CN108250292B

CN108250292B - Chilo suppressalis callosity venom, ovarian serine protease inhibitor CcSPN and application

Info

Publication number: CN108250292B
Application number: CN201711304696.7A
Authority: CN
Inventors: 叶恭银; 滕子文; 熊时姣; 方琦
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2017-12-11
Filing date: 2017-12-11
Publication date: 2020-04-17
Anticipated expiration: 2037-12-11
Also published as: CN108250292A

Abstract

The present invention relates to the fields of molecular biology, genetic engineering and protein engineering. Specifically, the invention discloses chilo suppressalis cocoon bee venom and ovarian secretory protein serine protease inhibitor CcSPN protein, and the amino acid sequence of the protein is SEQ ID NO: 2, the preparation method is as follows. The invention also provides a gene for coding the CcSPN protein, and the nucleotide sequence of the gene is SEQ ID NO: 1, the preparation method comprises the following steps of; or to SEQ ID NO: 1 has at least 70% homology with the nucleotide sequence in the sequence table; or the nucleotide sequence of the polypeptide can be matched with the nucleotide sequence shown in SEQ ID NO: 1. The inhibitor prepared by the invention can be used for inhibiting the blackening of the haemolymph of the larvae of the host chilo suppressalis.

Description

Chilo suppressalis callosity venom, ovarian serine protease inhibitor CcSPN and application

Technical Field

The present invention relates to the fields of molecular biology, genetic engineering and protein engineering. In particular to a serine protease inhibitor protein CcSPN secreted in the venom gland and ovary of chilo suppressalis calluses and a coding nucleic acid sequence and application thereof.

Background

Agricultural pests are important restriction factors for increasing agricultural production and improving agricultural product quality, and according to statistics, the amount of grains lost due to diseases and pests in China is nearly 500 jin each year, and the loss of economic crops reaches more than 350 jin. For a long time, the unreasonable use of chemical pesticides in large quantities has resulted in pesticide residues, pest resistance and rampant problems. Since the middle of the 90 s of the 20 th century, the cultivation and application of insect-resistant transgenic crops have succeeded, and new opportunities for pest control have come into play. Statistically, the global transgenic planting area has increased dramatically from about 170 million hectares in 1996 to 1.8 million hectares in 2014 (where the insect-resistant accounts for 43%), yielding significant economic and ecological effects. However, the problem of resistance to target pests is also emerging increasingly when Bt gene resistant crops are planted singly for a long time.

Therefore, researchers also devote to the discovery of novel insecticidal protein/peptide genes from microorganisms, plants and animals and the cultivation of novel insect-resistant transgenic crops by means of multiple genes or fusion genes and the like so as to solve the problems brought by the pesticides and Bt crops. Parasitic wasps are important natural enemy insects and have important biocontrol value. Parasitic wasps carry a variety of parasitic factors, including venoms (venoms), ovarian secreted proteins (ovarian fluids), polydinaviruses (polydinaviruses), viroid-like particles (virus-like particles), teratocytes (teratocytes), and the like. These parasitic factors can regulate physiological activities such as host immune response, growth and development, etc. The research on parasitic factors of parasitic wasps can serve for production and open up a new way for biological control of pests. For example, the secretory protein gene of the teratocyte of the Tibetan podophyllum crocosma (Micropliis crocipes) is transferred into tobacco, and the resistance of the plant to the tobacco hornworm (Manduca sexta) can be improved.

Chilo suppersalis, belonging to Lepidoptera Cnaphalocrocis (Lepidoptera: Crambidae), is one of important boring pests on rice in China and can cause rice withered hearts, white ears and the like. The insect has wide distribution and strong adaptability. The annual occurrence area of the rice borers in China is more than 1500 million hectares, and the total economic loss is about 115 million yuan. Chilo suppressalis cocoon discs (Cotesiaceae) belong to Hymenoptera cocoon bee family (Hymenoptera: Braconidae), are mainly distributed in Guizhou, Jiangsu, Zhejiang, Jiangxi, Hunan, Sichuan, Fujian, Guangdong, Guangxi, Yunnan, Taiwan and the like in China, and are also distributed in Asia such as Indonesia, Japan and Korea. The parasitic wasp is a dominant multi-parasitic endoparasitic wasp in the larva stage of chilo suppressalis, for example, the parasitic rate of the chilo suppressalis in the overwintering generation period of Jiangsu can reach 90 percent, the parasitic rate of the chilo suppressalis in the growth period of rice is 10 to 30 percent, and parasitic factors of the parasitic wasp comprise venom, ovarian secretory protein and abnormal cells, so that the parasitic wasp has important production practice significance for research and excavation of specific components of the parasitic factors.

