CN108226508A - The monoclonal antibody of anti-human Legumain albumen, hybridoma cell strain and application thereof - Google Patents
The monoclonal antibody of anti-human Legumain albumen, hybridoma cell strain and application thereof Download PDFInfo
- Publication number
- CN108226508A CN108226508A CN201710083179.5A CN201710083179A CN108226508A CN 108226508 A CN108226508 A CN 108226508A CN 201710083179 A CN201710083179 A CN 201710083179A CN 108226508 A CN108226508 A CN 108226508A
- Authority
- CN
- China
- Prior art keywords
- monoclonal antibody
- legumain
- albumen
- cell strain
- lgmn
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 108010055066 asparaginylendopeptidase Proteins 0.000 title claims abstract description 70
- 102000030431 Asparaginyl endopeptidase Human genes 0.000 title claims abstract description 68
- 210000004408 hybridoma Anatomy 0.000 title claims abstract description 39
- 230000028327 secretion Effects 0.000 claims abstract description 9
- 238000006243 chemical reaction Methods 0.000 claims description 8
- 239000000203 mixture Substances 0.000 claims description 3
- 101001063370 Homo sapiens Legumain Proteins 0.000 abstract description 11
- 108090000623 proteins and genes Proteins 0.000 abstract description 11
- 238000000034 method Methods 0.000 abstract description 10
- 102000004169 proteins and genes Human genes 0.000 abstract description 8
- 108090000619 Cathepsin H Proteins 0.000 abstract description 4
- 102000004175 Cathepsin H Human genes 0.000 abstract description 4
- 108090000624 Cathepsin L Proteins 0.000 abstract description 4
- 102000004172 Cathepsin L Human genes 0.000 abstract description 4
- 102100030985 Legumain Human genes 0.000 abstract description 3
- 230000037029 cross reaction Effects 0.000 abstract description 2
- 210000004027 cell Anatomy 0.000 description 39
- MTHSVFCYNBDYFN-UHFFFAOYSA-N diethylene glycol Chemical compound OCCOCCO MTHSVFCYNBDYFN-UHFFFAOYSA-N 0.000 description 26
- 239000000243 solution Substances 0.000 description 22
- 239000000427 antigen Substances 0.000 description 19
- 102000036639 antigens Human genes 0.000 description 19
- 108091007433 antigens Proteins 0.000 description 19
- 206010003445 Ascites Diseases 0.000 description 15
- 230000029087 digestion Effects 0.000 description 13
- 239000007788 liquid Substances 0.000 description 13
- 241000699666 Mus <mouse, genus> Species 0.000 description 12
- 206010028980 Neoplasm Diseases 0.000 description 12
- 238000002156 mixing Methods 0.000 description 9
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 8
- 238000001514 detection method Methods 0.000 description 8
- 239000013612 plasmid Substances 0.000 description 8
- 239000006228 supernatant Substances 0.000 description 8
- 241000283707 Capra Species 0.000 description 7
- CURLTUGMZLYLDI-UHFFFAOYSA-N Carbon dioxide Chemical compound O=C=O CURLTUGMZLYLDI-UHFFFAOYSA-N 0.000 description 7
- 239000012980 RPMI-1640 medium Substances 0.000 description 7
- 235000018102 proteins Nutrition 0.000 description 7
- 238000000746 purification Methods 0.000 description 7
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 6
- 229920002873 Polyethylenimine Polymers 0.000 description 6
- 238000005516 engineering process Methods 0.000 description 6
- 210000001519 tissue Anatomy 0.000 description 6
- 238000001890 transfection Methods 0.000 description 6
- 238000005406 washing Methods 0.000 description 6
- 238000001262 western blot Methods 0.000 description 6
- 201000011510 cancer Diseases 0.000 description 5
- 229910002092 carbon dioxide Inorganic materials 0.000 description 5
- 230000007910 cell fusion Effects 0.000 description 5
- 239000012634 fragment Substances 0.000 description 5
- 244000005700 microbiome Species 0.000 description 5
- 210000004988 splenocyte Anatomy 0.000 description 5
- 238000002965 ELISA Methods 0.000 description 4
- 241000196324 Embryophyta Species 0.000 description 4
- 238000005119 centrifugation Methods 0.000 description 4
- 230000008859 change Effects 0.000 description 4
- 230000004927 fusion Effects 0.000 description 4
- 230000003287 optical effect Effects 0.000 description 4
- 238000004393 prognosis Methods 0.000 description 4
- 238000011084 recovery Methods 0.000 description 4
- 235000020183 skimmed milk Nutrition 0.000 description 4
- 239000011780 sodium chloride Substances 0.000 description 4
