CN108300697A

CN108300697A - A kind of method and purposes that trophocyte stimulation NK cells expand

Info

Publication number: CN108300697A
Application number: CN201710025596.4A
Authority: CN
Inventors: 黄飞; 何凤; 赵晓楠; 金涛; 王海鹰; 史子啸
Original assignee: Shanghai Hrain Biotechnology Co Ltd
Current assignee: Shanghai Hrain Biotechnology Co Ltd
Priority date: 2017-01-13
Filing date: 2017-01-13
Publication date: 2018-07-20

Abstract

The invention belongs to biotechnologies.The invention discloses the construction methods and sequence information of expression 21 trophocyte of CD64, CD86,41BBL and mbIL (K562 APC3 mbIL21).The field for the whole flow process and application that this trophocyte stimulation NK cells expand is also disclosed that simultaneously.Trophocyte prepared by the present invention can improve the amplification in vitro efficiency of NK cells while can also make the state of NK cells holding high-purity.

Description

A kind of method and purposes that trophocyte stimulation NK cells expand

Technical field

The invention belongs to biotechnologies, and in particular to the trophocyte of genetic engineering transformation stimulates the expansion of NK cells Increasing method and purposes.

Background technology

NK (Natural Killer) cell-natural killer cells, belongs to nospecific immunity cell, the mark master on surface There are CD56, CD16 etc..In healthy human peripheral blood, account for about the 5~15% of total number of lymphocytes.Resist tumour for body first Road defence line is generally in dormant state, and after signal factor activation, it is thin to penetrate into attack tumour cell and virus infection in tissue Born of the same parents.

NK cell activity with the negatively correlated property of tumor invasion.NK cell activity is continuously decreased with the increase at age, cancer Disease incidence increases with advancing age；The cancer morbidity of middle and high group low of crowd's group ratio NK activity of NK activity is high Twice；NK cells shows, which are activation receptor (KAR) expression, in cancer patient's body reduces, and Inhibitory receptor (KIR) expression increases, To which function is suppressed；The NK activity of cancer metastasis patient is substantially reduced.

NK cells have wider antitumor spectra.Homology, of the same race or xenograft tumor cell can be killed, the machine of target cell is killed System may be that 1) release perforin and granzyme cause target cell necrosis or apoptosis；2) inducing target cell is adjusted by death receptor Apoptosis；3) it secretes a variety of responsiveness cell factors and fights metastatic tumour；4) secondary tumor immune response is excited.

NK cells are inherent immunity system medium size lymphocytes, it cannot identify exogenous antigen molecule, but can kill swollen Oncocyte and the cell of virus infection [Front Immunol, 2014,17,5:95.].NK cells of adopting are carried out to tumour patient Treatment has very big foreground.Because NK cells have very high killing activity and not will produce graft-versus-host reaction.Uniquely It is sorry be not enough NK cells for immunization therapy [Tumors Front Immunol, 2014,5:87.].So external Amplification NK cell technologies are just come into being, and gradually start to develop [Blood, 2005,106 (1):376-383.].The study found that comprehensive Close perhaps contributed in vitro, in vivo using various cell factors NK proliferation and effector function [Cytokine, 2013,62 (1):58-63.].Gamma chain cytokines have played important function in NK cell Proliferations and Function.The family member wraps Include IL2, IL4, IL7, IL9, IL15 and IL21.In NK cell differentiation procedures, different cell factors all has different works With [J Biomed Biotechnol, 2011,2011:861920.].

Natural kill (NK) cell expands after being activated by proliferative cytokines (such as IL-2 and IL-15).NK is thin Born of the same parents are greatly enhanced by coming from some amplicon protein abilities of feeder cells (tumor cell line and PBMC) secretion.Therefore, spoke According to feeder cells and the culture mediums of co-culture system of NK cells include IL-2 and IL-15, this co-culture system has been developed that To generate a large amount of NK cells.Common feeder cells system is RPMI8866, Epstein-Barr lymphoid cell lines (EBV- ) and K562 LCL.The stimulation of known NK- sensitivities K562 cells (cell after genetic engineering modification) increases NK cells to IL-2, IL-15 and IL-21 combination culture systems breeder reaction ability (Methods Mol Biol.2016；1441:167-74.). IL21 is the important adjusting molecule of NK cell functions, can promote NK cell Proliferations, enhances NK cytotoxic effects and ADCC makees With [Nature, 2000,408 (6808):57-63.].In recent years, someone is same on K562 cells using the method for genetic engineering When express IL-15, CD137L equimolecular, and stimulate with this cell the proliferation of NK cells.IL-15 and CD137L combined stimulations are The basis that NK cell-specifics expand in PBMC：Expanded to induced NK cell by intercellular contact stimulus as memebrane protein Increase.IL15 can promote the differentiation and maturation of NK cells, and IL21 can combine the differentiation and maturation that IL15 molecules promote NK cells [Nature.408(6808):57-63.]

NK cells ratio shared in peripheral blood lymphocytes is relatively low, and it is therefore necessary to establish a kind of NK cell bodies to extend out Increasing technology, the function for studying NK cells, and lay the foundation for tumour cell immunization therapy.

