CN108254346B

CN108254346B - Magnetic fluorescent copolymer nano probe with DNA as template and application thereof

Info

Publication number: CN108254346B
Application number: CN201810054708.3A
Authority: CN
Inventors: 马楠; 李智
Original assignee: Suzhou University
Current assignee: Suzhou University
Priority date: 2018-01-19
Filing date: 2018-01-19
Publication date: 2020-09-15
Anticipated expiration: 2038-01-19
Also published as: CN108254346A

Abstract

The invention relates to a magnetic fluorescent copolymer nano probe taking DNA as a template, which comprises a linear template DNA chain, wherein the template DNA chain is respectively connected with magnetic nanoparticles with super-paramagnetic property, quantum dot nanoparticles with fluorescent property and DNA or RNA aptamers capable of specifically identifying tumor cells by means of a recognition DNA sequence, and the magnetic nanoparticles or the quantum dot nanoparticles and the DNA or RNA aptamers are alternately connected on the template DNA chain. The invention also discloses application of the magnetic fluorescent copolymer nano probe in preparation for identifying circulating tumor cells. The nano probe can amplify magnetic signals and fluorescent signals, has high specificity selection on tumor cells, and has low non-specific adsorption on normal blood cells.

Description

Magnetic fluorescent copolymer nano probe with DNA as template and application thereof

Technical Field

The invention relates to the technical field of nano biological materials, in particular to a magnetic fluorescent copolymer nano probe taking DNA as a template and application thereof.

Background

Circulating Tumor Cells (CTCs) are central in tumor metastasis, and 90% of tumor-induced deaths are due to tumor metastasis. Therefore, early diagnosis and treatment to prevent the spread metastasis of primary tumors play an important role in reducing mortality. Circulating tumor cells are present in the peripheral blood of patients at an early stage of cancer, and thus, they can be an important biological indicator for the diagnosis and treatment of cancer. However, the greatest difficulty is that the number of circulating tumor cells is extremely small compared to normal cells in the blood, and usually the concentration of circulating tumor cells in the blood of tumor patients is only 1-3000 cells/ml, while the concentration of red blood cells is 10⁹Leukocyte concentration 10/ml⁷One/ml. To capture circulating tumor cells, a series of separation and enrichment techniques have been developed, which can be largely classified into two categories: the first kind of physical separation method, such as utilizing the size difference, density difference, shape difference, etc. of tumor cell and normal blood cell to realize the separation and enrichment of cell; the second category, affinity methods, such as the specific capture of tumor cells by antibodies or aptamers, allows for the isolation and enrichment of cells.

Among the above methods, immunomagnetic separation technology is widely used because of its simple operation and high cell capture efficiency. In the traditional immunomagnetic separation technology, an antibody is modified on the surface of a magnetic bead with a large size to capture circulating tumor cells. However, the large size of the magnetic beads may agglomerate or precipitate in the blood, thereby affecting the separation efficiency. Wang et al (Biomaterials 2011,32,9758) reported that a high efficiency separation of tumor cells was achieved by surface modification of antibodies with magnetic nanoparticles of 30nm size. However, this method uses an antibody to capture circulating tumor cells, and therefore the detection cost is high. Kim et al (small2015,11,2536) firstly modify antibodies on the surface of quantum dots to identify tumor cells, then add secondary antibody modified magnetic nanoparticles to be combined on the surface of the quantum dots, and compared with the magnetic nanoparticles directly modified by the antibodies, capture efficiency of the tumor cells is greatly improved. However, the method uses the antibody to capture the circulating tumor cells, so the detection cost is high, and the capture purity of the method is low and is only 18% -23%. The CellSearch system is the only circulating tumor cell detection system approved by the Food and Drug Administration (FDA) in the united states, and captures all cells expressing EpCAM antigen in blood by coating a polymer layer around a magnetic nanocore with antibodies against EpCAM. After the immunomagnetic body has completed capture and enrichment, the cells are permeabilized, and a fluorescent reagent is added to identify and count circulating tumor cells. The CellSearch system has high capture efficiency and good repeatability, but has some disadvantages: the price of the instrument and equipment is high; because antibodies are used to capture circulating tumor cells, detection costs are high; the capture purity of circulating tumor cells is very low; detection requires permeabilization of the cells, rendering the captured cells inactive.

Disclosure of Invention

In order to solve the technical problems, the invention aims to provide a magnetic fluorescent copolymer nano probe taking DNA as a template and application thereof.

In one aspect, the present invention provides a magnetic fluorescent copolymer nanoprobe using DNA as a template, which comprises a linear template DNA strand, wherein the template DNA strand is connected to a magnetic nanoparticle with superparamagnetic property, a quantum dot nanoparticle with fluorescent property, and a DNA or RNA aptamer capable of specifically recognizing tumor cells by means of a recognition DNA sequence, and the magnetic nanoparticle or the quantum dot nanoparticle and the DNA or RNA aptamer are alternately connected to the template DNA strand.

Further, the template DNA strand has three kinds of recognition DNA sequences of repeating units and the three kinds of recognition DNA sequences alternate.

