CN108267596A - A kind of proximity ligation assay is for the quantitatively kit of detection RBP contents, method of preparation and use - Google Patents
A kind of proximity ligation assay is for the quantitatively kit of detection RBP contents, method of preparation and use Download PDFInfo
- Publication number
- CN108267596A CN108267596A CN201711272774.XA CN201711272774A CN108267596A CN 108267596 A CN108267596 A CN 108267596A CN 201711272774 A CN201711272774 A CN 201711272774A CN 108267596 A CN108267596 A CN 108267596A
- Authority
- CN
- China
- Prior art keywords
- rbp
- kit
- probes
- preparation
- ligation assay
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of proximity ligation assay for the kit of quantitatively detection RBP contents.The kit includes：RBP probe A, RBP probes B, connection buffer solution, qPCR reaction solutions；The invention also discloses a kind of proximity ligation assay for quantitatively detecting the preparation method of RBP content kits, this method includes：The preparation of RBP probes A, the preparation of RBP probes B；Finally also disclose the application method of the kit；Originally it is bright for the first time to apply proximity ligation assay method in the quantitative detection of RBP, compared with art methods, there is sensitivity height, high specificity, high throughput, the accuracy of the prediction of renal function disease can be improved, there is great market value.
Description
Technical field
The present invention relates to a kind of proximity ligation assay for the content of RBP in ion vitro immunization diagnosis detection human body, belong to disease
Disease diagnosis detection field.
Background technology
RBP ELISA (RetinoL Binding Protein, RBP) is small by one kind of hepatic secretion in blood plasma
Molecule protein, the polypeptide chain and small part carbohydrate being made of 183 amino acid residues form, without neutral sugar and amino
It is sugared, molecular weight 21,000Da.RBP is mainly synthesized by the rough surfaced endoplasmic reticulum (RER) of liver cell, is distributed widely in human serum, brain ridge
In liquid, urine and other body fluid, finally by urine ejection.It is also the transport protein of vitamin A in blood, in the generation of vitamin A
It plays a significant role in thanking.Since its half-life period is shorter, so more can sensitively reflect the disease condition of body.
In recent years, RBP detections and clinical practice are of increasing concern, detect serum RBP and urine RBP levels to liver,
The early diagnosis of kidney trouble and observation of curative effect are significant, also pass through the index frequently as clinical nutrition status evaluation, are used for
Specifically diagnose early malnutrition.
Method currently used for RBP contents in detection blood, urine is more, common to have enzyme-linked immunosorbent assay and be immunized
Turbidimetry etc..Enzyme-linked immunosorbent assay has the characteristics of easy to operate, the stable reagent phase is long, but enzyme-linked immunosorbent assay
The detection sensitivity of method is relatively low, and is applied to clinic now frequently with immunoturbidimetry, which has tended to be ripe, operation letter
Just, disturbing factor is few, but the emulsion reagent stability of liquid is bad, and testing result accuracy is bad.And base proposed by the present invention
In a kind of immunodiagnosis detection method of proximity ligation assay detection RBP contents, there is detection sensitivity height, detection specificity
The advantages such as by force, sample loss is low, easy to operate, detection device is common, are applied to the monitoring of injury of kidney disease, can improve
The accuracy rate of injury of kidney medical diagnosis on disease has great market value.
Invention content
For the technical problems in the prior art, the present invention provides a kind of detection examination that can be used for quantitatively detection RBP
Agent box, its method of preparation and use.
The invention is realized by the following technical scheme：
A kind of method for preparing the kit that RBP contents are quantitatively detected based on proximity ligation assay, is included the following steps：
1) the RBP probes A of anti-RBP antibody couplings oligonucleotide；
2) the RBP probes B of anti-RBP antibody couplings oligonucleotide；
In the above-mentioned technical solutions, the anti-RBP antibody is the monoclonal antibody or Anti-TNF-α for RBP different epitopes
Body.
The prepared RBP detection kits based on proximity ligation assay according to any of the above technical solution.It is led
Form including：
1) RBP probes A；
2) RBP probes B；
3) buffer solution is connected；
4) qPCR reaction solutions.