- 238000012360 testing method Methods 0.000 description 4
- IAZDPXIOMUYVGZ-UHFFFAOYSA-N Dimethylsulphoxide Chemical compound CS(C)=O IAZDPXIOMUYVGZ-UHFFFAOYSA-N 0.000 description 3
- 102100021628 Histatin-3 Human genes 0.000 description 3
- 101000898505 Homo sapiens Histatin-3 Proteins 0.000 description 3
- 239000002671 adjuvant Substances 0.000 description 3
- 238000001042 affinity chromatography Methods 0.000 description 3
- 239000003153 chemical reaction reagent Substances 0.000 description 3
- 238000010790 dilution Methods 0.000 description 3
- 239000012895 dilution Substances 0.000 description 3
- 239000000284 extract Substances 0.000 description 3
- 230000003053 immunization Effects 0.000 description 3
- 238000002649 immunization Methods 0.000 description 3
- 239000012528 membrane Substances 0.000 description 3
- 229910052757 nitrogen Inorganic materials 0.000 description 3
- 239000013641 positive control Substances 0.000 description 3
- 210000002966 serum Anatomy 0.000 description 3
- 239000000725 suspension Substances 0.000 description 3
- 210000004881 tumor cell Anatomy 0.000 description 3
- 108090000712 Cathepsin B Proteins 0.000 description 2
- 102000004225 Cathepsin B Human genes 0.000 description 2
- 102000005927 Cysteine Proteases Human genes 0.000 description 2
- 108010005843 Cysteine Proteases Proteins 0.000 description 2
- 102000012410 DNA Ligases Human genes 0.000 description 2
- 108010061982 DNA Ligases Proteins 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 2
- 108090000790 Enzymes Proteins 0.000 description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- GRYLNZFGIOXLOG-UHFFFAOYSA-N Nitric acid Chemical compound O[N+]([O-])=O GRYLNZFGIOXLOG-UHFFFAOYSA-N 0.000 description 2
- 206010035226 Plasma cell myeloma Diseases 0.000 description 2
- QAOWNCQODCNURD-UHFFFAOYSA-N Sulfuric acid Chemical compound OS(O)(=O)=O QAOWNCQODCNURD-UHFFFAOYSA-N 0.000 description 2
- 210000000683 abdominal cavity Anatomy 0.000 description 2
- 238000010171 animal model Methods 0.000 description 2
- 230000008901 benefit Effects 0.000 description 2
- 230000027455 binding Effects 0.000 description 2
- 238000009739 binding Methods 0.000 description 2
- 239000000090 biomarker Substances 0.000 description 2
- 239000007853 buffer solution Substances 0.000 description 2
- 244000309466 calf Species 0.000 description 2
- 230000003197 catalytic effect Effects 0.000 description 2
- 239000006285 cell suspension Substances 0.000 description 2
- 229920002678 cellulose Polymers 0.000 description 2
- 239000001913 cellulose Substances 0.000 description 2
- 210000000349 chromosome Anatomy 0.000 description 2
- 238000000576 coating method Methods 0.000 description 2
- 208000029742 colonic neoplasm Diseases 0.000 description 2
- UQLDLKMNUJERMK-UHFFFAOYSA-L di(octadecanoyloxy)lead Chemical compound [Pb+2].CCCCCCCCCCCCCCCCCC([O-])=O.CCCCCCCCCCCCCCCCCC([O-])=O UQLDLKMNUJERMK-UHFFFAOYSA-L 0.000 description 2
- 238000003745 diagnosis Methods 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 238000010828 elution Methods 0.000 description 2
- 239000013613 expression plasmid Substances 0.000 description 2
- 238000000605 extraction Methods 0.000 description 2
- 238000001502 gel electrophoresis Methods 0.000 description 2
- 239000001963 growth medium Substances 0.000 description 2
- 150000002460 imidazoles Chemical class 0.000 description 2
- 230000005847 immunogenicity Effects 0.000 description 2
- 238000000338 in vitro Methods 0.000 description 2
- 230000009545 invasion Effects 0.000 description 2
- 201000000050 myeloid neoplasm Diseases 0.000 description 2
- 229910017604 nitric acid Inorganic materials 0.000 description 2
- 238000002264 polyacrylamide gel electrophoresis Methods 0.000 description 2
- 239000000047 product Substances 0.000 description 2
- 239000012474 protein marker Substances 0.000 description 2
- 238000001742 protein purification Methods 0.000 description 2
- 238000012797 qualification Methods 0.000 description 2
- 238000012216 screening Methods 0.000 description 2
- 210000000952 spleen Anatomy 0.000 description 2
- 238000012546 transfer Methods 0.000 description 2
- 210000004981 tumor-associated macrophage Anatomy 0.000 description 2
- DWNBOPVKNPVNQG-LURJTMIESA-N (2s)-4-hydroxy-2-(propylamino)butanoic acid Chemical compound CCCN[C@H](C(O)=O)CCO DWNBOPVKNPVNQG-LURJTMIESA-N 0.000 description 1