Disclosure of Invention

The invention aims to solve the technical problem of providing a serine protease inhibitor gene CcSPN secreted by the venom gland and ovary of chilo suppressalis callosity and callosity of chilo suppressalis and having an immune suppression effect (blood lymph blackening suppression) on common agricultural pests, and a protein coded by the serine protease inhibitor gene CcSPN and application of the serine protease inhibitor gene CcSPN.

In order to solve the technical problems, the invention provides a serine protease inhibitor CcSPN protein secreted by the venom gland and ovary of chilo suppressalis callosity and the amino acid sequence of the protein is SEQ ID NO: 2, respectively.

Remarks explanation: SEQ ID NO: 2 comprises a signal peptide, signal peptide M I K L I L I A T I V V L TI P D S S C.

The improvement of the serine protease inhibitor CcSPN secreted by the venom gland and ovary of Chilo suppressalis callosity cocoon bee of the invention: the protein, conservative variant protein thereof, active fragment thereof or active derivative thereof.

The invention also provides a gene for coding the serine protease inhibitor CcSPN secreted by the venom gland and ovary of the chilo suppressalis callosity cocoon bee, and the nucleotide sequence of the gene is SEQ ID NO: 1, the preparation method comprises the following steps of; or to SEQ ID NO: 1 has at least 70% homology with the nucleotide sequence in the sequence table; or the nucleotide sequence of the polypeptide can be matched with the nucleotide sequence shown in SEQ ID NO: 1.

As an improvement of the gene of the present invention: the sequence comprises SEQ ID NO: 1, 8-66 continuous nucleotides.

The invention also provides the application of the serine protease inhibitor protein CcSPN secreted by the venom gland and ovary of the chilo suppressalis callosity cocoon bee: the protein and eGFP (enhanced green fluorescent protein) protein fusion expression can be used for inhibiting the blackening reaction of chilo suppressalis blood lymph.

The serine protease inhibitor protein secreted by the venom gland and ovary of chilo suppressalis cotesia disclosea and the nucleic acid sequence for coding the protein provided by the invention can be applied to the amino acid sequence and the coding sequence of the protein, and can be developed into insect-resistant crops and biological pesticides with application values and applied to a plurality of fields of agricultural pest control and the like.

The invention is realized by the following technical scheme: the invention utilizes chilo suppressalis cotesia discutialis venom gland and ovary transcriptome sequencing to obtain a complete sequence of a serine protease inhibitor gene, carries out reverse transcription on extracted RNA of chilo suppressalis cotesia discutialis venom gland to obtain cDNA, carries out molecular cloning, eukaryotic expression and purification under non-denaturing conditions, and eGFP-CcSPN (eGFP and CcSPN fusion expression) expressed by the eukaryotic system can inhibit the humoral immunity function (blackening reaction) of the haemolymph of chilo suppressalis larva of agricultural pest.

The DNA molecules isolated by the invention comprise: the nucleotide sequence of a serine protease inhibitor CcSPN with secretion of chilo suppressalis cotesia discutita venom gland and ovary, and the nucleotide sequence is similar to the nucleotide sequence shown in SEQ ID NO: 1 has at least 70% homology with the nucleotide sequence in the sequence table; or the nucleotide sequence can be matched with the nucleotide sequence shown in SEQ ID NO: 1. Preferably, the sequence encodes a polypeptide having the sequence of SEQ ID NO: 2 in sequence shown in the specification. More preferably, the sequence has the sequence shown in SEQ ID NO: 1.

The serine protease inhibitor CcSPN secreted by the venom gland and the ovary of chilo suppressalis calluses separated by the invention comprises: has the sequence shown in SEQ ID NO: 2, or a conservative variant thereof, or an active fragment thereof, or an active derivative thereof. Preferably, the protein is a polypeptide having the sequence of SEQ ID NO: 2, or a pharmaceutically acceptable salt thereof.

The DNA molecule of the invention comprises 8-66 consecutive nucleotides in said DNA molecule.

The host cell transformed with the DNA molecule of the invention is an insect cell.

In the present invention, "isolated", "purified" DNA means that the DNA or fragment has been isolated from the sequences which flank it in the natural state, and that the DNA fragment has been separated from the components which accompany the nucleotides in the natural state, and from the proteins which accompany it in the cell.