In this patent, we further express on the pAPC cells for stablizing expression CD86, CD64 and 41BBL molecule Then mbIL21 molecules expand NK cells with the engineering cell strain (being named as K562-APC3-mbIL21) of structure.So This research expresses IL21 molecules simultaneously on the K562-APC3-mbIL21 cells for stablizing expression CD86, CD64 and 41BBL, passes through As stimulation cell after gamma-rays irradiation, its effect in the amplification of NK cells is studied.Specific method is：Separation is strong Health human peripheral blood single nucleus cell (PBMC) then isolates the NK cells of high-purity from PBMC, then uses engineering cell K562-APC3-mbIL21 simultaneously supplements cell factor IL2 to NK cells progress amplification in vitro, and application cell counting method and streaming are thin Born of the same parents' art is respectively compared the amplification times and NK cell purities of NK cells, and using CFSE/7-AAD methods to tumour cell K562, Raji and Molm13 carries out cell toxicity test and detects killing-efficiency.By 2 stimulations of culture in 2 weeks, NK cells are averagely expanded to 1000 times, cell purity maintains 80% or so.Killing experiments are the results show that the NK cells of amplification are high to K562 cell killings rate Up to 60.6%.

Invention content

First aspect present invention provides a kind of polynucleotide sequence, and the polynucleotide sequence is selected from：

CD64 coded sequences, CD86 coded sequences, 41BBL coded sequences, film fix the polynucleotides of IL-21 coded sequences Sequence；(2) complementary series of (1) described polynucleotide sequence.

Second aspect of the present invention provides amino acid sequence, and the amino acid sequence is selected from：

CD64 coded sequences, CD86 coded sequences, 41BBL coded sequences, film fix the amino acid sequence of IL-21 coded sequences Row；With in the amino acid sequence that (1) limits through replacing, missing or adding one or several amino acid and retain activation T it is thin The amino acid sequence derived from (1) of cytoactive.

Third aspect present invention provides a kind of genetically engineered cell, which is characterized in that the genetically engineered cell is K562- APC3-mbIL21 cells.Fourth aspect present invention provides the preparation method of genetically engineered cell, which is characterized in that including following Step：

(1) structure expresses the slow virus carrier of CD64, CD86,41BBL and mb IL-21 respectively；

(2) tri- slow virus cotransfection K562 cells of CD64, CD86,41BBL, fluidic cell detection of expression, acquisition CD64, CD86,41BBL stablize expression cell and import the IL-21 that cell membrane surface stablizes expression on this basis, establish K562-APC3- mbIL21。

Fourth aspect present invention provides application of the genetically engineered cell in the amplification of NK cells.

Fifth aspect present invention provides a kind of NK methods for cell expansion, which is characterized in that includes the following steps：

1) slow virus carrier of structure CD64, CD86,41BBL and mbIL-21 expression；

2) the corresponding cell of tri- slow virus cotransfections of CD64, CD86,41BBL, fluidic cell detection of expression, acquisition CD64, CD86,41BBL stablize expression cell and import the IL-21 that cell membrane surface stablizes expression on this basis, establish K562-APC3- mbIL21；

3) genetically engineered cell that lethal exposure or mitomycin processing step (2) obtain, by 1:2 with sorting after NK Mixing with cells is cultivated altogether in NK cell amplification cultivation liquid；

4) repetitive stimulation 1 time weekly, continued stimulus 2 weeks, to obtain the NK cells of sufficient amount.

Sixth aspect present invention provides application of the method for efficient amplification NK cells in cell therapy field.

Description of the drawings

Fig. 1 builds the carrier figure used in K562-APC3-mbIL21 trophocytes

Fig. 2 mbIL21 tactic pattern figures

Fig. 3 K562-APC3-mbIL21 trophocyte CD64, CD86,41BBL and mbIL-21 detection of expression

The ratio of the front and back NK cells of Fig. 4 PBMC sortings

Fig. 5 K562-APC3-mbIL21 trophocytes stimulate the purity analysis figure after NK cells

2 post-stimulatory growth curves of trophocyte of Fig. 6 NK cells

Fig. 7 activation expands the secretion of 9 days 5 hours IL-2 of NK cells and target cell co-cultivation

Fig. 8 activation expands the secretion of 9 days 5 hours INF γ of NK cells and target cell co-cultivation

Fig. 9 activation expands 9 days NK cells and target cell co-cultures 4 hours CD107a and expresses

Figure 10 activation expands the lethal effect to tumour cell after 9 days NK cells and target cells co-culture 4 hours

Specific implementation mode

The present invention is described in further detail by reference to following EXPERIMENTAL EXAMPLE.These embodiments are merely for explanation Property purpose provide, be not intended to it is restrictive, unless otherwise prescribed.Therefore, the present invention should not be interpreted in any way as being limited to Lower embodiment, but should be interpreted as including since introduction provided herein will become apparent from any and whole variation. Method used in embodiment and reagent, unless otherwise stated, for the method and reagent of this field routine.

Embodiment 1：The determination of APC3-mbIL21 gene orders

1.NCBI query site people CD64 gene orders (NM_000566), people CD86 gene orders (BC040261), people 41BBL gene orders (NM_003811).

2. building film fixes IL-21 (mbIL-21), by GM-CSF signal peptides (NP_000749.2), people IL21, human IgG 4 Hinge area, human IgG 4Fc segments, the connection of the transmembrane domains people CD4, these sequences are in website http://sg.idtdna.com/ Codon optimization is carried out on CodonOpt, ensures to be more suitable for human cell's expression in the case where encoding amino acid sequence is constant.

3. above-mentioned sequence full genome is synthesized, different restriction enzyme sites are being introduced from beginning to end, are forming complete mbIL21 genes sequence Column information.CD64, CD86,41BBL, mbIL21 nucleotide sequence of synthesis are inserted into slow virus FUW carriers through digestion, connection, turn Change to competence E.coli (DH5 α), after being sequenced correctly, extracts and purify using the plasmid purification kit of Qi agen companies Plasmid.