Further, the magnetic nanoparticles, the quantum dot nanoparticles and the DNA or RNA aptamers are all connected with base sequences which are complementary with the recognition DNA sequences.

Furthermore, the quantum dot nanoparticles are composed of elements of II-VI family, IV-VI family, I-VI family, II-V family and III-V family.

Further, the quantum dots are binary quantum dots or ternary quantum dots. The binary quantum dots are selected from one or more of cadmium telluride, cadmium selenide, cadmium sulfide, lead selenide, silver sulfide, silver selenide, zinc sulfide, zinc selenide, zinc telluride, cadmium phosphide, cadmium arsenide, indium phosphide and indium arsenide. The ternary quantum dots are one or more of cadmium mercury tellurium, cadmium mercury selenium, cadmium mercury sulfur, zinc mercury tellurium, zinc mercury selenium, zinc mercury sulfur, zinc cadmium tellurium, zinc cadmium selenium, zinc cadmium sulfur, zinc tellurium selenium, zinc tellurium sulfur, zinc selenium sulfur, cadmium tellurium selenium, cadmium tellurium sulfur, cadmium selenium sulfur, zinc copper selenium, zinc manganese selenium, copper indium sulfur and copper indium selenium.

Further, the material of the magnetic nano-particles is Fe₃O₄、γ-Fe₂O₃、CoFe₂O₄、NiFe₂O₄And MnFe₂O₄One or more of them.

Further, the magnetic nanoparticles have a particle size of 5 to 100 nm.

Further, the preparation method of the magnetic fluorescent copolymer nanoprobe comprises the following steps:

mixing a linear template DNA chain, a quantum dot nano-particle, a magnetic nano-particle and a DNA or RNA aptamer for specifically recognizing tumor cells and then reacting to obtain the magnetic fluorescent copolymer nano-probe, wherein the template DNA chain is provided with a recognition DNA sequence, and the quantum dot nano-particle, the magnetic nano-particle and the DNA or RNA aptamer are respectively connected with a base sequence complementary to the recognition DNA sequence.

Further, the mole ratio of the linear template DNA chain, the magnetic nanoparticles, the quantum dot nanoparticles and the DNA or RNA aptamer for specifically recognizing the tumor cells is 1:1-10:2-40: 2-50. Preferably, the molar ratio is 1:7:3: 10.

In a specific embodiment of the present invention, a method for preparing a magnetic fluorescent copolymer nanoprobe comprises the following steps:

(1) connecting the C1DNA sequence with the quantum dot to form a DNA-quantum dot;

(2) connecting the C2DNA sequence with the magnetic nano-particles to form DNA-magnetic nano-particles, functionalizing the surfaces of the magnetic nano-particles, and modifying the 3' end of the C2DNA sequence with a group which is mutually reacted with the group on the surfaces of the magnetic nano-particles; preferably, the surface of the magnetic nanoparticles is carboxyl-functionalized;

(3) preparing linear DNA chains, wherein each DNA chain comprises a first base sequence which is complementary with a part of bases in a C1DNA sequence in the DNA-quantum dots, a second base sequence which is complementary with a part of bases in a C2DNA sequence in the DNA-magnetic nano-particles and a third sequence;

(4) mixing linear DNA chain, DNA-quantum dot, DNA-magnetic nano and DNA or RNA aptamer for specifically recognizing tumor cells, and reacting to obtain the magnetic fluorescent copolymer nano probe (MQAP for short), wherein the third sequence is complementary with partial basic group of the DNA or RNA aptamer for specifically recognizing tumor cells.

Further, in the step (3), the preparation method is a hybridization chain reaction, a rolling circle amplification reaction or a common PCR polymerization reaction.

Further, in both step (3) and step (4), the reaction is carried out in a DNA buffer solution having a pH of 6.5 to 9.5, comprising sodium chloride, disodium hydrogen phosphate and water.

Further, in both step (3) and step (4), the reaction is carried out at 15 to 37 ℃.

Specifically, in step (1), the 5' end of the C1DNA sequence includes a thio-modified base sequence N1, the sequence N1 is also linked with the sequence N2, and the sequence N1 is 5-20bp in length. Specifically, the N1 and N2 sequences in the C1DNA sequence are linked by 6 bases a, which may be replaced by any number of bases a or base T sequences. N1 is 10 thio-modified base G sequence, which can be replaced by any base sequence of 5-20 any number of thio-modifications. Preferably, the sequence of N2 is shown in SEQ ID No. 1.

Specifically, in step (2), the 3' end of the C2DNA sequence is modified with amino, thiol, avidin, biotin, etc.

Specifically, in step (2), the C2DNA sequence is 5' -N13- (A)₁₀-NH₂-3', wherein (A)₁₀Represents 10 bases A, which may be replaced by any number of bases A or base T sequences. NH (NH)₂Can be replaced by sulfhydryl, avidin, biotin and the like. N13 is complementary to the sequence N7 base, preferably N13 is shown in SEQ ID No. 2.