The application method of kit described in any of the above technical solution, it is characterised in that：Include the following steps：
1) sample to be tested is added in reacting hole, adds RBP probe A and RBP probe B, added in after being incubated 5-30min
To connection buffer solution reaction 5-30min, finally mixed with qPCR reaction solutions；
2) to it is above-mentioned 1) in end reaction liquid carry out qPCR, the Ct values of each reacting hole of survey calculation.
The reacting hole of this kit can be microwell plate, micro-fluidic reagent disc, reaction cup, reaction tube etc..
Description of the drawings
Fig. 1 is that a kind of kit of the proximity ligation assay provided in an embodiment of the present invention for quantitatively detection RBP contents is former
Schematic diagram is managed, wherein, 1- oligodeoxynucleotide, 2- coupling agents, the anti-RBP antibody of 3-, 4- determinands (RBP), 5- oligomerization deoxidations
Nucleotide, 6- coupling agents, the anti-RBP antibody of 7-, 8-Taqman fluorescence probes, 9-Taq enzymes
Fig. 2 is a kind of kit inspection of the proximity ligation assay provided in an embodiment of the present invention for quantitatively detection RBP contents
Linear areal map.
Fig. 3 is a kind of kit knot of the proximity ligation assay provided in an embodiment of the present invention for quantitatively detection RBP contents
Fruit correlation compares.
Specific embodiment
Below with reference to attached drawing to a kind of proximity ligation assay of the present invention for the quantitatively kit of detection RBP contents, system
Standby and its application method is described in detail.
Embodiment 1
The preparation of RBP probes A：
1) the anti-RBP antibody of 0.1mg is taken to carry out common incubation 5-30min with DBCO-sulfo-NHS reagents；
2) 10 μ L 0.5mol/L Tris-HCl after reaction, are added in, are incubated 5-10min to terminate reaction；
3) the above-mentioned antibody being modified is added in into 5 ' the terminal modified oligodeoxynucleotide a for having azido group, 4 DEG C incubate overnight
It educates to get to RBP probes A.
Embodiment 2
The preparation of RBP probes B：
1) the anti-RBP antibody of 0.1mg is taken to carry out common incubation 5-30min with DBCO-sulfo-NHS reagents；
2) 10 μ L 0.5mol/L Tris-HCl after reaction, are added in, are incubated 5-10min to terminate reaction；
3) the above-mentioned antibody being modified is added in into 5 ' the terminal modified oligodeoxynucleotide b for having azido group, 4 DEG C incubate overnight
It educates to get to RBP probes B.
Embodiment 3
Kit mainly forms：
1) RBP probes A；
2) RBP probes B；
3) buffer solution is connected；
4) qPCR reaction solutions.
Embodiment 4
Kit application method, includes the following steps：
1) sample to be tested is added in reacting hole, adds RBP probe A and RBP probe B, added in after being incubated 5-30min
To connection buffer solution reaction 5-30min, finally mixed with qPCR reaction solutions；
2) to it is above-mentioned 1) in end reaction liquid carry out qPCR, the Ct values of each reacting hole of survey calculation.
The reacting hole of this kit can be microwell plate, micro-fluidic reagent disc, reaction cup, reaction tube etc..
Embodiment 5
Kit method evaluation of the present invention：
It is 1. linear
Compound concentration is 0 μ g/mL, the RBP standard solutions of 5 μ g/mL, 25 μ g/mL, 100 μ g/mL, 300 μ g/mL.Anti-
Ying Kongzhong is separately added into 10 μ L standard items, adds in 100 μ L RBP probe A, adds in 100 μ L RBP probes B, 37 DEG C incubate 10 points
Clock.After incubation, after adding in 20 μ L connections buffer solutions reaction 10min, add 20 μ L qPCR reaction solutions and carry out qPCR reactions, survey
Amount calculates the Ct values of each reacting hole.
Using Ct values as ordinate, standard concentration is abscissa, draws standard working curve (see attached drawing 2).
