CN108277276A - A kind of application of the long-chain non-coding RNA and combinations thereof in diagnosis/treatment gastric cancer - Google Patents
A kind of application of the long-chain non-coding RNA and combinations thereof in diagnosis/treatment gastric cancer Download PDFInfo
- Publication number
- CN108277276A CN108277276A CN201711485001.XA CN201711485001A CN108277276A CN 108277276 A CN108277276 A CN 108277276A CN 201711485001 A CN201711485001 A CN 201711485001A CN 108277276 A CN108277276 A CN 108277276A
- Authority
- CN
- China
- Prior art keywords
- nfia
- gastric cancer
- cell
- long
- coding rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Pathology (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Oncology (AREA)
- Molecular Biology (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Hospice & Palliative Care (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to genetic engineering field, more particularly to a kind of long-chain non-coding RNA, NFIA AS1 and combinations thereof, the application in preparing diagnosis of gastric cancer and target drug treatment.Meanwhile the invention further relates to its primer, the application in preparing diagnosis of gastric cancer reagent.By studying the expression of the long-chain non-coding RNA cellular level, the relationship of itself and incidence gastric cancer mechanism is disclosed.
Description
Technical field
The invention belongs to genetic engineering field, more particularly to a kind of long-chain non-coding RNA, NFIA-AS1 and combinations thereof,
Application in preparing diagnosis of gastric cancer and target drug treatment.Meanwhile the invention further relates to its primers, are preparing diagnosis of gastric cancer examination
Application in agent.
Background technology
Gastric cancer (GC) is to lead to dead world's second largest cancer.The state of an illness fast development and transfer cause its prognosis compared with
Difference.In order to improve early diagnosis and the targeted therapy of GC, there is an urgent need to understand its potential molecular mechanism and determine new, effectively
New biomarker and therapy target.
Long-chain non-coding RNA (lncRNAs) is the RNA molecule that a kind of transcript length is more than 200nt, and it is small to be different from other
Molecule non-coding RNA, can cis- (in cis) or trans- (in trans) effect mode adjust RNA metabolism, protein
Functional activity, histone modification and chromatin remodeling are given birth in epigenetics, transcription and post-transcriptional level wide participation cell
Object process.Non-coding RNA (ncRNA) is the RNA that can not be translated into protein.It is divided into two major classes：Tiny RNA (＜ 200NT)
And lncRNAs.Small ncRNA includes microRNA, siRNA and DNA, has been proved to play important work in gastric cancer occurs
With.In recent years, many studies have shown that lncRNAs participates in the generation of a variety of diseases, there are multiple functions in extensive bioprocess,
It is especially related to human carcinomas card morbidity.Researches show that：In addition to the encoding gene that these have been widely studied, long non-coding RNA
The unconventionality expression of (long noncoding RNAs, lncRNAs) also assists in malignancy of tumor progress.More and more research confirmations,
LncRNAs not only plays important regulating and controlling effect, unconventionality expression in the normal physiological function and growth course for maintaining body
The malignant progression of occurrence and development especially tumour with disease has close contact.One well-known carcinogenic lncRNA ginseng
Pathogenesis with tumour is HOTAIR (HOX transcribes antisense gene RNA), it is raised always, and the result for being determined as patient is strong
Strong prognostic marker such as influences the survival rate of a variety of human patients with tumors.
Recently, there is many studies have shown that lncRNA high expression in stomach organization, meanwhile, show as low expression.Therefore anxious
New lncRNAs need to be found, and inquires into its biological effect to gastric cancer, it is latent with gene therapy in gastric cancer for diagnosing to obtain
In therapy target.
