CN108251532B

CN108251532B - Fecal DNA colorectal tumor polygene prediction model based on NGS technology

Info

Publication number: CN108251532B
Application number: CN201810272503.2A
Authority: CN
Inventors: 毛瑞芳; 陈璟; 王云霞; 王君; 秦楠
Original assignee: Shanghai Realbio Technology Co ltd
Current assignee: Shanghai Realbio Technology Co ltd
Priority date: 2018-03-29
Filing date: 2018-03-29
Publication date: 2021-12-28
Anticipated expiration: 2038-03-29
Also published as: CN108251532A

Abstract

The present invention provides methods and systems for determining colorectal tumor cells. The method comprises the following steps: respectively obtaining KRAS gene and NDRG4 gene of a sample to be detected, and carrying out methylation treatment on the NDRG4 gene; sequencing the KRAS gene and the methylated NDRG4 gene respectively to obtain a KRAS gene sequencing result and an NDRG4 gene sequencing result; performing first comparison on a gene sequence of a first target point position in the KRAS gene sequencing result and a first reference sequence, and calculating the KRAS gene mutation rate; performing second comparison on the gene sequence of a second target point position in the NDRG4 gene sequencing result and a second reference sequence, and calculating the methylation linkage ratio of the NDRG4 gene; and determining whether the colorectal tumor cells exist in the sample to be detected based on the KRAS gene mutation rate and the NDRG4 gene methylation linkage rate. The method and the system can be used for quickly, simply and specifically detecting whether the tumor cells are colorectal tumor cells or not, and have high sensitivity.

Description

Fecal DNA colorectal tumor polygene prediction model based on NGS technology

Technical Field

The invention relates to the technical field of molecular biology. In particular to a fecal DNA colorectal tumor polygene prediction model based on NGS technology. More specifically, the present invention relates to methods and systems for determining colorectal tumor cells based on the KRAS and NDRG4 genes.

Background

Colorectal cancer (CRC) is a common malignant tumor, including colon tumor and rectal tumor, also called large intestine tumor, which refers to a malignant tumor occurring in the colon or rectum of the lower digestive tract of a human body, and is one of the main cancers threatening human health, and the incidence rate of the cancer is higher in the 3 rd position of male tumor and the 2 nd position of female tumor in the world. In China, with the development of social economy, the change of living habits and dietary structures of residents and the like, the morbidity and mortality of colorectal tumors in China continuously rise. The statistics data of Chinese cancer in 2015 show that new cases and death cases of colorectal tumors in China are located at the 5 th position, which are about 37.63 ten thousand and 19.10 ten thousand respectively, and the morbidity and mortality of colorectal tumors are higher than the global average level and in developing countries, so that the colorectal cancer becomes a disease seriously harming the health of Chinese people.

Colorectal tumors usually develop slowly, most colorectal tumors have already developed slowly in the form of polyps or adenomas at the diseased site for more than 10 years before forming, and the biological characteristics make colorectal tumors suitable for screening and the 5-year survival rate after the early colorectal tumor surgery can reach more than 90%, while the later stage is less than 10%. The existing methods for colorectal tumor screening mainly comprise colonoscopy, fecal occult blood detection and the like, but have the defects of low sensitivity, poor specificity, low patient compliance and the like. Therefore, a screening method with better sensitivity and specificity and higher efficiency is found, and the method has important significance for the tool for early diagnosis of colorectal tumors.

Disclosure of Invention

The present invention is directed to solving at least one of the problems of the prior art to some extent.

In one aspect of the invention, a method of determining colorectal tumor cells is provided. According to an embodiment of the invention, the method comprises: respectively obtaining KRAS gene and NDRG4 gene of a sample to be detected, and carrying out methylation treatment on the NDRG4 gene; sequencing the KRAS gene and the methylated NDRG4 gene respectively to obtain a KRAS gene sequencing result and an NDRG4 gene sequencing result; performing first comparison on a gene sequence of a first target point position in the KRAS gene sequencing result and a first reference sequence, and calculating the KRAS gene mutation rate; performing second comparison on the gene sequence of a second target point position in the NDRG4 gene sequencing result and a second reference sequence, and calculating the methylation linkage ratio of the NDRG4 gene; and determining whether the colorectal tumor cells exist in the sample to be detected based on the KRAS gene mutation rate and the NDRG4 gene methylation linkage rate.