Further, in the step (3), hybridizing an H1 sequence with a hairpin structure with an LH1DNA sequence to obtain an assembly structure M1 sequence (figure 1), and then performing hybridization chain reaction on the M1 sequence, an H1 sequence with the hairpin structure and an H2 sequence with the hairpin structure under the action of a promoter I sequence to form a linear DNA chain;

wherein, the H1 sequence comprises sequences N3, N4 and N5, the sequence N5 is complementary with the N2 sequence of the C1DNA sequence in the DNA-quantum dot in base, the LH1DNA sequence comprises a sequence N6 complementary with the N3 sequence in the H1 sequence and a sequence N7 complementary with partial base of the C2DNA sequence in the DNA-magnetic nano-scale, the H2 sequence comprises a sequence N8 complementary with the N4 sequence in the H1 sequence and a sequence N9 identical with the I sequence, and the sequence N9 is also connected with a sequence N10.

Specifically, in step (3), the molar ratio of the promoter I sequence, the M1 sequence, the H1 sequence and the H2 sequence is 1:3:7: 10.

Specifically, in the step (3), N4 and N5 in the H1 sequence are connected through 5 bases A, and the nucleotide sequence of the H1 sequence is shown as any one of SEQ ID No.3-SEQ ID No. 5. The nucleotide sequence of the H2 sequence is shown in any one of SEQ ID No.6-SEQ ID No. 8. The nucleotide sequence of the promoter I sequence is shown in any one of SEQ ID No.9-SEQ ID No. 11.

Specifically, in step (4), the DNA or RNA aptamer specifically recognizing the tumor cell is an SH2DNA sequence, which includes a DNA sequence or RNA sequence N11 specifically recognizing the tumor cell and a sequence N12 complementary to the sequence N10 in the H2 sequence. Specifically, the N11 sequence and the N12 sequence in the SH2DNA sequence are linked by 6 bases a, which may be replaced by any number of bases a or base T sequences. The sequence of N11 is shown in any one of SEQ ID No.12-SEQ ID No. 27. The sequence of N12 is shown in SEQ ID No. 28. In the invention, all sequence sequences in the sequence table are from 5 'end to 3' end.

Specifically, in the step (4), the molar ratio of the DNA-quantum dot, DNA-magnetic nano-particle and SH2DNA sequence to the promoter I sequence in the step (3) is 7:3:10: 1.

As shown in FIG. 2, the I sequence is a sequence partially complementary to the sequences a and b of H1, the H1 sequence and the H2 sequence are DNAs with hairpin structures, and the three DNAs are mixed together to generate hybrid chain reaction. a. b, C, a ', b' and C 'are applied to hybridization chain reaction, the 3' end of the H1 sequence is composed of s and d, s is A or T with random quantity as space interval, d is a random sequence used for hybridizing with partial base of the C1DNA sequence; the 5' end of the H2 sequence is composed of s, e, s is a random number of A or T as space intervals, e is a random sequence for hybridization with the partial sequence in C2. In the step (3), the promoter I sequence carries out chain opening on the hairpin structure H1 sequence through a footpoint-mediated chain replacement reaction to release another single chain, the single chain can carry out chain opening on the hairpin structure H2 sequence in the same way to release another single chain which is the same as the promoter I sequence, and the H1 sequence is carried out chain opening again to be cycled to assemble the linear one-dimensional DNA polymer. And (3) after the linear DNA chain, the DNA-quantum dot, the DNA-magnetic nano and the SH2DNA sequence obtained in the step (3) are mixed and connected with each other through complementary pairing between bases, the DNA-quantum dot, the DNA-magnetic nano and the SH2DNA sequence are connected to the linear DNA chain, so that the finally synthesized nano probe has magnetic and fluorescent properties and can specifically identify circulating tumor cells (figure 3).

On the other hand, the invention also claims the application of the magnetic fluorescent copolymer nano probe prepared by the preparation method as a preparation for identifying circulating tumor cells.

Furthermore, the circulating tumor cells are one or more of CCRF-CEM cells, MCF-7 cells, MDA-MB-231 cells, SKBR-3 cells, LNCap cells, PC3 cells, SKOV3 cells, OVCAR-3 cells, A549 cells, HepG2 cells, Kato III cells, HT-29 cells, DU145DLD-1 cells, HCT 116 cells, SW480 cells and A-431 cells.

Further, when in use, the concentration of the magnetic fluorescent copolymer nano probe is 2.5-50nmol/L, preferably, the concentration is 15-50 nmol/L.

Further, when used, the cell density of the circulating tumor cells is 25 cells/mL or more. Preferably, the cell density is 50/mL to 1000/mL.

By the scheme, the invention at least has the following advantages:

the preparation method takes various DNA sequences as templates, magnetic nanoparticles, semiconductor quantum dots with fluorescence properties and DNA aptamers for specifically recognizing tumor cells are copolymerized and assembled, and the raw material selection is diversified.

The nano probe provided by the invention uses the DNA aptamer to replace an antibody to identify the tumor cells, so that the detection cost can be reduced. Meanwhile, the DNA aptamer is used for identifying the tumor cells, DNA or DNA enzyme which is antisense to the aptamer can be used for releasing the probe after the tumor cells are captured, and the influence of the magnetic nano-particles on the activity of the tumor cells is further reduced. The captured cells may be continued to be cultured for subsequent analysis.