Invention content
The object of the present invention is to provide a kind of long-chain non-coding RNAs to treat in the reagent for preparing diagnosis of gastric cancer and preparing
Application in gastric cancer medicament.The present invention uses following technical scheme：
A kind of long-chain non-coding RNA, NFIA-AS1, which is characterized in that length 392bp, nucleotide sequence is such as>NR_
104180.1Homo sapiens NFIA antisense RNA 1(NFIA-AS1),long non-coding RNA SEQ
ID NO:1
GGCCATGAGAAGCTCAAGTTCACCATGAGCCACAGCAGTAAGCCATGCTTTAGCCT
CTGACCTGTGCTCC
AATTTTGGTACAATGATTTCTGCCATGTTCTCCAACAGGGTGAGGAAACAGACAGC
ACTAAGAGAAAAAG
CTGGAACTCAAAACCAAATTAACTCCAAACTTAAGTTTTCCCACTTCGACAAGAAA
AGGAACTGCATGTG
TTTTTCTGCCTCTTGCAGATGTATGTCATAAAAGTTGGATGCCTTCCTTTCAAGACAT
TTGAATGGATCA
CCAAATAATTACCTACTTTTCTCTCACAACTCAGATAAATAATTAAAAGGAGATATAC
ACAGATTGGTTG
CATACTTAAGAGTGAGAATCAATTAAAACAAAATTGTATGCA
The present invention also provides a kind of reagent answering in preparing diagnosis of gastric cancer reagent of the above-mentioned long-chain non-coding RNA of detection
With.
The present invention also provides the detection examinations of a kind of composition, including diagnosis long-chain non-coding RNA described in claim 1
Agent.
The present invention also provides a kind of primers of detection NFIA-AS1, which is characterized in that its nucleotide sequence such as SEQ ID
NO：2, shown in 3, i.e.,：SEQ ID NO:2NFIA-AS1FACCATGAGCCACAGCAGTAA, SEQ ID NO：3 NFIA-
AS1RCTGTTTCCTCACCCTGTTGGA。
Detect application of the primer of NFIA-AS1 in preparing diagnosis of gastric cancer pharmaceutical agent.
A kind of kit, including above-mentioned primer；Preferably, in the kit primer a concentration of 0.01~0.1mol/
L。
A kind of pharmaceutical composition for treating knot gastric cancer, including the inhibitor of NFIA-AS1.
Further, in described pharmaceutical composition, the agonist of NFIA-AS1 is the overexpression plasmid vector of NFIA-AS1,
I.e. by the plasmid dna sequence of restriction endonuclease modified.
Technical thought
The present invention is thin from three clinical tissue sample, cell, animal experiment in vivo layer viewpoint NFIA-AS1 regulation and control gastric cancers
The mechanism of action of the pernicious process of born of the same parents, with relationship of the qPCR equimolecular biology techniques means between NFIA-AS1 and target gene
It verifies.
Advantageous effect
1. the expression of lncRNA is significantly lowered in stomach organization；
2. patients with gastric cancer Overall survival is shorter (P ＜ 0.001) related to the decline of NFIA-AS1 levels；
The expression of 3.NFIA-AS1 has the function of that stomach cancer cell is inhibited to be proliferated in vitro and in vivo；
The proliferation of the inhibition stomach cancer cell of 4.NFIA-AS1 is by inhibiting the expression of albumen P15 to play a role.
The present invention has significant scientific meaning：The expression of NFIA-AS1 is significantly lowered in stomach organization；This research
Abundant lncRNAs is regulated and controled the molecular mechanism of gastric cancer occurrence and development by successful implementation, is disclosed NFIA-AS1 and be can be used as stomach diagnosis, pre-
Marker afterwards provides experiment and theoretical foundation for clinic early carcinoma of stomach clinical diagnosis and treatment.
Description of the drawings
Fig. 1：Analyze expression and and clinical parameter of the NFIA-AS1 in GC patient tissues
Fig. 2：NFIA-AS1 is related to the poor prognosis of GC patient
Fig. 3：Promote stomach cancer cell migration and cell cycle in vitro
Fig. 4：NFIA-AS1 influences P15 and P16 expressions
Fig. 5：The influence that in-vivo tumour occurs for NFIA-AS1
Specific implementation mode
It is further illustrated the present invention below with embodiment, but the present invention is not intended to be limited thereto.It is not noted in the following example
The experimental method of bright actual conditions, usually according to normal condition, or according to the normal condition proposed by manufacturer.