2. accuracy
Correlation compares：As shown in figure 3, it is with the correlation of member RBP kits in Chongqing：Y=0.949x+2.469, R2
=0.997.
The present invention is compared with existing method and product, and with detection sensitivity height, specificity is good, cost is relatively low, to detection
The advantages of instrument requirements are low.
The above description is merely a specific embodiment, but protection scope of the present invention is not limited thereto, any
Those familiar with the art disclosed herein technical scope in, the change or replacement that can readily occur in, all
It is covered by the protection scope of the present invention.
Claims (10)
1. a kind of proximity ligation assay is for the quantitatively kit of detection RBP contents, method of preparation and use, it is characterised in that：
1) kit mainly forms：RBP probe A, RBP probes B, connection buffer solution, qPCR reaction solutions；
2) application method：Sample to be tested is added in reacting hole, adds RBP probe A and RBP probe B, is incubated 5-30min
After be added to connection buffer solution reaction 5-30min, finally mixed with qPCR reaction solutions；
3) detection method：To it is above-mentioned 2) in end reaction liquid carry out qPCR, the Ct values of each reacting hole of survey calculation.
2. a kind of proximity ligation assay is for the preparation method of the quantitatively kit of detection RBP contents, which is characterized in that including such as
Lower step：
1) preparation of RBP probes A；
2) preparation of RBP probes B.
3. RBP probes A according to claim 1 and probe B are the oligodeoxynucleotide of anti-RBP antibody couplings.
4. anti-RBP antibody according to claim 3 is the monoclonal antibody or polyclonal antibody for RBP different epitopes.
5. the oligodeoxynucleotide a sequences on RBP probes A according to claim 3 are：5’-
GCATTGATCTAGTCATTCTAGTTATGTAGGGCCAACGACGACTGCAGATGAATTAATGAGGA-3’。
6. the oligodeoxynucleotide b sequences on RBP probes B according to claim 3 are：5’-
CGTAGCCGGCATATGGTACGACGACATGTACAGATACGACTGACGATCAGTACGTTTAAGGATAC-3’。
7. a kind of proximity ligation assay according to claim 1, for quantitatively detecting the kit of RBP contents, feature exists
In the connection buffer solution in the kit is 0.02%BSA, 20mmol/L Tris, 50mmol/L KCL, 20mmol/L
MgCl2, 0.03U/ μ L DNA ligases, 100mmol/L oligonucleotides bridge chains.
8. according to claim 7 the sequence of oligonucleotide bridge chain for 5 '-
TCGTACCATATGCCGGCTACGTCCTCATTAATTCATCTG-3’。
9. a kind of proximity ligation assay according to claim 1, for quantitatively detecting the kit of RBP contents, feature exists
In the qPCR reaction solutions in the kit include PCR forward primers, PCR reverse primers, TaqMan probe, Taq DNA and gather
Synthase.
10. PCR forward primers sequence according to claim 9 is 5 '-ATTGATCTAGTCATTCTAGTTATG-3 ', PCR
Reverse primer sequences are 5 '-ATCCTTAAACGTACTGATCGTCAGTCG-3 ', TaqMan probe sequences for 5 '-
TGAATTAATGAGGACGTAGCCGGCATATGGTAC-3’。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711272774.XA CN108267596A (en) | 2017-11-27 | 2017-11-27 | A kind of proximity ligation assay is for the quantitatively kit of detection RBP contents, method of preparation and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711272774.XA CN108267596A (en) | 2017-11-27 | 2017-11-27 | A kind of proximity ligation assay is for the quantitatively kit of detection RBP contents, method of preparation and use |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108267596A true CN108267596A (en) | 2018-07-10 |
Family
ID=62771976
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711272774.XA Pending CN108267596A (en) | 2017-11-27 | 2017-11-27 | A kind of proximity ligation assay is for the quantitatively kit of detection RBP contents, method of preparation and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108267596A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101452001A (en) * | 2007-12-06 | 2009-06-10 | 王颖 | Quantitative determination RBP4 kit by chemiluminescence magnetic enzymoimmune method |