The nano probe can amplify magnetic signals and fluorescent signals, has high specificity selection on tumor cells, has low non-specific adsorption on normal blood cells, and can realize high capture efficiency and capture purity.

The nano probe has fluorescence property, does not need to carry out fixed dyeing on captured cells, and the magnetic nano is encapsulated in the DNA polymer, so that the toxicity of the magnetic nano is reduced, the cells can be identified after being captured by the probe, and the nano probe has higher activity.

The nanoprobe can be used as a preparation for identifying circulating tumor cells, and in the detection application of the circulating tumor cells, the nanoprobe does not need to use an antibody, so the cost is lower; the cell capture purity is higher, and the complexity of subsequent analysis is reduced; meanwhile, the captured cells have activity and high capture purity, and can be used for subsequent gene analysis.

The foregoing description is only an overview of the technical solutions of the present invention, and in order to make the technical solutions of the present invention more clearly understood and to implement them in accordance with the contents of the description, the following detailed description is given with reference to the preferred embodiments of the present invention and the accompanying drawings.

Drawings

FIG. 1 is a schematic diagram of the preparation route of the M1 sequence by hybridization of H1 sequence with LH1DNA sequence;

FIG. 2 is a schematic diagram of the principle of the hybridization chain reaction;

FIG. 3 is a schematic diagram of a preparation route of a magnetic fluorescent copolymer nanoprobe;

FIG. 4 shows the results of ultraviolet absorption and fluorescence spectrum characterization of magnetic fluorescent copolymer nanoprobes;

FIG. 5 shows the result of transmission electron microscopy characterization of the magnetic fluorescent copolymer nanoprobe;

FIG. 6 is a representation of confocal laser fluorescence imaging of magnetic fluorescent copolymer nanoprobes after interaction with CCRF-CEM cells and Ramos cells in example 2;

FIG. 7 is a schematic view showing the structure of a cell separation apparatus in example 3;

FIG. 8 is a photograph of a fluorescence image isolated from a solution of CCRF-CEM cells in example 3;

FIG. 9 is a graph of fluorescence images of CCRF-CEM cells separated from a mixed system of CCRF-CEM and Ramos cells in example 4;

FIG. 10 shows the structure of the magnetic fluorescent copolymer nanoprobes after the interaction with CCRF-CEM cells in example 4;

FIG. 11 is a schematic diagram of cell separation in example 5;

FIG. 12 is a photograph of a fluorescence image of CCRF-CEM cells isolated from blood in example 5;

description of reference numerals:

1-culture dish, 2-magnet.

Detailed Description

The following detailed description of embodiments of the present invention is provided in connection with the accompanying drawings and examples. The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

Example 1

Synthesis of DNA-Quantum dots

In this example, the C1DNA sequence used was as follows:

5’-GGGGGGGGGGAAAAAACGTCCGTGCTCAC-3', wherein base G is thio modified.

The C2DNA sequences used were as follows:

5’-TACGCGTCTAGGATCAAAAAAAAAA-NH₂-3’。

the H1 sequence used was as follows:

5’-TTAACCCACGCCGAATCCTAGACTCAAAGTAGTCTAGGATTCGGCGTGAAAAAGTGAGCACGGA CG-3', which is a hairpin structure with the overhanging portion underlined.

The H2 sequence used was as follows:

5’-GACGTGCAGGCTGTTTAAAGTCTAGGATTCGGCGTGGGTTAACACGCCGAATCCTAGACTACTTTG-3', which is a hairpin structure with the overhanging portion underlined.

The promoter I sequence used was as follows:

5’-AGTCTAGGATTCGGCGTGGGTTAA-3’。

the LH1DNA sequence used was as follows:

5’-GATCCTAGACGCGTAAAAAAACGTCCGTGCTCAC-3’。

the SH2 sequence used was as follows:

5’-CAGCCTGCACGTC(A)₆ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA-3', the underlined base sequence is complementary to the underlined base sequence of the H2 sequence.

(1) Weighing 0.02g of telluriumPowder (Te) was mixed with 0.0125g of sodium borohydride (NaBH)₄) Into a 1.5mL centrifugal tube, 0.5mL ultrapure water was added and reacted at 60 ℃ for 40 minutes to produce sodium telluride (NaHTe).

(2) And (3) synthesizing the DNA-CdTe quantum dots: taking 0.5mL of metal ion precursor solution 1 with pH of 9, and adding cadmium chloride (CdCl) in the precursor solution 1₂) The concentration is 1.25mM, the concentration of Glutathione (GSH) is 1.05mM, a C1DNA sequence with the base number of 120nmol base is added into the precursor solution 1, heating is carried out at 100 ℃, DNA-CdTe quantum dots are synthesized, and the synthesized DNA-CdTe quantum dots are purified by centrifuging for 3 minutes under the condition of 12500 revolutions per minute by using a 30K ultrafilter tube.