Sequencing primer：

Upstream primer sequence：GGCGAGTGTGTTTTGTGAAGTT

Downstream primer sequence：ATACAAAGGCATTAAAGCAGCG

Embodiment 2：The structure of K562-APC3-mbIL21 trophocytes

Plasmid purification calcium phosphate method transfects 293T cells and carries out retrovirus Packaging experimentation.

1. the 1st day：293T cells should be less than for 20 generations, not cover with excessively.With 0.6 × 10⁶Cells/ml bed boards, 10cm Ware adds the DMEM culture mediums of 10ml, mixes well cell, 37 degree of overnight incubations.

2. the 2nd day：293T cell fusion degree reaches 90% or so and is transfected (being typically bed board 14-18 hours or so)； Prepare plasmid composite, it is that 12.5 μ g, Gag-pol are for 10 μ g, VSVg that the amount of various plasmids, which is slow virus (FUW) parenchyma grain, 6.25 μ g, CaCl₂250 μ l, H₂O is that 1ml total volumes are 1.25ml；Addition is with plasmid composite isometric in another pipe HBS, be vortexed concussion 20s when adding plasmid composite.Softly mixture is added to along side in 293T wares, 37 DEG C of degree cultures 4 hours, culture medium is removed, PBS is washed one time, rejoins the fresh culture of preheating.

3. the 4th day：Packing is stored in -80 DEG C transfection is collected supernatant and filtered with 0.45 μm of filter after 48 hours after.4.24 Orifice plate is added 2 × 10⁵K562 cells, add each 250ul of CD64, CD86,41BBL, mbIL21 slow virus, add Polybrene (Invi trogen) makes final concentration of 5 μ g/ml.

It 5.30 DEG C, 2500rpm, centrifuges 90 minutes.

6. after centrifugation, inhaling the viral suspension abandoned in hole, not sopping up cell carefully.1ml culture mediums are added, are used in combination The pipette tips piping and druming of 1ml is uniform, is put into CO₂It is cultivated in incubator, after cultivating 3 days, carries out cell monoclonal and select, pass through detection CD64, CD86,41BBL and mbIL21 expression select the K562-APC3-mbIL21 trophocytes used for follow-up study.

Shown in Fig. 1,4 kinds of slow virus carriers of the present embodiment structure.Shown in Fig. 2, the mbIL21 patterns of the present embodiment structure Figure includes signal peptide, hinge area, Fc segments and transmembrane region.

Shown in Fig. 3, visible K562-APC3-mbIL21 trophocytes surface C D64, CD86, the 41BBL of flow cytometer detection and MbIL21 is uniformly expressed；Q-PCR detects visible K562-APC3-mbIL21 trophocytes height and expresses mbIL21.

Embodiment 3：The amplification of NK cells

1. after detaching PBMC, obtaining NK cells using the NK sorting kits (Cat.19055) of Stem Cell, being resuspended in NK culture mediums (X-VIVO^MDual anti-+ 1%GlutaMax+1%HEPES+2%N the acetyl of 15+1%-cysteine+5% inactivates people AB Serum+200IU/ml IL-2)；

2. as shown in Figure 4, flow cytometer detection NK cells (CD3^-CD56⁺) the 17.1 of PBMC is accounted for before sorting, it compares after sorting Example reaches 73.0%.

3. 100Gy gamma-ray irradiations or 25 μ g/ml mitomycins is taken to handle the K562- after (37 DEG C are handled 30 minutes) APC3-mbIL-21 trophocytes are resuspended in NK culture mediums after centrifugation.

4. by NK：K562-APC3-mbIL-21=1：0.5 quantity is 2.5 × 10 than mixing, adjustment NK cell densities⁵/ Ml is put to 37 DEG C, is cultivated in the incubator of 5%CO2, is every other day replaced fresh NK culture mediums.

After 5.7 days, NK cell counts are collected, NK culture mediums are resuspended in after centrifugation, take 100Gy gamma-ray irradiations or 25 μ g/ Ml mitomycins treated K562-APC3-mbIL-21 trophocytes, also according to NK：K562-APC3-mbIL-21=1： 0.5 quantity carries out 2 stimulations than mixing, to NK cells.

6. in incubation, fresh NK cells culture medium is every other day replaced.

7. monitoring NK cell purities and proliferative conditions.

NK cell purities (CD3^-CD56⁺) as shown in figure 5, the 5th day flow cytometer detection its purity is after NK cells are stimulated at 1 time 74.3%；The 5th day its purity of flow cytometer detection is 85.7% after being stimulated at 2 times；

NK cell Proliferations curve is as shown in fig. 6, NK cells are living after K562-APC3-mbIL-21 trophocytes once stimulation Change and enter vegetative state, the fast breeding phase is entered after secondary stimulus, 1000 times of proliferation or more when cell number reaches peak value.

Embodiment 4：IL-2 secretions detect after NK cells are co-cultured with target cell

1. the cell for taking activation to expand, is resuspended in the X-VIVO complete mediums without IL-2, adjustment cell concentration is 2 × 10⁶/mL。

2. taking target cell, (K562, Raji or Molm13, are resuspended in the X-VIVO complete mediums without IL-2, and adjustment is thin Born of the same parents a concentration of 2 × 10⁶/mL。

3. taking 96 hole V bottom plates, target cell 2 × 10 is added per hole for experimental group⁵It is a, NK cells 2 × 10⁵It is a；BD is added simultaneously GolgiPlug (contains BFA, 1 μ l BD GolgiPlug are added in every 1ml cell culture mediums), and after mixing well, 37 DEG C of incubations 5 are small When；After incubation, cell is collected, as experimental group.