The inventor researches and discovers that the KRAS gene target spot and the NDRG4 gene target spot are mutually related, and then a detection model is established by adopting a logistic regression algorithm based on the mutation rate of the KRAS gene target spot and the methylation linkage ratio of the NDRG4 gene target spot, so that whether colorectal tumor cells exist can be quickly, simply and specifically detected, and the sensitivity is high.

In tumor research, the KRAS gene is a protooncogene and plays a key role in tumor occurrence, development, proliferation, metastasis and angiogenesis. The KRAS gene can lose function after mutation, thereby stimulating the spontaneous growth and differentiation of cells. Researches find that the mutation of the KRAS gene plays an important role in the occurrence and development of colorectal tumors, and suggest that the KRAS gene can become a new diagnosis target of the colorectal tumors.

In the invention, the gene sequence of the first target point position in the KRAS gene sequencing result is compared with a first reference sequence (SEQ ID NO: 1) so as to obtain the mutation rate for the subsequent algorithm judgment.

SEQ ID NO:1 is shown as follows:

AAAGAATGGTCCTGCACCAGTAATATGCATATTAAAACAAGATTTACCTCTATTGTTGGATCATATTCGTCCACAAAATGATTCTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCACCAGCTCCAACTACCACAAGTTTATATTCAGTCATTTTCAGCAGGCCT

it is currently widely accepted that DNA methylation is closely related to the development of cancer. Methylation abnormalities in cancer are manifested by a decrease in the overall level of methylation and an increase in the level of methylation in the promoter region. For example, hypermethylation of cancer suppressor genes and repair genes can lead to their inactivation, resulting in loss of tumor suppression and increased gene damage. NDRG4 is a member of the NDRG gene family of cancer suppressor genes. The research finds that the methylation of the NDRG4 gene is an important biological characteristic of colorectal tumors, so that the methylation of the NDRG4 promoter can be used as a biomarker for detecting the colorectal tumors.

In the present invention, the NDRG4 gene is methylated in advance, and all unmethylated cytosines are converted to uracil while methylated cytosines are not changed. During subsequent sequencing, uracil is all converted to thymine. Furthermore, the methylation conversion rate was calculated by comparing the gene sequence at the second target site of interest in the sequencing results of the methylated NDRG4 gene with a second reference sequence (SEQ ID NO: 2) and counting the C/T ratio of the unmethylated sites. Further, in order to reduce the influence of the conversion rate on the detection result, the linkage methylation sites are used as a statistical index for judging whether the gene segments are methylated, that is, whether all target targets in each read are methylated simultaneously is counted, and as the linkage index, the ratio of the reads in which linkage methylation occurs to the total reads is calculated to obtain the methylation linkage ratio.

SEQ ID NO:2 is shown as follows:

AGGTTTTTGAGTTTTTGGTTTTTTTCGATTTTAAGGGTTTTTTTTTTTCGGTTTTTAGGCGGCGACGGCGGGTAGCGCGAAGTAGTAGGCGTAGGGGCGTTGGGATGGGGATGTTTTTGTAGGTTTA

according to an embodiment of the present invention, the method for determining colorectal tumor cells described above may further have the following additional technical features:

according to an embodiment of the present invention, the presence or absence of colorectal tumor cells in the test sample is determined based on the following criteria:

the KRAS gene mutation rate is greater than 0.0021, and the NDRG4 gene methylation linkage ratio is greater than 0.00115, which is an indication of the colorectal tumor cells existing in the sample to be detected; the KRAS gene mutation rate is not more than 0.0021 or the NDRG4 gene methylation linkage ratio is not more than 0.00115, which is an indication that the sample to be tested does not have colorectal tumor cells. The inventor collects a large number of samples for sequencing, simultaneously collects clinical and pathological information, comprehensively analyzes a genome sequencing result and the clinical information, and obtains the algorithm by utilizing a biological statistical analysis method. Therefore, the method can be used for quickly, simply and specifically detecting whether the colorectal tumor cells exist or not, and has high sensitivity.