(3) Dissolving the DNA-CdTe quantum dots in 0.5ml of NaOH solution with pH of 10.5, adding 7 mu L of metal ion precursor solution 2 with pH of 11, and adding CdCl in the precursor solution 2₂The concentration of the precursor is 30mM, the concentration of GSH is 75mM, the concentration of thiourea (thiourea) is 25mM, the mixture is heated for 30min at the temperature of 95 ℃, 10 mu L of precursor solution 2 is added, and the mixture is continuously heated for 30min at the temperature of 95 ℃ to obtain the DNA-CdTe/CdS quantum dots, which are named as DNA-quantum dots in the invention.

(II) preparation of DNA-magnetic nanoparticles

0.1mL of 5mg/mL (1.35. mu.M) of carboxyl-functionalized Fe₃O₄Dissolving magnetic nanoparticles in 1mL boric acid buffer solution (pH 5.5) with concentration of 10mM, adding 100 μ L1 mg/mL EDC and 50 μ L1 mg/mL NHS, performing ultrasonic treatment in ice water for 20min, adding 9mL 1 × PBS solution containing 15.625nmol base C2DNA sequence, performing ultrasonic treatment in ice water for 40min, standing in dark at 4 deg.C for 12h, and centrifuging at 13500r/min for purification to obtain DNA-modified Fe₃O₄. The invention is named as DNA-magnetic nanometer.

(III) preparation of magnetic fluorescent copolymer nanoprobe

As shown in figure 3, firstly hybridizing an equal amount of H1 sequence and LH1DNA sequence in 1 × DNA buffer solution for 1 hour to obtain an assembly structure M1 sequence, then mixing M1, H1, H2 and I sequences in 2.5 × DNA buffer solution for reaction, standing the mixed solution at room temperature in a dark place for 12 hours (the molar concentration ratio of the I, M1, H1 and H2 sequences in the solution is 1:3:7: 10), adding DNA-quantum dots, DNA-magnetic nano and SH2DNA sequence for continuous reaction for 1 hour, and finally obtaining magnetic separation and purification to obtain magnetic nano-particlesThe fluorescent copolymer nanoprobe (hereinafter abbreviated as MQAP) comprises 1 × DNA buffer solution and 2.5 × DNA buffer solution, wherein pH is 6.5-7.5, sodium chloride (NaCl) is 1000mM, and disodium hydrogen phosphate (Na)₂HPO₄)100mM 10 × DNA buffer solution is respectively diluted by 10 times and 4 times, and the concentration ratio of the I sequence, the SH2 sequence, the DNA-magnetic nano-particles and the DNA-quantum dots is 1: 10: 3: 7.

The characterization results of the ultraviolet absorption and fluorescence spectrum of the purified MQAP probe are shown in the attached figure 4, the probe has a continuous ultraviolet absorption peak before 700nm, and has a maximum fluorescence emission peak at 639 nm.

The MQAP probe prepared by the invention responds to the magnet, the probe is stably present in the solution in the test tube before magnetic separation, and the probe is rapidly separated from the solution and adsorbed on the wall of the test tube after a magnetic field is applied.

The TEM and HRTEM characterization of MQAP probes is shown in fig. 5, where fig. 5 shows that a plurality of magnetic nanoparticles are tightly packed inside a nearly linear DNA polymer, surrounding a plurality of quantum dots.

Example 2 MQAP Probe for the specific identification of circulating tumor cells

(1) Culture of cell lines

Culturing human acute lymphoblastic leukemia cells (CCRF-CEM) and human B lymphoblastoid tumor cells (Ramos) as control cells. CCRF-CEM and Ramos cells are both at 25cm²The culture medium of (4) was RPMI 1640 medium containing 1% diabody (penicillin, streptomycin) and 10% Fetal Bovine Serum (FBS). The culture environment is 37 deg.C, and contains 5% CO₂The cell culture box of (1).

(2) MQAP probe specific identification experiment for CCRF-CEM cell

200 μ LCCRF-CEM or Ramos cells cultured as described above (2 × 10)⁶one/mL) was first pre-stained with Calcein-AM (Calcein-AM, 10. mu.M) or 4, 6-diamidino-2-phenylindole (DAPI, 10. mu.g/mL) respectively in a water bath at 37 ℃ for 30min, washed three times with 500. mu.L of cell washing buffer, reacted with 200. mu.L of MQAP probe prepared in example 1 at 4 ℃ for 1h, washed three times with cell washing buffer, and then 200. mu.L of cell binding buffer was addedAnd transferring the solution to an 8-pore chamber slide, and performing fluorescence imaging by using a laser confocal microscope. The cell washing buffer solution contains glucose 4.5g/L and magnesium chloride (MgCl)₂)5mM 1 × DPBS solution, wherein the cell binding buffer solution is a cell washing buffer solution containing 0.1mg/mL yeast tRNA (yeastRNA).

The imaging result is shown in FIG. 6, and FIG. 6 shows that the MQAP probe can specifically identify CCRF-CEM cells, so that a strong fluorescence signal can be obtained in the quantum dot signal collection region (FIGS. 6A and 6B); the probe was unable to specifically recognize Ramos cells, so only very weak fluorescent signals were obtained in the quantum dot signal collection region (fig. 6C, 6D), due to non-specific adsorption of Ramos cells to the probe.