4. the PBS per effective 1mL cleans cell, 300g, 4 DEG C of centrifugations carefully suck supernatant after five minutes.

After 5.PBS washes cell, 250 μ l/EP pipe Fixation/Permeabilization solution are added, 4 DEG C incubate 20min is educated to fix cell and rupture of membranes；With 1 × BD Perm/Wash^TMBuffer cleans cell 2 times, 1ml/ times.

6. carrying out intracellular factor dyeing, appropriate IL-2 cell factors fluorescence antibody or negative control are taken, with BD Perm/ Wash^TMBuffer is diluted to 50 μ l, and the cell for having fixed rupture of membranes is fully resuspended with this antibody diluent, and 4 DEG C are protected from light 30 points of incubation Clock, 1 × BD Perm/Wash^TMThe cleaning cells 2 times of buffer 1mL/ times, are then resuspended with PBS.

7. flow cytomery

The present embodiment testing result is shown in Fig. 7, it is seen then that NK cells are made with tumour cell (K562, Raji and Molm13) It is respectively 3.73%, 4.73% and 4.19% with the lower IL-2 percentage expressed.

Embodiment 5：INF- γ secretions detect after NK cells are co-cultured with target cell

6. carrying out intracellular factor dyeing, appropriate IFN-γ cell factor fluorescence antibody or negative control are taken, with BD Perm/ Wash^TMBuffer is diluted to 50 μ l, and the cell for having fixed rupture of membranes is fully resuspended with this antibody diluent, and 4 DEG C are protected from light 30 points of incubation Clock, 1 × BD Perm/Wash^TMThe cleaning cells 2 times of buffer 1mL/ times, are then resuspended with PBS.

7. flow cytomery

The present embodiment testing result is shown in Fig. 8, it is seen then that the percentage of NK cells secretion of gamma-IFN under K562 cytosiies Rate has 21.3%, and cell proportion increase obviously changes compared with control group (1.59%) apparent.

Embodiment 6：CD107a detection of expression after NK cells are co-cultured with target cell

1. taking one piece of 96 orifice plate of the bottoms V, add NK cells 2 × 10 per hole⁵A and target cell (K562, Raji, Molm13) 2 × 10⁵ It is a, the X-VIVO complete mediums for being free of IL-2 for 100ul are resuspended, BD GolgiStop are added and (contains monesin, is cultivated per 1ml 1 μ l BD GolgiStop are added in base), 1 μ l CD107a antibody (1 is added per hole:100) it, is incubated 4 hours for 37 DEG C, collects thin Born of the same parents.

2. sample is centrifuged removal culture medium, it is primary that PBS washes cell, 400g, and 4 DEG C centrifuge 5 minutes.Supernatant is abandoned, often pipe adds Enter appropriate specific surfaces antibody CD3, CD56,100 μ l of resuspension volume are protected from light incubation 30 minutes on ice.

3. the PBS cleanings cell 1 time, 400g, 4 DEG C per effective 3mL centrifuges 5 minutes.Carefully suck supernatant.

4. appropriate PBS is resuspended, flow cytomery CD3, CD56, CD107a.

The present embodiment testing result is shown in fig.9.As it can be seen that NK cells express the hundred of CD107a under K562 cytosiies Point rate has 40.2%, and the cell conspicuousness for expressing CD107a increases；NK cells expressed under the action of Raji and Molm13 hundred Divide rate relatively low, respectively 9.41% and 15.3%.

Embodiment 7：NK cells detect tumor specific cell lethal effect after being co-cultured with target cell

1.K562, Raji, Molm13 cell are resuspended in respectively in serum-free RPMI1640 culture mediums, and adjustment cell concentration is 1×10⁶Fluorescein based dye CFSE (carboxyfluoresceindiacetatesuccinimidyl ester) is added to end in/ml A concentration of 1 μM.

2. mixing, 37 DEG C are incubated 10 minutes.

3. after being incubated, being added and being reacted with end mark within 2 minutes with the isometric FBS of cell suspension, incubation at room temperature.

4. cleaning cell is simultaneously resuspended in cytotoxicity culture medium, density 1 × 10⁶/ml。

5. cleaning NK cells are simultaneously suspended in cytotoxicity culture medium, adjustment a concentration of 5 × 10⁶/ml。

6. according to NK：Target cell=10:1、3:1、1:1 ratio is cultivated in 5ml sterility test pipes, each is total In culture group, target cell 50,000 (50 μ l), while one group of control group for only including target cell is set.

7. co-cultured cell is placed in 37 DEG C to be incubated 4 hours.

8. after the completion of being incubated, PBS cleans cell, the concentration recommended to specifications immediately after rapidly joins 7-AAD (7- Aminoactinomycin D), it is incubated 30 minutes on ice.

9. being not required to clean, machine testing in streaming is directly carried out, data are analyzed with Flow Jo.