According to an embodiment of the invention, the first target of interest is selected from codon 12 and codon 13 of exon 2. The inventors found that there were significant differences between the above targets of colorectal tumor cells and normal cells. Therefore, the existence of the colorectal tumor cells can be specifically determined by detecting the mutation rate of the target points.

According to an embodiment of the invention, the second target of interest is selected from the 6 th and 14 th CpG positions (NC-000016.9: 58497140,58497161) calculated from the primer upstream of the promoter region in the direction of gene transcription. The inventors have found that the methylation degree of the target of the colorectal tumor cell is high, and further, all the unmethylated cytosines are converted into uracil by methylation treatment of the NDRG4 gene of the sample to be tested, and the methylated cytosines are not changed. And comparing the methylated target site gene sequence with a second reference sequence, thereby calculating the methylation conversion rate. Further, in order to reduce the influence of the conversion rate on the detection result, the linkage methylation sites are used as a statistical index for judging whether the gene segments are methylated, namely, whether methylation sites 6 and 14 in each read are methylated simultaneously is counted, and the ratio of the reads in which linkage methylation occurs to the total reads is calculated as the linkage index to obtain the methylation linkage ratio.

According to an embodiment of the invention, the sample to be tested is derived from stool. According to a particular embodiment of the invention, the colorectal tumor cell is an intestinal epithelial tumor cell, preferably a human intestinal epithelial tumor cell.

At present, more methods used in colorectal tumor screening are a fecal occult blood test and an enteroscopy, wherein the fecal occult blood test mainly detects blood components in feces, mainly hemoglobin, and if multiple and continuous positive reactions prompt gastrointestinal bleeding, the enteroscopy should be further performed. The fecal occult blood test has the advantages of rapidness, low cost and convenient detection, but has obvious problems, such as poor specificity and great influence by diet, the food and the medicine containing ferrous ions interfere the result, and the false positive rate is 30%. The sensitivity is low, and the bleeding amount is more than 90 mug/ml; the methodology has multiple limitations: the patient is prepared for a long time in advance. Because the color development is judged differently due to different material taking parts and different reaction time, errors can be generated in the test of the same method. The enteroscopy is an examination method for inserting an enteroscopy circulation cavity to the ileocecal part through the anus and observing colon lesions from the side of mucous membrane, and is the best choice for diagnosing large intestine mucous membrane lesions at present. The image of the colon mucosa is transmitted to an electronic computer processing center through an electronic camera probe arranged at the front end of the enteroscope and then displayed on a monitor screen, and the tiny change of the large intestine mucosa can be observed. Enteroscopy is currently the most effective method for finding intestinal tumors and precancerous lesions. The enteroscopy also has certain disadvantages, for example, the enteroscopy needs relatively complicated bowel clearing preparation, and because the enteroscopy is an invasive examination mode, the enteroscopy has certain discomfort and complications, so that an examiner is easy to feel afraid of the mind, the compliance is not high, and the enteroscopy is difficult to popularize on a large scale.

Because some exfoliated cells exist in the feces, detection, such as DNA detection, aiming at the exfoliated cells is used for analyzing the tumor mutation condition of the exfoliated cells of the intestinal wall from the molecular level, and the detection is earlier than the detection under enteroscopy, so that the detection is more suitable for early screening. Compared with detection methods such as blood and enteroscopy, the detection method for the feces has the following advantages: the sampling is convenient and can be carried out every day; the quantity is large, and the detection requirement can be met; non-invasive, non-invasive and highly compliant.

According to an embodiment of the invention, the methylation treatment is performed using bisulfite. The NDRG4 gene is transformed with bisulfite, all unmethylated cytosines are converted to uracil, and methylated cytosines are unchanged, and the methylation linkage ratio is determined by alignment.