In the invention, the nucleic acid sequence coded by the serine protease inhibitor CcSPN secreted by the venom gland and ovary of chilo suppressalis calluses is as follows: the nucleotide sequence of the protein with the activity of serine protease inhibitor CcSPN secreted by chilo suppressalis cotesia discutita venom gland and ovary is shown as SEQ ID NO: 1 and degenerate sequences thereof. The degenerate sequence is SEQ ID NO: 1 sequence having one or more codons substituted by a degenerate codon encoding the same amino acid. Due to codon degeneracy, compared to SEQ ID NO: 1 can also encode a degenerate sequence with a nucleotide sequence homology as low as about 70% as shown in SEQ ID NO: 1.

Also included are compositions that hybridize under moderately stringent conditions, more preferably under highly stringent conditions, to the nucleotide sequence of SEQ ID NO: 1, or a nucleotide sequence that hybridizes to the nucleotide sequence in 1. Also included are the sequences substantially identical to SEQ ID NO: 1, preferably at least 80%, more preferably at least 90%, most preferably at least 95%. Also included are variant forms of the sequence of SEQ id No.1 which encode proteins having the same function of the natural chilo suppressalis discodermic venom gland and ovary secreted serpin protein CcSPN. These variants include (but are not limited to): deletion, insertion and/or substitution of several (usually 1 to 90, preferably 1 to 60, more preferably 1 to 20, most preferably 1 to 10) nucleotides, and addition of several (usually less than 60, preferably less than 30, more preferably less than 10, most preferably less than 5) nucleotides at the 5 'and/or 3' end.

The serine protease inhibitor CcSPN protein secreted by the venom gland and ovary of chilo suppressalis calluses in the invention refers to: the protein with the sequence of SEQ ID NO.2 of the activity of serine protease inhibitor CcSPN secreted by chilo suppressalis cotesia discutialis venom glands and ovaries. The term also includes variants of the sequence of SEQ ID No.2 which have the same function as the serine protease inhibitor CcSPN secreted by the venom glands and ovaries of the natural chilo suppressalis callousia disclosaeli. These variants include (but are not limited to): deletion, insertion and/or substitution of several (usually 1 to 50, preferably 1 to 30, more preferably 1 to 20, most preferably 1 to 10) amino acids, and addition of one or several (usually up to 20, preferably up to 10, more preferably up to 5) amino acids at the C-terminal and/or N-terminal. For example, in the art, substitutions with amino acids of similar or similar properties will not generally alter the function of the protein. Also, for example, the addition of one or several amino acids at the C-terminus and/or N-terminus does not generally alter the function of the protein. The term also includes active fragments and active derivatives of the serine protease inhibitor CcSPN secreted by the gonads and ovaries of chilo suppressalis calluses.

The serine protease inhibitor CcSPN conservative variant protein secreted by the venom gland and ovary of chilo suppressalis callosity wasps in the invention refers to: compared with the amino acid sequence of SEQ ID NO.2, the protein is formed by replacing at most 10, preferably at most 8, and more preferably at most 5 amino acids with similar or similar properties.

The invention also includes analogs of the Chilo suppressalis Cucumaria frondosa venom gland and ovary secreted serine protease inhibitor CcSPN or proteins which differ from the natural serine protease inhibitors by either amino acid sequence differences or by modifications which do not affect the sequence, or both.

Modified (generally without altering primary structure) forms include: chemically derivatized forms of the protein such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation, such as those proteins that result from glycosylation modifications during synthesis and processing of the protein or during further processing steps. Such modification may be accomplished by exposing the protein to an enzyme that performs glycosylation, such as mammalian glycosylating or deglycosylating enzymes. Modified forms also include sequences having phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine). Also included are proteins that have been modified to improve their proteolytic properties or to optimize their solubility properties.

In the present invention, various vectors known in the art, such as commercially available vectors, including plasmids, cosmids, and the like, can be used. When the serine protease inhibitor CcSPN protein secreted by the chilo suppressalis cotesia discutialis venom gland and ovary is produced, the coding sequence of the serine protease inhibitor CcSPN secreted by the chilo suppressalis cotesia discutialis venom gland and ovary can be operably linked to an expression control sequence, so that the expression vector of the serine protease inhibitor CcSPN secreted by the chilo suppressalis cotesia discutialis venom gland and ovary is formed.