Example 3 MQAP Probe for isolation of enriched CCRF-CEM cells alone

(1) The MQAP probe was allowed to interact with CCRF-CEM cells at various concentrations according to the method of step (2) in example 2, and then 100. mu.L (2 × 10) was taken²one/mL) CCRF-CEM cells reacted with varying concentrations of MQAP probe were added to a 24-well plate, magnetic separation was performed for 15min with a magnet placed at the edge of the plate, and then the captured tumor cells were counted by fluorescence microscopy. The cell separation device is shown in figure 7 (figure 7a is a schematic structural diagram of the separation device, figure 7B is an enlarged view of circle a in figure a, and an arrow in the figure is a blood adding position), the fluorescence imaging characterization result of tumor cell capture is shown in figure 8, figure 8A is a bright field, figure 8B is a quantum dot, and the arrow in the figure indicates a CCRF-CEM cell, and the CCRF-CEM cell which is acted with the probe moves to the edge region of the solution under the action of the magnetic field. The capture efficiency of tumor cells is shown in table 1, the capture efficiency of the probe to the CCRF-CEM cells is increased with the increase of the probe concentration, and when the probe concentration reaches 15nM (in magnetic nanometers), the capture efficiency of the probe to the CCRF-CEM cells is 88%, and the capture efficiency is not obviously improved with the increase of the probe concentration.

TABLE 1 CCRF-CEM cell Capture efficiency vs Probe concentration

Concentration of Probe	Tumor cell capture efficiency
		2.5nM	14.2％
5nM	43.7％
		7.5nM	62.3％
15nM
		88％
30nM
		88％
50nM			91.8％

(2) MQAP probes Capture efficiency test for different densities of CCRF-CEM cells: CCRF-CEM cells were first exposed to MQAP probe at a concentration of 15nM, as described in step (2) of step 2. And (3) adding 100 mu L of CCRF-CEM cells with different concentrations into a 24-well plate, performing magnetic separation, wherein the separation process refers to the method in the embodiment, the capture result is shown in Table 2, the capture efficiency can still be ensured to be higher under lower cell density, and the capture efficiency of the probe on the CCRF-CEM cells is 58.3% -90.1%.

TABLE 2 CCRF-CEM cell Capture efficiency vs. cell density

Tumor cell density	Tumor cell capture efficiency
		25/mL	58.3％
50 pieces/mL	81％
		100 pieces/mL	88.3％
200 pieces/mL	88％
		500 pieces/mL	89.3％
1000 pieces/mL	90.1％

Example 4 MQAP Probe used to isolate CCRF-CEM cells from CCRF-CEM, Ramos cell mixtures (1) CCRF-CEM or Ramos cells were first pre-stained and then reacted with MQAP probe as in step (2) of example 2.

(2) Collecting 100 μ L of the extract containing 2 × 10²The mixture of CCRF-CEM and Ramos cells of different concentrations was added to a 24-well plate and subjected to magnetic separation, the separation process was performed in accordance with step (1) of example 3, and the captured CCRF-CEM cells and Ramos cells were counted, and the counting criteria were that CCRF-CEM was cells expressing green and red fluorescence simultaneously and Ramos cells were cells expressing a blue fluorescence signal. And calculating the capture efficiency and the capture purity according to the statistical result. The capture efficiency and capture purity were calculated as follows:

the results of the trapping are shown in Table 3, even though the concentration of Ramos cells is 10⁶The capture efficiency and capture purity of CCRF-CEM are still kept at high values at one/mL. For a two-cell mixed system, the capture efficiency of the probe on CCRF-CEM cells is 76.2% -86.3%, and the capture purity is 78.7% -100%.

TABLE 3 correlation between the trapping efficiency and purity of CCRF-CEM cells and the background cell Ramos cell concentration

Ramos cell density	Tumor cell capture efficiency	Tumor cell capture purity
			2×10⁶Per mL	76.2％	78.7％
2×10⁵Per mL	78.1％	81.2％
			2×10⁴Per mL	83.1％	88.1％
2×10³Per mL	86.4％	93.4％
			2×10²Per mL	88.6％	98.6％
2×10¹Per mL	86.3％	100％

(3) Collecting 100 μ L of the extract containing 2 × 10²CCRF-CEM of one/mL, 10⁴The mixture of Ramos cells per mL was dropped into an 8-well chamber slide well plate and subjected to magnetic separation according to the step (1) in example 3. After magnetic separation, fluorescence imaging characterization was performed using a confocal laser microscope. The experimental results are shown in fig. 9, fig. 9A is a bright field, fig. 9B is a fluorescence superposition graph, the upper arrow indicates a control cell, the lower arrow indicates a CCRF-CEM tumor cell, most of the CCRF-CEM cells move to the fringe region under the action of the magnetic field, and only a few Ramos cells can move to the fringe region, which indicates that the capture efficiency and the capture purity of the probe on the CCRF-CEM cells are high, and the capture efficiency and the capture purity are 83.1% and 88.1% under the conditions.