According to the embodiment of the invention, the KRAS gene sequencing result and the NDRG4 gene sequencing result are obtained by performing quality control, filtering, alignment, splicing and quality value correction on the raw data obtained by sequencing the KRAS gene and the methylated NDRG4 gene respectively and independently. Therefore, the accuracy of the sequencing result is improved.

According to an embodiment of the invention, the sequencing depth of the sequencing is not less than 20000 x. Therefore, the accuracy of the sequencing result is improved.

In another aspect of the invention, the invention proposes a system for implementing the method for determining colorectal tumor cells described above. According to an embodiment of the invention, the system comprises: the gene acquisition device is suitable for respectively acquiring KRAS gene and NDRG4 gene of a sample to be detected and carrying out methylation treatment on the NDRG4 gene; the sequencing device is connected with the gene acquisition device and is suitable for sequencing the KRAS gene and the methylated NDRG4 gene respectively to obtain a KRAS gene sequencing result and an NDRG4 gene sequencing result; the comparison device is connected with the sequencing device and is suitable for carrying out first comparison on a gene sequence at a first target point position in the KRAS gene sequencing result and a first reference sequence so as to calculate the KRAS gene mutation rate; performing second comparison on the gene sequence of a second target point position in the NDRG4 gene sequencing result and a second reference sequence, and calculating the methylation linkage ratio of the NDRG4 gene; and the judging device is connected with the comparing device and is suitable for determining whether colorectal tumor cells exist in the sample to be detected based on the KRAS gene mutation rate and the NDRG4 gene methylation linkage rate. The system of the invention can be used for quickly, simply and specifically detecting whether colorectal tumor cells exist or not, and has high sensitivity.

It should be noted that the features and advantages described above for the method for determining colorectal tumor cells are also applicable to the system for determining colorectal tumor cells, and will not be described herein again.

In addition, it should be noted that the method and system for determining colorectal tumor cells of the present invention have at least the following advantages:

(1) the colorectal cancer can be quickly, accurately and specifically diagnosed, and the early diagnosis jig for the colorectal cancer is of great significance;

(2) for example, the method and the system can accurately screen colorectal cancer cells, further perform whole gene map detection on the colorectal cancer cells, discover other pathogenic genes and provide a basis for the theoretical research of colorectal cancer.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:

FIG. 1 shows a schematic of KRAS gene capture according to one embodiment of the present invention;

FIG. 2 shows a scheme for the methylation conversion of NDRG4 according to one embodiment of the present invention;

FIG. 3 shows a schematic of library building and data splitting on KRAS sequencing according to one embodiment of the present invention;

FIG. 4 shows a schematic diagram of KRAS detection mutation site counting according to one embodiment of the present invention;

FIG. 5 shows a schematic representation of NDRG4 methylation counts according to one embodiment of the present invention;

FIG. 6 shows determining threshold ranges for colorectal tumor cells, according to one embodiment of the invention.

Detailed Description

The scheme of the invention will be explained with reference to the examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples, where specific techniques or conditions are not indicated, are to be construed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1

Clinical samples with different disease course distributions of enteroscopy case results in 2017 of Lanxi red cross hospital, the second subsidiary hospital of the Sian traffic university, the Cijing hospital and the Tang city hospital 2016-. And (3) performing gene capture and high-throughput sequencing on the sample, simultaneously collecting clinical and pathological information of the sample, and finally comprehensively analyzing a genome sequencing result and the clinical information to construct a colorectal tumor cell detection model.

(1) Gene capture and high throughput sequencing

Fecal samples were subjected to gene capture and high throughput sequencing in the company's laboratory (see FIG. 1). Extracting genome DNA of a sample to be detected, and capturing target genes KRAS and NDRG4 by using a probe; converting the NDRG4 gene using bisulfite conversion to retain methylated C bases and to convert unmethylated C bases (fig. 2); and (3) sequencing by adopting an Illumina Miniseq/Miseq platform, wherein the average sequencing depth of the DNA sample is more than 20000 x. The specific analysis process is as follows:

1 raw data processing

The raw sequencing data from the machine is first subjected to basic processing such as quality control, filtering, alignment, and PE reads stitching and quality value correction (see FIG. 3). The spliced reads are called tags.