"operably linked" according to the present invention refers to the situation where certain parts of a linear DNA sequence are capable of affecting the activity of other parts of the same linear DNA sequence. For example, if the signal peptide DNA is expressed as a precursor and is involved in secretion of the protein, the signal peptide (secretory leader) DNA is operably linked to the protein DNA; a promoter is operably linked to a coding sequence if it controls the transcription of that sequence; a ribosome binding site is operably linked to a coding sequence if it is placed in a position that enables translation. Generally, "operably linked" means adjacent, and for secretory leaders means adjacent in reading frame.

In the present invention, the host cell is a prokaryotic cell or a eukaryotic cell. A commonly used prokaryotic host cell is referred to as an E.coli cell. A common eukaryotic host cell is referred to as an insect cell line.

The expression of the gene products of the serine protease inhibitor CcSPN secreted by the coccinella discoidea venom gland and the ovary can also be analyzed by Northern blotting technology or fluorescent quantitative PCR (polymerase chain reaction), namely, the existence, the absence and the quantity of the RNA transcript of the serine protease inhibitor CcSPN secreted by the coccinella discoidea venom gland and the ovary can be analyzed in the cells.

In addition, the nucleic acid molecule which can be used as a probe in the invention generally has 8 to 66 continuous amino acids, preferably 15 to 50 continuous nucleotides, of the nucleotide coding sequence of the serine protease inhibitor CcSPN secreted by the coccinella furcifera venom gland and ovary. The probe can be used for detecting whether nucleic acid molecules of a serine protease inhibitor CcSPN secreted by the venom gland and ovary of chilo suppressalis calluses are present in a sample.

The invention relates to a method for detecting whether a serine protease inhibitor CcSPN nucleotide sequence secreted by the venom gland and ovary of chilo suppressalis calluses is present in a sample, which comprises the steps of hybridizing the probe with the sample and then detecting whether the probe is combined. Preferably, the sample is a product after PCR amplification, wherein PCR amplification primers correspond to the nucleotide coding sequence of serine protease inhibitor CcSPN secreted by the coccinella discoidea venom gland and ovary, and can be positioned at two sides or in the middle of the coding sequence. Primers are typically 15-50 nucleotides in length.

In addition, according to the nucleotide sequence and the amino acid sequence of the serine protease inhibitor CcSPN secreted by the chilo suppressalis cotesia discutialis venom gland and ovary, the homologous gene or the homologous protein of the serine protease inhibitor CcSPN secreted by the chilo suppressalis cotesia discutialis venom gland and ovary can be screened on the basis of nucleic acid homology or expressed protein homology.

The full-length nucleotide sequence or the fragment of the serine protease inhibitor CcSPN secreted by the venom gland and the ovary of the chilo suppressalis callosity cocoon bee can be obtained by a PCR amplification method, a recombination method or an artificial synthesis method. For the PCR amplification method, primers can be designed based on the nucleotide sequences disclosed herein, and the sequences can be amplified using a commercially available cDNA library or a cDNA library prepared by a conventional method known to those skilled in the art as a template.

Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

Furthermore, mutations can also be introduced into the protein sequences of the invention by chemical synthesis. By utilizing the serine protease inhibitor CcSPN secreted by the venom gland and the ovary of the chilo suppressalis cotesia discutialis, substances or receptors and the like with interaction between the venom gland and the serine protease inhibitor CcSPN secreted by the ovary of the chilo suppressalis cotesia discutialis can be screened out by various conventional screening methods.

The invention has obvious inhibition effect in the hemolymph blackening test of the important rice pest chilo suppressalis, and has obvious inhibition effect on the humoral immunity of the chilo suppressalis. The harm of agricultural pests in China is very serious, the negative effect of using chemical pesticides is great, and the serine protease inhibitor CcSPN secreted by the coccinella discoidea venom gland and ovary of the chilo suppressalis is a new protein with an immunosuppressive effect on the agricultural pests, so that the chilo suppressalis CcSPN has a great application value.

Drawings

The following describes embodiments of the present invention in further detail with reference to the accompanying drawings.