| CN103235115A (en) * | 2013-04-01 | 2013-08-07 | 上海师范大学 | Novel electrochemiluminescence immunosensor for rapid and high sensitive detection of retinol binding protein and its preparation method |
| CN103276087A (en) * | 2013-05-30 | 2013-09-04 | 杭州金溪生物技术有限公司 | High-sensitivity protein detection method |
| CN105779649A (en) * | 2016-03-29 | 2016-07-20 | 扬州大学 | Immune PCR reagent kit for detecting avian leukemia virus |
-
2017
- 2017-11-27 CN CN201711272774.XA patent/CN108267596A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101452001A (en) * | 2007-12-06 | 2009-06-10 | 王颖 | Quantitative determination RBP4 kit by chemiluminescence magnetic enzymoimmune method |
| CN103235115A (en) * | 2013-04-01 | 2013-08-07 | 上海师范大学 | Novel electrochemiluminescence immunosensor for rapid and high sensitive detection of retinol binding protein and its preparation method |
| CN103276087A (en) * | 2013-05-30 | 2013-09-04 | 杭州金溪生物技术有限公司 | High-sensitivity protein detection method |
| CN105779649A (en) * | 2016-03-29 | 2016-07-20 | 扬州大学 | Immune PCR reagent kit for detecting avian leukemia virus |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101771697B1 (en) | Composition and method for detecting a diagnostic marker for infectious disease or infectious complications using tryptophanyl-tRNA synthetase | |
| CN101144814A (en) | Method for detecting, identifying and/ or quantifying compound using adapter type reagent | |
| CN105431728A (en) | Method of agglutination immunoassay | |
| CN104280556B (en) | A kind of detection method simultaneously measuring lipoprotein phospholipase A2 and c reactive protein content in blood plasma and kit | |
| US20150160221A1 (en) | Biomarkers for breast cancer predictions and diagnoses | |
| JP6732914B2 (en) | Composition for diagnosing infectious disease or infectious complication using tryptophanyl tRNA synthetase and method for detecting diagnostic marker | |
| CN102353789A (en) | Joint detection method for heart cerebrovascular disease-related protein marker and diagnostic kit thereof | |
| TW201643429A (en) | Prostate antigen standards and uses thereof | |
| US9983215B2 (en) | Methods and compositions for diagnosis of ectopic pregnancy | |
| WO2017222998A1 (en) | Dry-down processes for dye-conjugated reagents | |
| TR201809001T4 (en) | A method for diagnosing or monitoring renal function or diagnosing renal dysfunction. | |
| US20190107536A1 (en) | Assays and methods for the diagnosis of post-streptococcal disorders | |
| CN102695803A (en) | A proximity ligation assay involving generation of catalytic activity | |
| US20130237442A1 (en) | Methods and Compositions for Diagnosis of Non-Viable Early Pregnancy | |
| CA2936883A1 (en) | Prediction of postpartum hellp syndrome, postpartum eclampsia or postpartum preeclampsia | |
| US20150168410A1 (en) | Biomarkers for colorectal cancer diagnosis and prediction | |
| CN103911462B (en) | Identification and detection method for yellow fever, Japanese encephalitis, chikungunya fever and west Nile fever, primers and probes | |
| CN108267596A (en) | A kind of proximity ligation assay is for the quantitatively kit of detection RBP contents, method of preparation and use | |
| WO2007012937B1 (en) | Method for diagnosis of glioma distinguishing between progressive and denovo types | |
| US10457978B2 (en) | Cyclopentane-peptide nucleic acids for qualitative and quantitative detection of nucleic acids | |
| Zhao et al. | Preliminary study of diagnostic utility of molecular beacons in bladder cancer | |
| CN102296119A (en) | Specific detection method and kit for trace amount of breast adenocarcinoma cells in circulatory blood volume | |
| KR101297309B1 (en) | Composition for diagnosis of lung cancer and diagnosis kit of lung cancer | |
| US20180149653A1 (en) | Compositions and methods for diagnosing breast cancer | |
| CA2695662A1 (en) | Compositions and methods for detecting histamine related disorders |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180710 |
|
| WD01 | Invention patent application deemed withdrawn after publication |