2 colorectal tumor-associated Gene site screening

And (3) performing KRAS gene mutation detection, wherein the target detection targets are 7 mutant types of codons 12 and 13 of No. 2 exon of KRAS gene (see figure 4). For NDRG4 gene promoter interval methylation detection, the target detection target point is the 6 th and 14 th CpG positions calculated by the primer at the upstream of the NDRG4 gene promoter region along the gene transcription direction (see figure 5).

3KRAS Gene analysis

3.1 sequence filtration, using a reference sequence (namely a first reference sequence) of a KRAS gene non-mutation site, filtering a sequence containing the KRAS gene from tags of each split and spliced sample, evaluating amplification specificity and counting the content of impurities such as non-specific amplification, joint pollution and the like.

3.2 sequencing error rate was checked using the non-mutated sites as background noise.

3.3 identifying the mutation type, counting the effective sequencing quantity and mutation rate of the KRAS gene, and outputting the result.

4NDRG4 Gene methylation analysis

4.1 sequence filtration, using the reference sequence (i.e. the second reference sequence) of the NDRG4 non-methylation site, filtering the sequence containing the NDRG4 gene from the tags of each separated sample, and evaluating the amplification specificity, the conversion efficiency and the statistics of the content of impurities such as non-specific amplification and linker contamination.

4.2 recognition of methylated sites and estimation of methylation conversion by statistical C/T ratio of unmethylated sites.

4.3 in order to reduce the influence of the transformation efficiency on the measurement, the linked methylation sites are used as statistical indexes for judging whether the gene segments represented by the tags are methylated or not; that is, the condition whether methylation occurs at the 6 th and 14 th methylation sites in each tag is counted, and the ratio of the tags with linkage methylation to the total tags is calculated as the linkage index, namely the NDRG4 gene methylation linkage ratio.

5 determination of results

Judging whether the 2 detection results are larger than a decision threshold value or not according to the measured values, namely judging that the KRAS gene mutation rate is larger than 0.0021 and the NDRG4 gene methylation linkage ratio is larger than 0.00115, and judging that the KRAS gene mutation rate is positive; and (4) judging the gene is negative if the mutation rate of the KRAS gene is not more than 0.0021 or the methylation linkage ratio of the NDRG4 gene is not more than 0.00115.

The sensitivity and specificity of this model were 86.3% and 92.1%, respectively, as shown in table 1 and fig. 6. Therefore, the method disclosed by the invention is high in accuracy and strong in sensitivity.

TABLE 1 sensitivity and specificity of the prediction model

	Sensitivity of the probe	Specificity of
			The invention	86.3％	92.1％

Note:

sensitivity (also known as true-positive rate, sensitivity) is true-positive number/(true-positive number + false-negative number) × 100%. Refers to the degree to which a patient is correctly diagnosed, i.e., the percentage of patients that are actually ill and correctly diagnosed.

Specificity (also called true negative rate, specificity) is true negative number/(true negative number + false positive number) × 100%. Refers to the degree to which a non-patient is correctly judged, i.e., the percentage of patients that are actually disease-free and correctly diagnosed as disease-free.

Example 2

Enumerate 6 cases of the process of obtaining consistency judgment by applying the model to variable results obtained by measuring by using the NGS technology in volunteers hospitalized in Lanxi red cross hospital, the second affiliated hospital of the Siam traffic university, the Cijing hospital and the Tang hospital respectively.

The method specifically comprises the following steps: in the clinical test, total 6 clinical samples are selected, and feces samples are collected and detected before enteroscopy of the selected people.

Referring to the gene model analysis method of example 1, colorectal tumor determination results were obtained for 6 patients, and clinical results thereof were collected as summarized in table 2. Therefore, the method for determining the fecal DNA colorectal tumor based on the NGS technology has good reliability and accuracy.