FIG. 1 is a diagram showing the separation and purification of the CcSPN and enhanced green fluorescent protein fusion expression in eukaryotic system; note: m is a standard protein;

panel A is 12% polyacrylamide gel electrophoresis (SDS-PAGE), in which lane 1: sf9 cell lysate supernatant; and 2, performing: sf9 cell lysate precipitation; and 3, performing the following steps: sf9 cell lysate supernatant containing the recombinant pBacHTeGFPT-CcSPN plasmid; 4, performing channel: sf9 cell lysate precipitate containing recombinant pBacHTeGFPT-CcSPN plasmid; and 5, performing: a purified product of the supernatant of sf9 cell lysate containing the recombinant pBacHTeGFPT-CcSPN plasmid; 6, performing the following steps: sf9 cell lysate supernatant containing the pBacHTeGFPT plasmid; 7, performing channel: precipitation of sf9 cell lysate containing pBacHTeGFPT plasmid; and 8, performing: a purified product of supernatant of sf9 cell lysate containing pBacHTeGFPT plasmid;

panel B is an immunoblot assay (Western Blot) with lane 9: purified eGFP-CcSPN; 10, performing channel: purified eGFP. The antibody used was rabbit anti-CcSPN antibody.

FIG. 2 is a graph showing the inhibitory effect of eukaryotic expression fused eGFP-CcSPN on chilo suppressalis larva hemolymph blackening;

note: PBS is phosphate buffer solution, eGFP is enhanced green fluorescent protein expressed by eukaryotic cells, and eGFP-CcSPN is fusion protein of eGFP and CcSPN expressed by eukaryotic cells. "0.5/1 venom equivalent" represents the amount of venom carried by 0.5/1 female Chilo suppressalis fringed cocoon bee. "phenol oxidizing enzyme activity" is expressed in photometric units: the unit of 1 is 0.001 XOD 490/min/mg.

Detailed Description

The invention is further illustrated below with reference to laboratory specific test data. These examples are intended to illustrate the invention and are not intended to limit the scope of the invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as molecular cloning in Sambrook et al: the conditions described in the laboratory Manual (New York: Cold Spring harbor laboratory Press, 1989), or according to the manufacturer's recommendations.

Example 1: expression and purification of recombinant eGFP-CcSPN

1.1 extraction of RNA

Under a Leica MZ 16A microscope (Leica, Germany), female bees were sterilized with 75% alcohol and wiped clean, their genital tracts were torn out of the abdominal ends, soaked in sterile drops of Phosphate Buffered Saline (PBS) containing 1 unit/. mu.l rnase inhibitor (TOYOBO, Osaka, Japan) on slides, and the venom glands were collected in TRIzol reagent (Invitrogen, California, USA) by the following RNA extraction method:

1) collecting venom gland, adding 1ml Trizol, mixing, standing at room temperature for 5min

2) Adding 0.2ml chloroform into the centrifuge tube, shaking for 15s, transferring the mixed solution into a TIANGEN centrifuge tube, and standing for 2 min.

3) Centrifuge at 12000g for 15min at 4 deg.C, collect the supernatant, and transfer it to a new 1.5ml centrifuge tube.

4) 0.5ml of isopropanol is added into the centrifuge tube, the liquid in the tube is gently mixed evenly, and the mixture is kept stand for 10min at room temperature.

5) Centrifuge at 12000g for 10min at 4 ℃ and discard the supernatant.

6) 1ml of 75% ethanol was added to the centrifuge tube, the precipitate was gently washed, centrifuged at 7500g at 4 ℃ for 5min, and the supernatant was discarded. (at this time, absolute ethyl alcohol is added, and the product can be preserved in an ultralow temperature refrigerator at-80 ℃ for a long time)

7) Drying the centrifuge tube, adding a proper amount of non-RNA enzyme water for dissolving (promoting dissolution at 65 ℃), measuring the value of OD260/OD280 by a spectrophotometer, and carrying out the next step of experiment when the ratio is 1.8-2.0.

1.2 first Strand cDNA Synthesis

Mu.g of RNA was reverse transcribed into a single-stranded cDNA template using a TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (Transgen, Beijing, China) kit, as follows:

total mRNA: 1 μ g

Oligothymidine primer (oligo (dT) n): 0.5. mu.l

Random primers: 0.5. mu.l

2×TS Reaction Mix：10μl

TransScript RT/RI Enzyme Mix:1μl

gDNA Remover:1μl

Rnase-free Water:to 20μl

After the system was prepared, the cells were incubated at 25 ℃ for 10 minutes, at 42 ℃ for 1 hour and finally heated at 85 ℃ for 5 minutes.

The nucleotide sequence of the obtained cDNA is SEQ ID NO: 1, the preparation method is as follows.