(4) Different concentrations of MQAP probe were added to 200. mu.L of 5 × 10-containing 10⁴Cell culture medium of CCRF-CEM cells in a cell culture chamber (containing 5% CO at 37 deg.C)₂) After 1h of neutralization, the unreacted probe was removed by centrifugation, 100. mu.L of fresh RPMI 1640 medium and 10. mu.L of CCK-8 reagent solution were added again, transferred to a 96-well plate, and incubated in a cell incubator for 4h, and then the absorbance at 450nm was measured using a microplate reader. The experimental result is shown in FIG. 10, and the cell activity is above 95% after the probe reacts with the cell at the concentration of 15nM, which indicates that the probe has weak toxicity to the cell.

Example 5 MQAP Probe for isolating CCRF-CEM cells enriched in blood

(1) CCRF-CEM cells were pre-stained with Calcein-AM (Calcein-AM) according to example 2, step (2) pre-stained CCRF-CEM cells were diluted to 2 × 10⁴Counting the number of cells/mL, dripping 10 mu L of the solution onto a 24-pore plate for counting, transferring the liquid drop into 1mL of blood, counting again at the same position of the 24-pore plate, determining the number of CCRF-CEM cells remained on the pore plate, and determining the difference of the two counts as the number of the cells added into the blood.

(2) The MQAP probe prepared in example 1 was added to 1mL of blood containing a defined number of CCRF-CEM cells at a final concentration of 15nM and exposed for 1h at 4 ℃.

(3) After the MQAP probe reacts with blood, 3mL of erythrocyte lysate is added into the blood, the blood is placed on an ice bag for 15min to lyse erythrocytes, then the blood is centrifuged for 10min at the temperature of 4 ℃ and under the condition of 450 Xg, supernatant is discarded, and 1mL of cell binding buffer solution is added to resuspend the precipitate.

(4) The resuspended solution was transferred to the outer well of a 24-well plate for magnetic separation, and the separation process was referred to example 4, step (2). The cell separation is schematically shown in fig. 11, the separation result is shown in fig. 12, fig. 12A is a bright field, fig. 12B is an overlay, and it can be seen that the CCRF-CEM cells (tumor cells indicated by arrows) are moved to the fringe region under the action of the magnetic field, and only a few white blood cells can move to the fringe region, thus exhibiting higher capture purity of the probe. Data statistics result MQAP probe has capture efficiency of 78% and capture purity of 83.9% on CCRF-CEM tumor cells in blood.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, it should be noted that, for those skilled in the art, many modifications and variations can be made without departing from the technical principle of the present invention, and these modifications and variations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Suzhou university

<120> magnetic fluorescent copolymer nano probe using DNA as template and application

<141>2018-01-19

<160>28

<170>SIPOSequenceListing 1.0

<210>1

<211>13

<212>DNA

<213> (Artificial sequence)

<400>1

cgtccgtgct cac 13

<210>2

<211>15

<212>DNA

<213> (Artificial sequence)

<400>2

tacgcgtcta ggatc 15

<210>3

<211>66

<212>DNA

<213> (Artificial sequence)

<400>3

ttaacccacg ccgaatccta gactcaaagt agtctaggat tcggcgtgaa aaagtgagca 60

cggacg 66

<210>4

<211>66

<212>DNA

<213> (Artificial sequence)

<400>4

ggaacagctt tgaggtgcca tctcgcacct caaagctgtt ccactgtgaa aaagtgagca 60

cggacg 66

<210>5

<211>66

<212>DNA

<213> (Artificial sequence)

<400>5

ctggctcctg tgattgtgct ctagacatcg ctagagcaca atcacaggaa aaagtgagca 60

cggacg 66

<210>6

<211>66

<212>DNA

<213> (Artificial sequence)

<400>6

gacgtgcagg ctgtttaaag tctaggattc ggcgtgggtt aacacgccga atcctagact 60

actttg 66

<210>7

<211>66

<212>DNA

<213> (Artificial sequence)

<400>7

gacgtgcagg ctgtttaaga gatggcacct caaagctgtt cccacagtgg aacagctttg 60

aggtgc 66

<210>8

<211>66

<212>DNA

<213> (Artificial sequence)

<400>8

gacgtgcagg ctgtttaact agagcacaat cacaggagcc agcctgtgat tgtgctctag 60

cgatgt 66

<210>9

<211>24

<212>DNA

<213> (Artificial sequence)

<400>9

agtctaggat tcggcgtggg ttaa 24

<210>10

<211>24

<212>DNA

<213> (Artificial sequence)

<400>10

cacagtggaa cagctttgag gtgc 24

<210>11

<211>24

<212>DNA

<213> (Artificial sequence)

<400>11

ctagagcaca atcacaggag ccag 24

<210>12

<211>41

<212>DNA

<213> (Artificial sequence)

<400>12

atctaactgc tgcgccgccg ggaaaatact gtacggttag a 41

<210>13

<211>25

<212>DNA

<213> (Artificial sequence)

<400>13

gcagttgatc ctttggatac cctgg 25

<210>14

<211>48

<212>DNA

<213> (Artificial sequence)

<400>14

cactacagag gttgcgtctg tcccacgttg tcatgggggg ttggcctg 48

<210>15

<211>47

<212>DNA

<213> (Artificial sequence)