One, tissue collecting
Based on histopathological analysis (foundation《7th edition AJCC Cancer Staging Handbook》), we have collected 42 2006
To the patients with gastric cancer in Jiangsu Prov. People's Hospital receiving diagnosis and operative treatment in 2008.Tissue specimen collection is first
Time liquid nitrogen is stored in -80 DEG C, until RNA is extracted.The research is ratified by Ethics Committee of Nanjing Medical University.Obtain institute
There is the written informed consent of patient.
Two, experimental facilities and reagent
Experimental method used in the present invention and investigative technique：As the extraction of total serum IgE, MTT and clone technology, cell turn
Dye, Transwell technologies, EdU experiments, the use etc. of fluorescence real-time quantitative PCR, bioinformatic database；Required reality
It is commercially available to test material such as antibody, kit etc..
Team of the present invention relies on Nanjing Medical University, required each equipment, such as fluorescence quantitative PCR instrument, flow cytometer, enzyme mark
Instrument, CO2Incubator, low-temperature and high-speed centrifuge, fluorescence inverted microscope, laser confocal microscope etc. and experimental animal,
It can be used directly.
Three, cell experiment
1. cell line and condition of culture
4 kinds of stomach cancer cells (SGC7901, BGC823, HGC27, AGS) and normal gastric mucosa epithelial cell (GES-1) are purchased
In Chinese Academy of Sciences's biochemistry and Institute of Cell Biology (Shanghai, China).Cell culture：Culture be RPMI 1640 or
DMEM culture mediums, wherein containing 10% fetal calf serum, the penicillin of 100U/ml, the streptomysin of streptomysin 100mg/ml；5%
CO2, routine culture in 37 DEG C of constant incubators, the replacement fresh culture per 2-3 days, when cell fusion degree reaches 80%-90%
Shi Chuandai.All cell lines are verified by the DNA analysis of short tandem repeat.
2. cell transfecting
The primer sequence of complete sequence (NR_104180 in NCBI) synthesis NFIA-AS1 based on lncRNA NFIA-AS1,
Then carrier P DNA (Invitrogen, Shanghai, China) are cloned into.It is pair with empty vectors according to the application method of specification
According to pCDNA-NFIA-AS1 is transfected into stomach cancer cell using X-tremeGENE HP DNA reagents, and (Roche, Basel are auspicious
Scholar), after transfecting 48h, collects cell extraction RNA or albumen carries out real-time quantitative RT-PCR or Western blot analysis
(western blotting)。
3.RNA is extracted and quantitative PCR analysis
According to the operation instruction of reagent, with Trizol reagents separation total serum IgE (Invitrogen companies, Carlsbad,
CA).Reverse transcription application Transcription Kit kits (TaKaRa, Dalian, China).Pass through Power SYBR Green
Kit (Takara, Dalian, China) carries out real-time PCR analysis.Using the normal expression of GAPDH as experimental result.Used
Primer sequence is as follows：
NFIA-AS1F:5’-ACCATGAGCCACAGCAGTAA-3’；
NFIA-AS1R:5’-CTGTTTCCTCACCCTGTTGGA-3’；
GAPDH F:5’-GTCAACGGATTTGGTCTGTATT-3’；
GAPDH R:5’-AGTCTTCTGGGTGGCAGTGAT-3’。
Real-time fluorescence quantitative PCR carries out data acquisition using ABI 7500.Interpretation of result：Analyze specificity and the expansion of primer
Increasing Efficiency judges the atopic of primer according to solubility curve.Obtain Ct values according to amplification curve, using relative measurement with it is interior
Join the analysis that GAPDH carries out target gene relative expression quantity.Calculation formula is：2^ (- △ Ct), △ Ct=Ct gene-Ct
control。
4. cell proliferation experiment
Cell proliferation test is carried out with MTT kits (Sigma, St.Louis, Mo).By treated, cell is pressed per hole
2000-3000 cell inoculation is once assessed for every 24 hours in 96 well culture plates.It is placed in the culture containing 10% fetal calf serum
It is cultivated in base 2 weeks, replaces a culture solution within every 4 days.Bacterium colony is fixed with methanol, be used in combination 0.1% crystal it is purple (sigma,
St.Louis, Mo) dyeing.Then bacterium colony counting is carried out.