10. analysis target cell dead after using the dead cell gating of the 7AAD positives, measurement NK cells and target cell to co-culture Ratio；

11. visible (Figure 10) according to the testing result of the above cell factor IL-2, IFN-γ and CD107a, NK cells exist Efficiency is obviously played under K562 cytosiies.Correspondingly, Figure 10 is shown, NK cells all have each tumour cell killing work( Energy；It is 10 in effect target ratio:1 and 3:In the case of 1, NK cells are 60.6% and 45.5% to the killing rate of K562 cells, hence it is evident that high In Raji and Molm13；It is 1 in effect target ratio:In the case of 1, NK cells play weaker killing ability to each tumour cell, compare nothing Notable difference；Killing ability no significant difference of the NK cells to Raji and Molm13 cells.

Sequence table

<110>The Shanghai bio tech ltd Heng Run Da Sheng

<120>A kind of method and purposes that trophocyte stimulation NK cells expand

<170> PatentIn version 3.3

<210> 1

<211> 377

<212> PRT

<213>Artificial sequence

<400> 1

Met Trp Phe Leu Thr Thr Leu Leu Leu Trp Val Pro Val Asp Gly Gln

1 5 10 15

Val Asp Thr Thr Lys Ala Val Ile Thr Leu Gln Pro Pro Trp Val Ser

20 25 30

Val Phe Gln Glu Glu Thr Val Thr Leu His Cys Glu Val Leu His Leu

35 40 45

Pro Gly Ser Ser Ser Thr Gln Trp Phe Leu Asn Gly Thr Ala Thr Gln

50 55 60

Thr Ser Thr Pro Ser Tyr Arg Ile Thr Ser Ala Ser Val Asn Asp Ser

65 70 75 80

Gly Glu Tyr Arg Cys Gln Arg Gly Leu Ser Gly Arg Ser Asp Pro Ile

85 90 95

Gln Leu Glu Ile His Arg Gly Trp Leu Leu Leu Gln Val Ser Ser Arg

100 105 110

Val Phe Thr Glu Gly Glu Pro Leu Ala Leu Arg Cys His Ala Trp Lys

115 120 125

Asp Lys Phe Sec Trp Tyr Asn Val Leu Tyr Tyr Arg Asn Gly Lys Ala

130 135 140

Phe Lys Phe Phe His Trp Asn Ser Asn Leu Thr Ile Leu Lys Thr Asn

145 150 155 160

Ile Ser His Asn Gly Thr Tyr His Cys Ser Gly Met Gly Lys His Arg

165 170 175

Tyr Thr Ser Ala Gly Ile Ser Val Thr Val Lys Glu Leu Phe Pro Ala

180 185 190

Pro Val Leu Asn Ala Ser Val Thr Ser Pro Leu Leu Glu Gly Asn Phe

195 200 205

Sec Trp Thr Leu Ser Cys Glu Thr Lys Leu Leu Leu Gln Arg Pro Gly

210 215 220

Leu Gln Leu Tyr Phe Ser Phe Tyr Met Gly Ser Lys Thr Leu Arg Gly

225 230 235 240

Arg Asn Thr Ser Ser Glu Tyr Gln Ile Leu Thr Ala Arg Arg Glu Asp

245 250 255

Ser Gly Leu Tyr Trp Cys Glu Ala Ala Thr Glu Asp Gly Asn Val Leu

260 265 270

Lys Arg Ser Pro Glu Leu Glu Leu Gln Val Leu Gly Leu Gln Leu Pro

275 280 285

Thr Pro Val Trp Phe His Val Leu Phe Tyr Leu Ala Val Gly Ile Met

290 295 300

Phe Phe Sec Trp Asn Thr Val Leu Trp Val Thr Ile Arg Lys Glu Leu

305 310 315 320

Lys Arg Lys Lys Lys Trp Asp Leu Glu Ile Ser Leu Asp Ser Gly His

325 330 335

Glu Lys Lys Val Ile Ser Ser Leu Gln Glu Asp Arg His Leu Glu Glu

340 345 350

Glu Leu Lys Cys Gln Glu Gln Lys Glu Glu Gln Leu Gln Glu Gly Val

355 360 365

His Arg Lys Glu Pro Gln Gly Ala Thr

370 375

<210> 2

<211> 1125

<212> DNA

<213>Artificial sequence

<400> 2

atgtggttct tgacaactct gctcctttgg gttccagttg atgggcaagt ggacaccaca 60

aaggcagtga tcactttgca gcctccatgg gtcagcgtgt tccaagagga aaccgtaacc 120

ttgcactgtg aggtgctcca tctgcctggg agcagctcta cacagtggtt tctcaatggc 180

acagccactc agacctcgac ccccagctac agaatcacct ctgccagtgt caatgacagt 240

ggtgaataca ggtgccagag aggtctctca gggcgaagtg accccataca gctggaaatc 300

cacagaggct ggctactact gcaggtctcc agcagagtct tcacggaagg agaacctctg 360

gccttgaggt gtcatgcgtg gaaggataag ctggtgtaca atgtgcttta ctatcgaaat 420

ggcaaagcct ttaagttttt ccactggaat tctaacctca ccattctgaa aaccaacata 480

agtcacaatg gcacctacca ttgctcaggc atgggaaagc atcgctacac atcagcagga 540

atatctgtca ctgtgaaaga gctatttcca gctccagtgc tgaatgcatc tgtgacatcc 600

ccactcctgg aggggaatct ggtcaccctg agctgtgaaa caaagttgct cttgcagagg 660

cctggtttgc agctttactt ctccttctac atgggcagca agaccctgcg aggcaggaac 720

acatcctctg aataccaaat actaactgct agaagagaag actctgggtt atactggtgc 780

gaggctgcca cagaggatgg aaatgtcctt aagcgcagcc ctgagttgga gcttcaagtg 840

cttggcctcc agttaccaac tcctgtctgg tttcatgtcc ttttctatct ggcagtggga 900