1.3 expression and purification of recombinant proteins

Eukaryotic expression was performed by the baculovirus system, and eukaryotic expression primers (pre-primer 5 '-3': GTTCCGCGTGGATCCTATTCAAAATGTATTGCATCAAAATC; post-primer 5 '-3': ACCGCATGCCTCGAGTCAAACTGCAGTAGGGTCCATTACA) were designed by the Premier primer 5. Using the cDNA synthesized as described above as a template, the PCR system was as follows:

cDNA：1μl

Forward primer(10μM)：2μl

Reverse primer(10μM)：2μl

2×TransStar FastPfu PCR SuperMix：25μl

ddH₂O：20μl

Total volume：50μl

and (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 deg.C for 30s, annealing at 55 deg.C for 30s, extension at 72 deg.C for 1min, and circulation for 35 times; extension at 72 ℃ for 10 min.

Preparing 1% agarose Gel, verifying the size of the fragment by electrophoresis of the PCR product, and cutting and recovering the Gel by using an Axygen Gel extraction kit Gel recovery kit.

The target fragment obtained by PCR amplification was homologously recombined with the linearized (cleavage site: BamHI and XhoI) pBacHTeGFPT vector (pFastBacTMHTB plasmid His tag is followed by eGFP sequence, which is provided by professor Zhe Zhang xi) by the Clonexpress One Step Cloning Kit (Vazyme, China), and the recombinant protein expressed by the vector is the protein of the target protein (CcSPN) fused with eGFP.

Remarks explanation: the pBacHTeGFPT vector is clearly informed in the text of the expression of the amazesis peptide haemolytic gene and the enhanced green fluorescent protein gene fused in insect cells.

Homologous recombinants are:

5×CE II Buffer：4μl

linearized cloning vector (linearized pBacHTeGFPT vector): 1 μ l

Insert amplification product: 2 μ l

Exnase^TMII：2μl

The reaction conditions are as follows: reacting at 37 ℃ for 30 minutes, immediately placing the reaction tube in an ice water bath to cool for 15 minutes after the reaction is finished, and directly converting or storing at-20 ℃ for later use.

The recombinant pBacHTeGFPT plasmid was transformed into Transns 5 α chemical Complex Cell (TransGen, Beijing, China) and positive colonies were determined by colony PCR and DNA sequencing, which was done by Shanghai Boshang Biotech Ltd^TMColi Cells (Invitrogen, California, USA) and the recombinant pBacHTeGFPT was verified by colony PCR. Extracting recombinant pBacHTeGFPT using transfection reagent

II Reagent (Invitrogen, California, USA) infected sf9 cells. 3 passages of virus-infected 300ml Sf9 cells (2X 106cells/ml) were collected and passed through I-PER^TMThe lysate supernatant was collected and the pellet was resuspended IN 30. mu.l of double distilled water and tested for SDS-PAGE, two control groups, sf9 cells not transfected with any Bacmid and sf9 cells transfected with pBacHTeGFPT not recombinant CcSPN, both of which were collected and pelleted according to the same procedure as above, and analyzed for SDS-PAGE, the lysate supernatant of two sf9 cells transfected with Bacmid was purified by cPlex His-Tag Purification Resin (Roche, Indaipolis, IN, USA) and Ni-NTA Buffer (Novagen, MA, USA) and the Protein was purified by Western Blot Purification, Western Blot analysis, pH 3, Western Blot 3, USA, and dialyzed for Protein Purification by SDS-PAGE, pH 3, USA, and SDS-PAGE,

pH

3, 3. after centrifugationrotin Assay KitBradford (Sangon Biotech, Shanghai, China).

The amino acid sequences of the obtained chilo suppressalis cotesia discoidea venom and the ovarian protein serine protease inhibitor CcSPN are SEQ ID NO: 2, the preparation method is as follows.

Reduced SDS-PAGE was performed using a Mini-Protein III electrophoresis cell and a Model3000Xi transformer (Bio-rad, Hercules, Calif., USA) with gel and gel concentrations of 5% and 12%, respectively. Coomassie Brilliant blue R-250(Bio-rad, Hercules, Calif., USA) was stained for 15 minutes and then destained with Coomassie Brilliant blue destaining solution. Adopts GS-800^TMPhotographs were taken from a Calibrated Densitometer (Bio-rad, Hercules, Calif., USA) scan.