5.EdU is tested
Cell Proliferation is marked with EDU and kit is detected (sharp rich biotechnology, Guangzhou, China).By stomach cancer cell
It is placed in 24 orifice plates, cell in 24 orifice plates is handled with interference sequence, 50 μm of label culture mediums are added, are incubated 2 hours at 37 DEG C,
It is incubated at 5% DEG C.At room temperature, 30min then is handled with 4% paraformaldehyde (pH 7.4), with TritonX-100 processing
20min handles 30min with PBS buffer solutions, with poststaining, at room temperature, and after 30min, cell Hoechst 33,342 100
μ L are incubated (5 μ g/ml) then in fluorescence microscopy microscopic observation.With five random field computation positive percentages.
6. cell migration Matrigel
The cells Transwell of 8 μm of pore sizes are placed in 24 orifice plates.Cell migration assay, adjustment cell density to 0.5
× 105 or × 105.Take 100 μ l of cell suspension that the cells Transwell are added.700 μ l are added containing 10% in room under 24 orifice plates
The culture medium of FBS is put into incubator routine culture for 24 hours.Cell is taken, matrigel and upper indoor cell are wiped with cotton swab, is used
0.1% crystal violet is right using IX71 microscopes (Olympus, Tokyo, Japan) by the cell dyeing of cell outer bottom
The cell of the cells the Transwell counterdie dyeing of room side attachment up and down is taken pictures counting.
Four, nude mouse tumor forms experiment
According to agreement, by the approval of Nanjing Medical University's animal core facility, in the case where keeping no-special pathogen, to 5 weeks
The male nude mouse Balb/c mouse in age are operated.Blank control gene or the gene containing pCDNA-NFIA-AS1 are transfected to stomach
Cancer cell SGC7901, culture to 2 × 107Cell/ml collects cell suspending liquid, enrichment of cell, and 0.1 milliliter of hypodermic injection is arrived naked
The trailing flank both sides of mouse.Every 2 days genomes for measuring control groups and pCDNA-NFIA-AS1 tumor sizes and weight (four/
Group)；The size of tumour is (with length × wide2×0.5).Mouse is put to death after injecting 16 days, measures tumor weight.
Five, data analysis and experimental result
1. data analysis
It is for statistical analysis using 18 software packages of SPSS (Chicago, IL).It is examined with t or Chi-square Test is tested.It adopts
Survival analysis is carried out with Kaplan Meier methods, logarithm is used in combination to examine the difference compared between patient group.P value ＜ 0.05 is considered
With statistical significance.
2. experimental result
2.1 tissues are horizontal：Expression of the NFIA-AS1 in stomach organization is lowered
2.1.1qRT-PCR expression of the experimental study NFIA-AS1 in gastric cancer tumor tissue.NFIA-AS1 is in stomach organization
It is as shown in Figure 1a with the expression in cancer beside organism.Compare 42 pairs of patient's stomach organizations and cancer beside organism, finds the cancer side group that compares
It knits, NFIA-AS1 expressions are below in corresponding normal structure, and compared with Normal group, median ratio is 0.64
(Figure 1A).
2.1.2GC the relationship of patient clinical pathological factor and NFIA-AS1 expressions.The result shows that the table of NFIA-AS1
Up to related to tumor size, histological grade, TNM stage.Tumour is bigger, degree of tissue differentiation is lower, and TNM stage is proportionate
Tumour its NFIA-AS1 expression decline respectively, as shown in Figure 1B-D.The Clinical symptoms of all patients is as shown in table 1：
The clinical pathologic characteristic of 1 patients with gastric cancer of table
* Chi-square Test
*P<0.05
Further, we have evaluated expression and the relationship of survival of NFIA-AS1.According to tumor patient median
(0.64) expression is classified, and above-mentioned 42 cancer patients is divided into two groups, high relevant group (n=21, NFIA-AS1 table
Up to than >=intermediate value ratio, red column) and relevant group (n=21, NFIA-AS1 express ratio≤intermediate value ratio, blue column) (such as Fig. 1 E institutes
Show).Use Kaplan-Meier survival analysis and Log-Rank Test.As shown in fig. 1F, patients with gastric cancer Overall survival it is shorter with
NFIA-AS1 levels decline related (P ＜ 0.001).