TABLE 26 patient Gene model determination and clinical results

In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

SEQUENCE LISTING

<110> Shanghai Sharp next Biotech Co., Ltd

<120> fecal DNA colorectal tumor polygene prediction model based on NGS technology

<130> PIDC4180034

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 171

<212> DNA

<213> Artificial Sequence

<220>

<223> SEQ ID NO：1

<400> 1

aaagaatggt cctgcaccag taatatgcat attaaaacaa gatttacctc tattgttgga 60

tcatattcgt ccacaaaatg attctgaatt agctgtatcg tcaaggcact cttgcctacg 120

ccaccagctc caactaccac aagtttatat tcagtcattt tcagcaggcc t 171

<210> 2

<211> 127

<212> DNA

<213> Artificial Sequence

<220>

<223> SEQ ID NO：2

<400> 2

aggtttttga gtttttggtt tttttcgatt ttaagggttt ttttttttcg gtttttaggc 60

ggcgacggcg ggtagcgcga agtagtaggc gtaggggcgt tgggatgggg atgtttttgt 120

aggttta 127

Claims

1. The application of the reagent for detecting the 120 th to 125 th base mutation level in KRAS gene SEQ ID NO. 1 and the reagent for detecting the methylation linkage level of the 6 th and 10 th CpG islands in NDRG4 gene SEQ ID NO. 2 in preparing the reagent for determining whether colorectal tumor cells exist in a sample to be detected is characterized in that,

the reagent for detecting the 120 th to 125 th base mutation level in the KRAS gene SEQ ID NO. 1 and the reagent for detecting the 6 th and 10 th CpG methylation linkage level in the NDRG4 gene SEQ ID NO. 2 are realized by a sequencing technology,

the method comprises the following steps:

respectively obtaining KRAS gene and NDRG4 gene of a sample to be detected, and carrying out methylation treatment on the NDRG4 gene;

sequencing the KRAS gene and the methylated NDRG4 gene respectively to obtain a KRAS gene sequencing result and an NDRG4 gene sequencing result;

performing first comparison on a gene sequence of a first target point position in the KRAS gene sequencing result and a first reference sequence to calculate the KRAS gene mutation rate, wherein the first target point is the 120 th to 125 th bases in SEQ ID NO. 1, and the first reference sequence is SEQ ID NO. 1;

performing second comparison on a gene sequence at a second target point position in the NDRG4 gene sequencing result and a second reference sequence to calculate the methylation linkage ratio of the NDRG4 gene, wherein the second target point is the methylation linkage level of the 6 th and the 10 th CpG islands in SEQ ID NO 2, and the second reference sequence is SEQ ID NO 2;

establishing a detection model by adopting a logistic regression algorithm based on the KRAS gene mutation rate and the NDRG4 gene methylation linkage rate, and determining whether colorectal tumor cells exist in the sample to be detected;

determining whether the sample to be tested has colorectal tumor cells based on the following criteria:

the KRAS gene mutation rate is greater than 0.0021, and the NDRG4 gene methylation linkage ratio is greater than 0.00115, which is an indication of the colorectal tumor cells existing in the sample to be detected;

the KRAS gene mutation rate is not more than 0.0021 or the NDRG4 gene methylation linkage ratio is not more than 0.00115, and the KRAS gene mutation rate is an indication that colorectal tumor cells do not exist in the sample to be detected;

the sample to be tested is derived from feces.

2. The use according to claim 1, wherein the colorectal tumor cell is a human intestinal epithelial tumor cell.

3. Use according to claim 1, characterized in that the methylation treatment is carried out with bisulphite.

4. Use according to claim 1, wherein the raw data obtained from sequencing the KRAS gene and methylated NDRG4 gene are subjected to quality control, filtering, alignment, splicing and quality value correction independently to obtain the KRAS gene sequencing result and NDRG4 gene sequencing result.

5. The use according to claim 1, wherein the sequencing depth is not less than 20000 x.