ataatgtttt tagtgaacac tgttctctgg gtgacaatac gtaaagaact gaaaagaaag 960

aaaaagtggg atttagaaat ctctttggat tctggtcatg agaagaaggt aatttccagc 1020

cttcaagaag acagacattt agaagaagag ctgaaatgtc aggaacaaaa agaagaacag 1080

ctgcaggaag gggtgcaccg gaaggagccc cagggggcca cgtag 1125

<210> 3

<211> 331

<212> PRT

<213>Artificial sequence

<400> 3

Met Asp Pro Gln Cys Thr Met Gly Leu Ser Asn Ile Leu Phe Val Met

1 5 10 15

Ala Phe Leu Leu Ser Gly Ala Ala Pro Leu Lys Ile Gln Ala Tyr Phe

20 25 30

Asn Glu Thr Ala Asp Leu Pro Cys Gln Phe Ala Asn Ser Gln Asn Gln

35 40 45

Ser Leu Ser Glu Phe Sec Trp Val Phe Trp Gln Asp Gln Glu Asn Phe

50 55 60

Sec Trp Leu Asn Glu Val Tyr Leu Gly Lys Glu Lys Phe Asp Ser Val

65 70 75 80

His Ser Lys Tyr Met Gly Arg Thr Ser Phe Asp Ser Asp Ser Trp Thr

85 90 95

Leu Arg Leu His Asn Leu Gln Ile Lys Asp Lys Gly Leu Tyr Gln Cys

100 105 110

Ile Ile His His Lys Lys Pro Thr Gly Met Ile Arg Ile His Gln Met

115 120 125

Asn Ser Glu Leu Ser Val Leu Ala Asn Phe Ser Gln Pro Glu Ile Val

130 135 140

Pro Ile Ser Asn Ile Thr Glu Asn Val Tyr Ile Asn Leu Thr Cys Ser

145 150 155 160

Ser Ile His Gly Tyr Pro Glu Pro Lys Lys Met Ser Val Leu Leu Arg

165 170 175

Thr Lys Asn Ser Thr Ile Glu Tyr Asp Gly Ile Met Gln Lys Ser Gln

180 185 190

Asp Asn Val Thr Glu Leu Tyr Asp Val Ser Ile Ser Leu Ser Val Ser

195 200 205

Phe Pro Asp Val Thr Ser Asn Met Thr Ile Phe Cys Ile Leu Glu Thr

210 215 220

Asp Lys Thr Arg Leu Leu Ser Ser Pro Phe Ser Ile Glu Leu Glu Asp

225 230 235 240

Pro Gln Pro Pro Pro Asp His Ile Pro Trp Ile Thr Ala Val Leu Pro

245 250 255

Thr Val Ile Ile Cys Val Met Val Phe Cys Leu Ile Leu Trp Lys Trp

260 265 270

Lys Lys Lys Lys Arg Pro Arg Asn Ser Tyr Lys Cys Gly Thr Asn Thr

275 280 285

Met Glu Arg Glu Glu Ser Glu Gln Thr Lys Lys Arg Glu Lys Ile His

290 295 300

Ile Pro Glu Arg Ser Asp Glu Thr Gln Arg Val Phe Lys Ser Ser Lys

305 310 315 320

Thr Ser Ser Cys Asp Lys Ser Asp Thr Cys Phe

325 330

<210> 4

<211> 990

<212> DNA

<213>Artificial sequence

<400> 4

atggatcccc agtgcactat gggactgagt aacattctct ttgtgatggc cttcctgctc 60

tctggtgctg ctcctctgaa gattcaagct tatttcaatg agactgcaga cctgccatgc 120

caatttgcaa actctcaaaa ccaaagcctg agtgagctag tagtattttg gcaggaccag 180

gaaaacttgg ttctgaatga ggtatactta ggcaaagaga aatttgacag tgttcattcc 240

aagtatatgg gccgcacaag ttttgattcg gacagttgga ccctgagact tcacaatctt 300

cagatcaagg acaagggctt gtatcaatgt atcatccatc acaaaaagcc cacaggaatg 360

attcgcatcc accagatgaa ttctgaactg tcagtgcttg ctaacttcag tcaacctgaa 420

atagtaccaa tttctaatat aacagaaaat gtgtacataa atttgacctg ctcatctata 480

cacggttacc cagaacctaa gaagatgagt gttttgctaa gaaccaagaa ttcaactatc 540

gagtatgatg gtattatgca gaaatctcaa gataatgtca cagaactgta cgacgtttcc 600

atcagcttgt ctgtttcatt ccctgatgtt acgagcaata tgaccatctt ctgtattctg 660

gaaactgaca agacgcggct tttatcttca cctttctcta tagagcttga ggaccctcag 720

cctcccccag accacattcc ttggattaca gctgtacttc caacagttat tatatgtgtg 780

atggttttct gtctaattct atggaaatgg aagaagaaga agcggcctcg caactcttat 840

aaatgtggaa ccaacacaat ggagagggaa gagagtgaac agaccaagaa aagagaaaaa 900

atccatatac ctgaaagatc tgatgaaacc cagcgtgttt ttaaaagttc gaagacatct 960

tcatgcgaca aaagtgatac atgtttttaa 990

<210> 5

<211> 257

<212> PRT

<213>Artificial sequence

<400> 5

Met Glu Tyr Ala Ser Asp Ala Ser Leu Asp Pro Glu Ala Pro Trp Pro

1 5 10 15

Pro Ala Pro Arg Ala Arg Ala Cys Arg Val Leu Pro Trp Ala Phe Sec

20 25 30

Trp Ala Gly Leu Leu Leu Leu Leu Leu Leu Ala Ala Ala Cys Ala Val

35 40 45

Phe Leu Ala Cys Pro Trp Ala Val Ser Gly Ala Arg Ala Ser Pro Gly

50 55 60

Ser Ala Ala Ser Pro Arg Leu Arg Glu Gly Pro Glu Leu Ser Pro Asp

65 70 75 80

Asp Pro Ala Gly Leu Leu Asp Leu Arg Gln Gly Met Phe Ala Gln Sec

85 90 95

Cys Trp Ala Gln Asn Val Leu Leu Ile Asp Gly Pro Leu Ser Trp Tyr

100 105 110

Ser Asp Pro Gly Leu Ala Gly Val Ser Leu Thr Gly Gly Leu Ser Tyr

115 120 125

Lys Glu Asp Thr Lys Glu Phe Sec Trp Val Ala Lys Ala Gly Val Tyr

130 135 140

Tyr Val Phe Phe Gln Leu Glu Leu Arg Arg Val Val Ala Gly Glu Gly