2.2 experiment in vitro：The overexpression of NFIA-AS1 inhibits proliferation of human gastric cancer cell
Tested by qRT-PCR, NFIA-AS1 is to gastric carcinoma cell lines SGC7901, BGC823, AGS for evaluation, HGC27 and
The influence of normal gastric mucosa epithelial cell line GES-1 functions, the results show that compared with normal gastric mucosa cell line, NFIA-AS1
Expression in gastric carcinoma cell lines SGC7901 and AGS significantly lowers (see Fig. 2A) to adjust NFIA-AS1 in stomach cancer cell
Gene level transfects PcDNA-NFIA-AS1 to AGS, SGC7901 cell, and is carried out with control group using qRT-PCR analyses
Comparative assessment (result is shown in Fig. 2 B).Also, mtt assay and Colony forming experiment are carried out after transfecting.Mtt assay is the results show that with compareing
Group is compared, it is found that SGC7901 and AGS the proliferation quantity of transfection group significantly reduce (see Fig. 2 C)；The colony counts of the two are also notable
It reduces (see Fig. 2 D).(EDU) (red)/DAPI (blue) immunohistochemical staining also demonstrates this result；Express NFIA-AS1
Cancer cell multiplication rate can be significantly reduced (see Fig. 2 E).It is above-mentioned the experimental results showed that, NFIA-AS1 can be used as proliferation of human gastric cancer cell
Suppressor.
2.3 experiment in vitro：Promote gastric cancer cell cycle and the cell migration of in vitro culture
Flow cytometry analysis is carried out, influences of the NFIA-AS1 to GC cell Proliferations is further inquired into, compared with the control group,
As a result show that the SGC7901 cells containing NFIA-AS1, cell cycle progression are obviously stuck in G1-G0 phase cells.It is thin in gastric cancer
Also it observed similar result in born of the same parents AGS (see Fig. 3 A).Cell migration is an importance of tumour progression, so we
The migration of GC cells is assessed using the cells Transwell method.As shown in Figure 3B, it is overexpressed NFIA-AS1, inhibits stomach cancer cell
The transfer ability of SGC7901 and AGS, migrating cell number significantly reduce.The above results show that NFIA-AS1 has carcinogenic nature,
It can promote the migration of stomach cancer cell.
2.4 NFIA-AS1 inhibit the growth of CRC tumour cells in vivo
For inquire into NFIA-AS1 expression in vivo to the influence of tumour growth, respectively by NFIA-AS1pcdna-
Nfia-as1 and the gastric carcinoma cell line SGC-7901 of empty carrier transfection are inoculated into male nude mouse.All mouse occur different in injection site
Kind transplantable tumor.As shown in figures 5 a-b, 16 days after injection, the tumour growth of NFIA-AS1 overexpression groups obviously subtracts compared with control group group
Slowly；As shown in Figure 5 C, it is significantly lower than control group in PcDNA-NFIA-AS1 group average knurl weights.In addition, as shown in Figure 5 D, H＆E dyes
The characteristic feature of color tumor cells showed, and proliferation index Ki-67 evaluations are detected by immunohistochemical staining and are found, NFIA-AS1
The tumour of transfection group is obviously reduced.In short, the above results show that NFIA-AS1 can obviously inhibit the life of stomach cancer cell in vivo
It is long.
2.5 P15 are the downstream gene media of NFIA-AS1 keys
By comparing the growth inhibition effect to control group and transfection group, the potential overexpression of NFIA-AS1 is further inquired into
Mechanism.Compared with the control group, in mRNA level in-site, the P15 genes in transfection group significantly raise, on the contrary, P21, P27 and P57
Gene there is no up-regulation (see Fig. 4 A) the studies above statistics indicate that, the mechanism of action of NFIA-AS1 after transcription perhaps through adjusting
The expression for saving P15 come what is played a role, and needs further experiment to illustrate its potential mechanism.
