAP3K9 genes in mRNA and albumen water The influence of flat expression.As a result it shows：MiR-574-5p can inhibit expression of the MAP3K9 genes on mRNA and protein level, into One step determines that miR-574-5p can be combined with MAP3K93'UTR, and MAP3K9 is the target gene of miR-574-5p.

Nucleotide or amino acid sequence table

<110>Yangling Polytechnic college, Xibei Univ. of Agricultural ＆ Forest Science ＆ Technology

<120>A kind of method of miR-574-5p target genes screening

<160>

<210> 1

<211> 29

<212>The sense primer F of primer MAP3K9

<213> DNA

<220>

<400>

5'- CGGCTCGAGCCCATCTCCAGCTCCTTTCC -3'

<210> 2

<211> 30

<212>The downstream primer R of primer MAP3K9

<213> DNA

<220>

<400>

5'- TTGCGGCCGCTCCTCTCTGCACCTGCTACT -3'

<210> 3

<211> 20

<212>The sense primer F of MAP3K9 gene real-time quantitative primers

<213> DNA

<220>

<400>

5'-TGAAGCTCAAGGACGGAAAT-3'

<210> 4

<211> 20

<212>The downstream primer R of MAP3K9 gene real-time quantitative primers

<213> DNA

<220>

<400>

5'-CGCCTGGTGTCAACTGGATG-3'

<210> 5

<211> 18

<212>The sense primer F of reference gene β-actin real-time quantitative primers

<213> DNA

<220>

<400>

5'-GCAAGTTCCACGGCACAG-3'

<210> 6

<211> 18

<212>The downstream primer R of reference gene β-actin real-time quantitative primers

<213> DNA

<220>

<400>

5'-GGTTCACGCCCATCACAA-3'

<210> 7

<211> 21

<212>Negative control（Negative control, NC）Sense sequences

<213> DNA

<220>

<400>

UUCUCCGAACGUGUCACGUTT

<210> 8

<211> 21

<212>Negative control（Negative control, NC）Antisense sequences

<213> DNA

<220>

<400>

ACGUGACACGUUCGGAGAATT

<210> 9

<211> 24

<212>The Sense sequences of miRNA-574-5p

<213> DNA

<220>

<400>

UGAGUGUGUGUGUGUGAGUGUGUG

<210> 10

<211> 24

<212>The Antisense sequences of miRNA-574-5p

<213> DNA

<220>

<400>

CACACUCACACACACACACUCAUU

Claims

1. a kind of method of miR-574-5p target genes screening, which is characterized in that include the following steps：

1) using goat genomic DNA as template, in Taq archaeal dna polymerases, buffer environment, Mg²⁺, in the presence of dNTPs, profit It is expanded under the conditions of PCR with primer MAP3K9, determines that obtained PCR product is the sequence in the areas MAP3K9 gene 3'UTR；

2. the method as described in claim 1, which is characterized in that in step 1), the primer MAP3K9 is as follows, wherein Underscore be XhoI and NotI restriction endonucleases restriction enzyme site；

Sense primer F：5'-CGGCTCGAGCCCATCTCCAGCTCCTTTCC-3'；

Downstream primer R：5'-TTGCGGCCGCTCCTCTCTGCACCTGCTACT-3'。

The condition of the PCR amplification is：

15 μ L reaction systems, including DNA profiling 0.5 μ l, the sense primer F of the MasterMix of 7.5 μ l, primer MAP3K9 are under Primer each 0.5 μ l of R are swum, add aqua sterilisa to 15 μ l；

Described is using the PCR response procedures of primer MAP3K9：94 DEG C of pre-degeneration 4min, 94 DEG C are denaturalized 30s, and annealing temperature is 60 DEG C, annealing time 30s, 72 DEG C of extension 30s carry out 30 cycles altogether, and last 72 DEG C fully extend 10min, 4 DEG C of preservations.

3. the method as described in claim 1, which is characterized in that in step 2), the structure Dual-luciferase reportor systerm, Uciferase activity is detected, the specific method of the target gene of Preliminary Identification miR-574-5p is：

Wild type and saltant type reporter plasmid are built respectively；

The 293T cells for collecting exponential phase transfect specification respectively by miR- according to liposome Lipofectamine2000 574-5p analogies, negative control and MAP3K9 luciferase reporter vector corotation enter 293T cells, are divided into 4 groups：Wild type+ MiR-574-5p analogies, wild type+negative control, saltant type+miR-574-5p analogies and saltant type+negative control；

After culture for 24 hours, the intensity of different group firefly luciferases and renilla luciferase is detected, firefly luciferase is used With the activity of the ratio calculation relative fluorescence element enzyme of renilla luciferase intensity.

4. the method as described in claim 1, which is characterized in that in step 3), miR-574-5p pairs is detected using RT-qPCR methods MAP3K9 genes are in the specific method of the influence of mRNA level in-site：

The MAP3K9 gene real-time quantitative primers are as follows：

Sense primer F：5'-TGAAGCTCAAGGACGGAAAT-3'；

Downstream primer R：5'-CGCCTGGTGTCAACTGGATG-3'.

Reference gene β-actin real-time quantitative the primers are as follows：

Sense primer F：5'-GCAAGTTCCACGGCACAG-3'；

Downstream primer R：5'-GGTTCACGCCCATCACAA-3'.

The condition of the reverse transcription is：

The reverse transcription program is as follows：

37 DEG C of incubation 15min, 85 DEG C of incubation 5s, 4 DEG C preserve；

The condition of the RT-qPCR is：

20 μ L reaction systems：Platinum RTS SYBR Super Mix, MAP3K9 genes including 12.5 μ L and reference gene Each 1 μ L of sense primer F and downstream primer R of β-actin, the cDNA templates of 1 μ L add aqua sterilisa to 20 μ l；

The RT-qPCR response procedures that the utilization quantifies primer MAP3K9 are：95 DEG C of pre-degeneration 5min, 94 DEG C are denaturalized 15s, move back Fiery temperature is 60 DEG C, and annealing time 20s, 72 DEG C of extension 20s carry out 35 cycles, 4 DEG C of preservations altogether.

5. the method as described in claim 1, which is characterized in that detect miR- using Western blot methods described in step 4) Specific methods of the 574-5p to MAP3K9 genes in the influence of protein level be：

Negative control and miR-574-5p are transferred to galactophore epithelial cell, cell is collected after cultivating 48h, is cracked using cell protein Liquid extracts total protein, and albumen concentration is detected using BCA methods；

Negative control group and miR-574-5p transfection group cell protein samples are carried out sodium dodecyl sulfate polyacrylamide to coagulate Gel electrophoresis (SDS-PAGE), by the albumen in gel electrophoresis go to Kynoar (PVDF) film and with corresponding rabbit-anti MAP3K9, The goat-anti rabbit secondary antibody of rabbit-anti GAPDH and HRP label is incubated, and is exposed, is taken pictures after the reaction of ECL luminescent solutions is added, uses Image J image analysis softwares carry out quantitative analysis to gray scale, using β-actin as internal reference.