In Western Blot, protein samples were wet-transferred to nitrocellulose membranes (Sigma, St. Louis, MO, USA) by Mini-protein Tetraelectrophoresis System (Bio-rad, Hercules, Calif., USA) after 12% SDS-PAGE. Antibodies to the CcSPN protein were subjected to polypeptide synthesis (epitope CENTADFQNMTENSG) with a 5000-fold dilution of the primary antibody and a 5000-fold dilution of the secondary antibody with goat anti-rabbit IgG (H + L) (HuaAn Biotechnology, Hangzhou, China). Finally, the color was developed by TMB Stabilized Substrate for HRP (Promega, Madison, Wis., USA), GS-800^TMThe Calibrated Densitometer takes a scan photograph.

The obtained results are shown in fig. 1, and as can be seen from fig. 1, the purified protein eGFP-CcSPN has a single band, can be recognized by a specific antibody, and can be used for subsequent functional verification.

Example 2: determination of inhibition effect of recombinant eGFP-CcSPN on chilo suppressalis larva hemolymph blackening reaction

In the assay of blackening reaction, 20. mu.l, 10 Xhemolymph was mixed with 15. mu.l of eGFP-CcSPN protein solution (corresponding to concentration diluted with PBS) at 50 ng/. mu.l or 100 ng/. mu.l, then 20. mu.l of PBS containing 0.5. mu.g Micrococcus luteus was added at the same time and mixed for 5 minutes, and finally 200. mu.l, 2mM of 3,4-D-L levodopa was added, and change in photometric value within 30 minutes was assayed by Bio-Tek Synergy TMHT Multi-Detection Microplate Reader (Bio-Tek, USA). Controls included 15 μ l of the following solutions: phosphate Buffered Saline (PBS), 100 ng/. mu.l eGFP, 0.5 and 1 equivalent of crude venom (1 equivalent of venom corresponds to the amount of venom carried by 1 female bee) and saturated phenylthiourea, the concentration of eGFP and crude venom being generated by dilution with PBS. The comparison between the two samples was performed using Student's t-test, and Data Processing System (DPS) package (Version 9.5). From fig. 2, it can be seen that: both 50 ng/. mu.l and 100 ng/. mu.l of eGFP-CcSPN can inhibit the blackening reaction of host hemolymph, and the inhibition effect is more obvious along with the increase of the concentration.

Therefore, the chilo suppressalis cotesia discutita venom and the ovarian serine protease inhibitor CcSPN can obviously reduce the blackening capacity of the host (chilo suppressalis) hemolymph.

Finally, it should also be noted that the above-mentioned list is only a specific embodiment of the invention. It is obvious that the invention is not limited to the above embodiment examples, but that many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.

Sequence listing

<110> Zhejiang university

<120> chilo suppressalis cotesia cochleariae venom, ovarian serine protease inhibitor CcSPN and application

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>1221

<212>DNA

<213> Chilo suppressalis fringed cocoon bee (Cotesia chilonis)

<400>1

atgataaagt tgatattaat cgccacaata gtggttttga ctattcccga ttcctcctgc 60

tattcaaaat gtattgcatc aaaatctata aaatatcctc agcgatttgt tttcacaatg 120

actgatttat tcctgagtga tatttataaa gttctagcga ggtatgaaaa aggtaatata 180

attttttcgc cacttagttt gaacgccata ctgaccatgg ttagtttggg cgcaagaggg 240

aacacttctt cagaactaag tacatccttg cgattgtctt gtgataagaa tatcgctgga 300

gaaggatacc gacaacttat tcattttcta ctcaaaatcg aaggggtcaa gcttaagttt 360

gccaataaaa ttttcgtacc acaaacgtca gtactaaaga acagctttag gagtaaaatg 420

aagtggtttt tcaattccga tacatccata attgatccaa cgagaccaga aaaagctgct 480

gaagatatta atcgttggta tgccaaggaa actgaaaatc atataacgaa tttatacgag 540

cccagtgata ttgaaaacgc gaaaatcttg ttggctaatg ccgtttactt caaaggcaac 600

tgggctaata agttcaaccc tcgatggacg caaccatatc cattctatgt taatggtaat 660

agaaaatcaa taaaagatgt accgatgatg tttttagacg ctgagttcta ctggggctat 720

attcaagatt taaagtctgg ttttattgaa cttccatatg acagtcaaac gaatccggcg 780

atgaaaatga cgatcattct tccaaatcta ggagttgaca ttagagatgt tgagaggaat 840

attagcaaat tacctaggat tcagtatcgc ggagctacaa gcaagattgc tttgcatttg 900

ccaaaattca aaatcgagag caaatttgat ctaaaaccga ttctaaaaaa aatagggatt 960

aataatatgt ttgagaacac ggctgatttc caaaatatga ccgagaattc tgggttaaaa 1020

gttaccaaag tcgtccagaa agttgtcatt gaagtcaatg aagagggtag tgaagccgtt 1080

gttgcttcag gaatgacaat ggaatcaaga gaagctagtc cagttttcac tgtaaacaga 1140

ccatttttgt gtgttatttc tatggaaaga atgaaatgga tattattttt cgctcgtgta 1200

atggacccta ctgcagtttg a 1221

<210>2

<211>406

<212>PRT

<213> Chilo suppressalis fringed cocoon bee (Cotesia chilonis)