SEQUENCE LISTING
<110>Nanjing Pukou Central Hospital
<120>A kind of application of the long-chain non-coding RNA and combinations thereof in diagnosis/treatment gastric cancer
<130> CP11704287C
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 392
<212> DNA
<213>Artificial sequence
<400> 1
ggccatgaga agctcaagtt caccatgagc cacagcagta agccatgctt tagcctctga 60
cctgtgctcc aattttggta caatgatttc tgccatgttc tccaacaggg tgaggaaaca 120
gacagcacta agagaaaaag ctggaactca aaaccaaatt aactccaaac ttaagttttc 180
ccacttcgac aagaaaagga actgcatgtg tttttctgcc tcttgcagat gtatgtcata 240
aaagttggat gccttccttt caagacattt gaatggatca ccaaataatt acctactttt 300
ctctcacaac tcagataaat aattaaaagg agatatacac agattggttg catacttaag 360
agtgagaatc aattaaaaca aaattgtatg ca 392
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
accatgagcc acagcagtaa 20
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence
<400> 3
ctgtttcctc accctgttgg a 21
<210> 4
<211> 22
<212> DNA
<213>Artificial sequence
<400> 4
gtcaacggat ttggtctgta tt 22
<210> 5
<211> 21
<212> DNA
<213>Artificial sequence
<400> 5
agtcttctgg gtggcagtga t 21
Claims (8)
1. a kind of long-chain non-coding RNA, NFIA-AS1, which is characterized in that length 392bp, nucleotide sequence such as SEQ ID
NO:1
GGCCATGAGAAGCTCAAGTTCACCATGAGCCACAGCAGTAAGCCATGCTTTAGCCTCTGACCTGTGCTCC
AATTTTGGTACAATGATTTCTGCCATGTTCTCCAACAGGGTGAGGAAACAGACAGCACTAAGAGAAAAAG
CTGGAACTCAAAACCAAATTAACTCCAAACTTAAGTTTTCCCACTTCGACAAGAAAAGGAACTGCATGTG
TTTTTCTGCCTCTTGCAGATGTATGTCATAAAAGTTGGATGCCTTCCTTTCAAGACATTTGAATGGATCA
CCAAATAATTACCTACTTTTCTCTCACAACTCAGATAAATAATTAAAAGGAGATATACACAGATTGGTTG
CATACTTAAGAGTGAGAATCAATTAAAACAAAATTGTATGCA。
2. test right requires application of the reagent of the 1 long-chain non-coding RNA in preparing diagnosis of gastric cancer reagent.
3. a kind of composition, which is characterized in that the detection reagent including diagnosing long-chain non-coding RNA described in claim 1.
4. a kind of test right requires the primer of the 1 long-chain non-coding RNA, which is characterized in that its nucleotide sequence such as SEQ
ID NO：2, shown in 3, i.e.,：SEQ ID NO:2 NFIA-AS1 F ACCATGAGCCACAGCAGTAA, SEQ ID NO：3
NFIA-AS1 R CTGTTTCCTCACCCTGTTGGA。
5. application of the primer in preparing diagnosis of gastric cancer reagent described in claim 4.
6. a kind of kit, which is characterized in that including the primer described in claim 4；Preferably, primer in the kit
A concentration of 0.01~0.1mol/L.
7. a kind of pharmaceutical composition for treating gastric cancer, which is characterized in that the agonist including NFIA-AS1.