145 150 155 160

Ser Gly Ser Val Ser Leu Ala Leu His Leu Gln Pro Leu Arg Ser Ala

165 170 175

Ala Gly Ala Ala Ala Leu Ala Leu Thr Val Asp Leu Pro Pro Ala Ser

180 185 190

Ser Glu Ala Arg Asn Ser Ala Phe Gly Phe Gln Gly Arg Leu Leu His

195 200 205

Leu Ser Ala Gly Gln Arg Leu Gly Val His Leu His Thr Glu Ala Arg

210 215 220

Ala Arg His Ala Trp Gln Leu Thr Gln Gly Ala Thr Val Leu Gly Leu

225 230 235 240

Phe Arg Val Thr Pro Glu Ile Pro Ala Gly Leu Pro Ser Pro Arg Ser

245 250 255

Glu

<210> 6

<211> 765

<212> DNA

<213>Artificial sequence

<400> 6

atggaatacg cctctgacgc ttcactggac cccgaagccc cgtggcctcc cgcgccccgc 60

gctcgcgcct gccgcgtact gccttgggcc ctggtcgcgg ggctgctgct gctgctgctg 120

ctcgctgccg cctgcgccgt cttcctcgcc tgcccctggg ccgtgtccgg ggctcgcgcc 180

tcgcccggct ccgcggccag cccgagactc cgcgagggtc ccgagctttc gcccgacgat 240

cccgccggcc tcttggacct gcggcagggc atgtttgcgc agctggtggc ccaaaatgtt 300

ctgctgatcg atgggcccct gagctggtac agtgacccag gcctggcagg cgtgtccctg 360

acggggggcc tgagctacaa agaggacacg aaggagctgg tggtggccaa ggctggagtc 420

tactatgtct tctttcaact agagctgcgg cgcgtggtgg ccggcgaggg ctcaggctcc 480

gtttcacttg cgctgcacct gcagccactg cgctctgctg ctggggccgc cgccctggct 540

ttgaccgtgg acctgccacc cgcctcctcc gaggctcgga actcggcctt cggtttccag 600

ggccgcttgc tgcacctgag tgccggccag cgcctgggcg tccatcttca cactgaggcc 660

agggcacgcc atgcctggca gcttacccag ggcgccacag tcttgggact cttccgggtg 720

acccccgaaa tcccagccgg actcccttca ccgaggtcgg aataa 765

<210> 7

<211> 403

<212> PRT

<213>Artificial sequence

<400> 7

Met Trp Leu Gln Ser Leu Leu Leu Leu Gly Thr Val Ala Cys Ser Ile

1 5 10 15

Ser Gln Gly Gln Asp Arg His Met Ile Arg Met Arg Gln Leu Ile Asp

20 25 30

Ile Val Asp Gln Leu Lys Asn Tyr Val Asn Asp Phe Sec Trp Pro Glu

35 40 45

Phe Leu Pro Ala Pro Glu Asp Val Glu Thr Asn Cys Glu Trp Ser Ala

50 55 60

Phe Ser Cys Phe Gln Lys Ala Gln Leu Lys Ser Ala Asn Thr Gly Asn

65 70 75 80

Asn Glu Arg Ile Ile Asn Val Ser Ile Lys Lys Leu Lys Arg Lys Pro

85 90 95

Pro Ser Thr Asn Ala Gly Arg Arg Gln Lys His Arg Leu Thr Cys Pro

100 105 110

Ser Cys Asp Ser Tyr Glu Lys Lys Pro Pro Lys Glu Phe Leu Glu Arg

115 120 125

Phe Lys Ser Leu Leu Gln Lys Met Ile His Gln His Leu Ser Ser Arg

130 135 140

Thr His Gly Ser Glu Asp Ser Glu Ser Lys Tyr Gly Pro Pro Cys Pro

145 150 155 160

Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe

165 170 175

Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val

180 185 190

Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe

195 200 205

Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro

210 215 220

Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr

225 230 235 240

Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val

245 250 255

Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala

260 265 270

Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln

275 280 285

Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Phe Sec Trp Lys

290 295 300

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

305 310 315 320

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

325 330 335

Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln

340 345 350

Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

355 360 365

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys Met Ala Leu

370 375 380

Ile Val Leu Gly Gly Val Ala Gly Leu Leu Leu Phe Ile Gly Leu Gly

385 390 395 400

Ile Phe Phe

<210> 8

<211> 1206

<212> DNA

<213>Artificial sequence

<400> 8

atgtggcttc agtctctgct tctgctcggg actgtcgcgt gttccatttc acagggacag 60

gatagacaca tgatccggat gcgccagctg atcgacatag tcgatcagct gaaaaactat 120

gttaacgatt tggtgcctga gtttcttccc gctcccgaag acgttgaaac taattgtgag 180

tggtccgcct tcagctgctt ccagaaagct cagctgaagt ccgcaaacac cggcaacaat 240

gagagaatta tcaacgtatc tatcaagaaa ctgaaaagaa aaccaccaag cactaatgct 300

ggccgccgac aaaagcacag gctgacttgt ccgtcctgtg acagctacga gaagaagccc 360

cccaaagagt tcctggagag gtttaaaagt ctgctgcaga agatgatcca ccaacacctg 420