<400>15

aacaccggga ggatagttcg gtggctgttc agggtctcct cccggtg 47

<210>16

<211>28

<212>DNA

<213> (Artificial sequence)

<400>16

ttggtggtgg tggttgtggt ggtggtgg 28

<210>17

<211>57

<212>DNA

<213> (Artificial sequence)

<400>17

tggatgggga gatccgttga gtaagcgggc gtgtctctct gccgccttgc tatgggg 57

<210>18

<211>69

<212>DNA

<213> (Artificial sequence)

<400>18

ggctgttgtg agcctcctcc cagagggaag actttaggtt cggttcacgt cccgcttatt 60

cttactccc 69

<210>19

<211>51

<212>DNA

<213> (Artificial sequence)

<400>19

taactcaata agctaggtgg gtgggggaca ctacccgggg ggtggttggg t 51

<210>20

<211>45

<212>DNA

<213> (Artificial sequence)

<400>20

tctctagtta ttgagttttc ttttatgggt gggtgggggg ttttt 45

<210>21

<211>56

<212>RNA

<213> (Artificial sequence)

<400>21

gggaggacga ugcggaucag ccauguuuac gucacuccuu gucaauccuc aucggc 56

<210>22

<211>58

<212>RNA

<213> (Artificial sequence)

<400>22

gggaggacga ugcggaccga aaaagaccug acuucuauac uaagucuacg uucccaga 58

<210>23

<211>18

<212>RNA

<213> (Artificial sequence)

<400>23

gcgacugguu cccggucg 18

<210>24

<211>41

<212>RNA

<213> (Artificial sequence)

<400>24

aagugacguc cugaucgauu gugcauucgg ugugacgauc u 41

<210>25

<211>34

<212>RNA

<213> (Artificial sequence)

<400>25

accaagaccu gacuucuaac uaagucuacg uucc 34

<210>26

<211>35

<212>RNA

<213> (Artificial sequence)

<400>26

ggaggacgcu cgccguaaug gauguuuugc uccug 35

<210>27

<211>71

<212>RNA

<213> (Artificial sequence)

<400>27

gggaggacga ugcggugccc acuaugcgug ccgaaaaaca uuucccccuc uaccccagac 60

gacucgcgcg a 71

<210>28

<211>13

<212>DNA

<213> (Artificial sequence)

<400>28

cagcctgcac gtc 13

Claims

1. A magnetic fluorescent copolymer nano probe taking DNA as a template is characterized in that: the kit comprises a linear template DNA chain, wherein the template DNA chain is respectively connected with magnetic nanoparticles with super-paramagnetic properties, quantum dot nanoparticles with fluorescent properties and DNA or RNA aptamers capable of specifically recognizing tumor cells by means of recognition DNA sequences, and the magnetic nanoparticles or the quantum dot nanoparticles and the DNA or RNA aptamers are alternately connected on the template DNA chain; and base sequences which are complementary with the recognition DNA sequences are connected to the magnetic nanoparticles, the quantum dot nanoparticles and the DNA or RNA aptamers.

2. The DNA-templated magnetic fluorescent copolymer nanoprobe of claim 1, wherein: the template DNA strand has three recognition DNA sequences of repeating units and the three recognition DNA sequences appear alternately.

3. The DNA-templated magnetic fluorescent copolymer nanoprobe of claim 1, wherein: the quantum dot nanoparticles are composed of elements of II-VI family, IV-VI family, I-VI family, II-V family and III-V family.

4. The DNA-templated magnetic fluorescent copolymer nanoprobe of claim 3, wherein: the quantum dot nanoparticles are binary quantum dots or ternary quantum dots.

5. The DNA-templated magnetic fluorescent copolymer nanoprobe of claim 1, wherein: the magnetic nano-particles with the super paramagnetic property are made of Fe₃O₄、γ-Fe₂O₃、CoFe₂O₄、NiFe₂O₄And MnFe₂O₄One or more of them.

6. The DNA-templated magnetic fluorescent copolymer nanoprobe of claim 1, wherein: the magnetic nanoparticles have a particle size of 5-100 nm.

7. The DNA-templated magnetic fluorescent copolymer nanoprobe according to any one of claims 1 to 6, wherein the preparation method comprises the steps of:

mixing a linear template DNA chain, a quantum dot nano-particle, a magnetic nano-particle and a DNA or RNA aptamer for specifically recognizing tumor cells and then reacting to obtain the magnetic fluorescent copolymer nano-probe, wherein the template DNA chain is provided with a recognition DNA sequence, and the quantum dot nano-particle, the magnetic nano-particle and the DNA or RNA aptamer are respectively connected with a base sequence complementary with the recognition DNA sequence.

8. The DNA-templated magnetic fluorescent copolymer nanoprobe of claim 7, wherein: the molar ratio of the linear template DNA chain, the magnetic nanoparticles, the quantum dot nanoparticles and the DNA or RNA aptamer for specifically recognizing the tumor cells is 1:1-10:2-40: 2-50.

9. Use of the DNA-templated magnetic fluorescent copolymer nanoprobe of any one of claims 1-6 as a preparation for identifying circulating tumor cells.