<400>2

Met Ile Lys Leu Ile Leu Ile Ala Thr Ile Val Val Leu Thr Ile Pro

1 5 10 15

Asp Ser Ser Cys Tyr Ser Lys Cys Ile Ala Ser Lys Ser Ile Lys Tyr

20 25 30

Pro Gln Arg Phe Val Phe Thr Met Thr Asp Leu Phe Leu Ser Asp Ile

35 40 45

Tyr Lys Val Leu Ala Arg Tyr Glu Lys Gly Asn Ile Ile Phe Ser Pro

50 55 60

Leu Ser Leu Asn Ala Ile Leu Thr Met Val Ser Leu Gly Ala Arg Gly

65 70 75 80

Asn Thr Ser Ser Glu Leu Ser Thr Ser Leu Arg Leu Ser Cys Asp Lys

85 90 95

Asn Ile Ala Gly Glu Gly Tyr Arg Gln Leu Ile His Phe Leu Leu Lys

100 105 110

Ile Glu Gly Val Lys Leu Lys Phe Ala Asn Lys Ile Phe Val Pro Gln

115 120 125

Thr Ser Val Leu Lys Asn Ser Phe Arg Ser Lys Met Lys Trp Phe Phe

130 135 140

Asn Ser Asp Thr Ser Ile Ile Asp Pro Thr Arg Pro Glu Lys Ala Ala

145 150 155 160

Glu Asp Ile Asn Arg Trp Tyr Ala Lys Glu Thr Glu Asn His Ile Thr

165 170 175

Asn Leu Tyr Glu Pro Ser Asp Ile Glu Asn Ala Lys Ile Leu Leu Ala

180 185 190

Asn Ala Val Tyr Phe Lys Gly Asn Trp Ala Asn Lys Phe Asn Pro Arg

195 200 205

Trp Thr Gln Pro Tyr Pro Phe Tyr Val Asn Gly Asn Arg Lys Ser Ile

210 215 220

Lys Asp Val Pro Met Met Phe Leu Asp Ala Glu Phe Tyr Trp Gly Tyr

225 230 235 240

Ile Gln Asp Leu Lys Ser Gly Phe Ile Glu Leu Pro Tyr Asp Ser Gln

245 250 255

Thr Asn Pro Ala Met Lys Met Thr Ile Ile Leu Pro Asn Leu Gly Val

260 265 270

Asp Ile Arg Asp Val Glu Arg Asn Ile Ser Lys Leu Pro Arg Ile Gln

275 280 285

Tyr Arg Gly Ala Thr Ser Lys Ile Ala Leu His Leu Pro Lys Phe Lys

290 295 300

Ile Glu Ser Lys Phe Asp Leu Lys Pro Ile Leu Lys Lys Ile Gly Ile

305 310 315 320

Asn Asn Met Phe Glu Asn Thr Ala Asp Phe Gln Asn Met Thr Glu Asn

325 330 335

Ser Gly Leu Lys Val Thr Lys Val Val Gln Lys Val Val Ile Glu Val

340 345 350

Asn Glu Glu Gly Ser Glu Ala Val Val Ala Ser Gly Met Thr Met Glu

355 360 365

Ser Arg Glu Ala Ser Pro Val Phe Thr Val Asn Arg Pro Phe Leu Cys

370 375 380

Val Ile Ser Met Glu Arg Met Lys Trp Ile Leu Phe Phe Ala Arg Val

385 390 395 400

Met Asp Pro Thr Ala Val

405

Claims

1. The application of chilo suppressalis fringed cocoon bee venom and ovarian secretory protein serine protease inhibitor CcSPN protein is characterized in that: the inhibitor can be used for inhibiting the blackening of hemolymph of host chilo suppressalis larva;

the amino acid sequences of the chilo suppressalis cotesia facialis venom and the ovarian secretory protein serine protease inhibitor CcSPN protein are shown as SEQ ID NO: 2, the preparation method is as follows.