8. pharmaceutical composition according to claim 7, which is characterized in that the agonist is the overexpression of NFIA-AS1
Plasmid, i.e., by the plasmid dna sequence of restriction endonuclease modified.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711485001.XA CN108277276B (en) | 2017-12-29 | 2017-12-29 | Application of long-chain non-coding RNA and composition thereof in diagnosis/treatment of gastric cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711485001.XA CN108277276B (en) | 2017-12-29 | 2017-12-29 | Application of long-chain non-coding RNA and composition thereof in diagnosis/treatment of gastric cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108277276A true CN108277276A (en) | 2018-07-13 |
| CN108277276B CN108277276B (en) | 2021-08-13 |
Family
ID=62802946
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711485001.XA Expired - Fee Related CN108277276B (en) | 2017-12-29 | 2017-12-29 | Application of long-chain non-coding RNA and composition thereof in diagnosis/treatment of gastric cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108277276B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834288A (en) * | 2016-12-16 | 2017-06-13 | 南京医科大学 | A kind of long non-coding RNA and its application in diagnosis/treatment stomach cancer |
-
2017
- 2017-12-29 CN CN201711485001.XA patent/CN108277276B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834288A (en) * | 2016-12-16 | 2017-06-13 | 南京医科大学 | A kind of long non-coding RNA and its application in diagnosis/treatment stomach cancer |
Non-Patent Citations (3)
| Title |
|---|
| JING WANG,ET AL: "A novel long non-coding RNA NFIA-AS1 is down-regulated in gastric cancer and inhibits proliferation of gastric cancer cells", 《THE JOURNAL OF BIOMEDICAL RESEARCH》 * |
| KANG CM，ET AL: "NR_104180.1", 《GENBANK》 * |
| YANG ZHANG，ET AL: "Long non-coding RNAs as epigenetic mediator and predictor of glioma progression, invasiveness, and prognosis", 《SEMINARS IN CANCER BIOLOGY》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108277276B (en) | 2021-08-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chen et al. | Long noncoding RNA (lncRNA) FOXD2-AS1 promotes cell proliferation and metastasis in hepatocellular carcinoma by regulating MiR-185/AKT axis | |
| CN111718995B (en) | Biomarker for nasopharyngeal carcinoma metastasis diagnosis and/or prognosis evaluation | |
| Yu et al. | Linc00702 inhibits cell growth and metastasis through regulating PTEN in colorectal cancer. | |
| CN107519193B (en) | Molecular diagnostic marker for early stage esophageal squamous carcinoma and application thereof | |
| CN109468382A (en) | Application of the lncRNA in adenocarcinoma of lung diagnosis and treatment | |
| CN109593848A (en) | A kind of tumour correlated series, long-chain non-coding RNA and its application | |
| CN108611420A (en) | Applications of the circ-0000423 in preparing or screening the drug of colon cancer | |
| Wang et al. | circ_0002346 suppresses non‐small‐cell lung cancer progression depending on the regulation of the miR‐582‐3p/STXBP6 Axis | |
| CN110229901A (en) | Gene hsa_circ_0027089 relevant to triple negative breast cancer diagnosis and treatment and its application | |
| Jiang et al. | TGIF2 promotes cervical cancer metastasis by negatively regulating FCMR. | |
| Feng et al. | Overexpression of miR-770 indicates a favorable prognosis and suppresses tumorigenesis by modulating PI3K-AKT pathway in glioma. | |
| CN106520992A (en) | Application of molecular marker STAC2 to oral squamous cell carcinoma | |
| CN111643516A (en) | LncRNA XIST and application of miR-132 combined with LncRNA XIST in inhibition of gastric cancer cell proliferation, invasion and metastasis | |
| CN112575080A (en) | Application of long-chain non-coding RNA molecule in diagnosis and/or treatment of esophageal squamous cell carcinoma | |
| CN110229900A (en) | Gene hsa_circ_0103520 relevant to breast cancer diagnosis and treatment and its application | |
| Qin et al. | High expression of neutrophil cytosolic factor 2 (NCF2) is associated with aggressive features and poor prognosis of esophageal squamous cell carcinoma | |
| CN108277276A (en) | A kind of application of the long-chain non-coding RNA and combinations thereof in diagnosis/treatment gastric cancer | |
| CN110577952B (en) | Application of siRNA interfering long non-coding RNA in preparation of medicine for treating breast cancer | |
| CN111118007B (en) | Application of long non-coding RNA in preparation of medicine for treating cervical cancer | |
| CN110607368B (en) | Application of miRNA3926-1 gene as pancreatic cancer diagnosis and curative effect marker | |
| CN104403996B (en) | Human gastric cancer cell line with 5-fluorouracil resistance and establishment method and application thereof | |
| CN106834482B (en) | Primer, kit, detection method and application for detecting miR-874-3p expression | |
| CN105755154A (en) | Molecular marker differentiating metastatic squamous cell lung carcinoma from non-metastatic squamous cell lung carcinoma | |
| CN111534587A (en) | Molecular marker 5-tRF-His, breast cancer detection kit and application thereof | |
| CN110257522A (en) | Gene hsa_circ_0045881 relevant to breast cancer diagnosis and treatment and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20210813 Termination date: 20211229 |