agcagtcgaa cccacggaag cgaggattca gagagtaagt atggtccacc ttgtccacct 480

tgccctgcgc ccgagttttt gggcggaccg tctgtgttcc tgttcccacc caaacccaag 540

gatacgctga tgatctctcg gactcctgag gtcacttgcg tggtggtgga cgtctcacag 600

gaggacccag aggtgcagtt taactggtac gtggacggcg tggaagtgca caacgccaag 660

actaaaccta gggaagagca gtttaacagc acatacagag tagttagtgt tctcaccgtg 720

ctgcatcagg attggctcaa cggcaaagag tataagtgta aggtcagtaa taagggactg 780

cccagcagca tcgagaagac aatcagcaag gccaagggac aacctcgcga accccaagtt 840

tataccttgc ctccgtcaca ggaggagatg accaaaaatc aggtgtcact gacatgtctg 900

gtgaaaggtt tctacccgtc cgatatcgcc gtggaatggg agtctaacgg gcagccggag 960

aataactata agacaacccc cccagtcctg gattcagatg ggagcttttt cctctactca 1020

aggctcacag tggataaatc acggtggcaa gaaggcaatg tcttctcctg ctcagtcatg 1080

cacgaagctc tgcacaacca ttatacccag aaaagcctta gtctttctct gggaaagatg 1140

gccctgatcg tgctgggtgg tgtggctgga cttctgctct ttattggact ggggattttt 1200

ttctga 1206

Claims

1. a kind of genetically engineered cell, which is characterized in that the genetically engineered cell K562-APC3-mbIL21, cell membrane table Expression CD64, CD86,41BBL is stablized in face and film fixes IL-21.

2. the structure encoded amino acid sequences of K562-APC3-mbIL21 as described in claim 1, it is characterised in that

The amino acid sequence of the CD64 such as SEQ ID NO:Shown in 1；

The amino acid sequence of the CD86 such as SEQ ID NO:Shown in 3；

The amino acid sequence of the 41BBL such as SEQ ID NO:Shown in 5；

The amino acid sequence of the mbIL21 such as SEQ ID NO:Shown in 7.

3. polynucleotide sequence as claimed in claim 2, it is characterised in that

The polynucleotide sequence of the CD64 such as SEQ ID NO:Shown in 2；

The polynucleotide sequence of the CD86 such as SEQ ID NO:Shown in 4；

The 41BBL polynucleotide sequences such as SEQ ID NO:Shown in 6；

The mbIL21 polynucleotide sequences such as SEQ ID NO:Shown in 8.

4. a kind of genetically engineered cell according to claim 1, which is characterized in that the genetically engineered cell is K562- APC3-mbIL21 cells.

5. the preparation method of genetically engineered cell described in claim 1, which is characterized in that include the following steps：

(1) structure expresses the slow virus carrier of CD64, CD86,41BBL and mbIL-21 respectively；

(2) tri- slow virus cotransfection K562 cells of CD64, CD86,41BBL, fluidic cell detection of expression, acquisition CD64, CD86,41BBL stablize 562 cell of expressing K and import the IL-21 that cell membrane surface stablizes expression on this basis, establish K562- APC3-mbIL21。

6. the preparation method of genetically engineered cell according to claim 5, which is characterized in that the genetically engineered cell is K562-APC3-mbIL21 cells.

7. application of the genetically engineered cell in the amplification of NK cells described in claim 1 or 4.

8. a kind of NK methods for cell expansion, which is characterized in that expanded, wrapped using genetically engineered cell described in claim 1 Include following steps：

(1) slow virus carrier of structure CD64, CD86,41BBL and mbIL-21 expression；

(2) the corresponding cell of tri- slow virus cotransfections of CD64, CD86,41BBL, fluidic cell detection of expression, acquisition CD64, CD86,41BBL stablize expression cell and import the IL-21 that cell membrane surface stablizes expression on this basis, establish K562-APC3- mbIL21；

(3) genetically engineered cell that lethal exposure or mitomycin processing step (2) obtain, by 1:2 is thin with the NK after sorting Born of the same parents mix, and are cultivated altogether in NK cell amplification cultivation liquid；

(4) repetitive stimulation 1 time weekly, continued stimulus 2 weeks, to obtain the NK cells of sufficient amount.

9. a kind of NK methods for cell expansion according to claim 8, which is characterized in that the genetically engineered cell be for K562-APC3-mbIL21。

10. such as application of the method for claim 1-9 any one of them efficient amplification NK cells in cell therapy field.