- 229920000936 Agarose Polymers 0.000 description 1
- 102000002260 Alkaline Phosphatase Human genes 0.000 description 1
- 108020004774 Alkaline Phosphatase Proteins 0.000 description 1
- 238000011725 BALB/c mouse Methods 0.000 description 1
- 108091003079 Bovine Serum Albumin Proteins 0.000 description 1
- 206010009944 Colon cancer Diseases 0.000 description 1
- 108700033181 EC 3.4.22.34 Proteins 0.000 description 1
- 102000010911 Enzyme Precursors Human genes 0.000 description 1
- 108010062466 Enzyme Precursors Proteins 0.000 description 1
- 101000911390 Homo sapiens Coagulation factor VIII Proteins 0.000 description 1
- 108010001336 Horseradish Peroxidase Proteins 0.000 description 1
- 206010021143 Hypoxia Diseases 0.000 description 1
- 206010021703 Indifference Diseases 0.000 description 1
- 102000004317 Lyases Human genes 0.000 description 1
- 108090000856 Lyases Proteins 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 241001529936 Murinae Species 0.000 description 1
- 241000699670 Mus sp. Species 0.000 description 1
- 206010033128 Ovarian cancer Diseases 0.000 description 1
- 206010061535 Ovarian neoplasm Diseases 0.000 description 1
- 229920001030 Polyethylene Glycol 4000 Polymers 0.000 description 1
- 102100026534 Procathepsin L Human genes 0.000 description 1
- 108010076504 Protein Sorting Signals Proteins 0.000 description 1
- 239000006146 Roswell Park Memorial Institute medium Substances 0.000 description 1
- 229920002684 Sepharose Polymers 0.000 description 1
- 101150077427 Slc17a6 gene Proteins 0.000 description 1
- 102000003978 Tissue Plasminogen Activator Human genes 0.000 description 1
- 108090000373 Tissue Plasminogen Activator Proteins 0.000 description 1
- 238000002835 absorbance Methods 0.000 description 1
- 230000002378 acidificating effect Effects 0.000 description 1
- 230000009471 action Effects 0.000 description 1
- 230000004913 activation Effects 0.000 description 1
- 230000001464 adherent effect Effects 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 125000000539 amino acid group Chemical group 0.000 description 1
- 230000006907 apoptotic process Effects 0.000 description 1
- 229960000074 biopharmaceutical Drugs 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 229910052799 carbon Inorganic materials 0.000 description 1
- 239000001569 carbon dioxide Substances 0.000 description 1
- 238000006555 catalytic reaction Methods 0.000 description 1
- 238000004113 cell culture Methods 0.000 description 1
- 239000006143 cell culture medium Substances 0.000 description 1
- 210000003169 central nervous system Anatomy 0.000 description 1
- 238000001311 chemical methods and process Methods 0.000 description 1
- 239000007795 chemical reaction product Substances 0.000 description 1
- 238000004140 cleaning Methods 0.000 description 1
- 238000010367 cloning Methods 0.000 description 1
- 239000011248 coating agent Substances 0.000 description 1
- 210000001072 colon Anatomy 0.000 description 1
- 150000001875 compounds Chemical class 0.000 description 1
- 239000003636 conditioned culture medium Substances 0.000 description 1
- 238000010276 construction Methods 0.000 description 1
- 238000005859 coupling reaction Methods 0.000 description 1
- 238000005138 cryopreservation Methods 0.000 description 1
- 239000012531 culture fluid Substances 0.000 description 1
- 230000034994 death Effects 0.000 description 1
- 230000007423 decrease Effects 0.000 description 1
- 230000022811 deglycosylation Effects 0.000 description 1
- 239000008367 deionised water Substances 0.000 description 1
- 229910021641 deionized water Inorganic materials 0.000 description 1
- 230000001419 dependent effect Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000018109 developmental process Effects 0.000 description 1
- 238000000502 dialysis Methods 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 238000007865 diluting Methods 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 239000003480 eluent Substances 0.000 description 1
- 230000001804 emulsifying effect Effects 0.000 description 1
- 210000003038 endothelium Anatomy 0.000 description 1
- 235000019441 ethanol Nutrition 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 239000012894 fetal calf serum Substances 0.000 description 1
- 102000037865 fusion proteins Human genes 0.000 description 1
- 108020001507 fusion proteins Proteins 0.000 description 1
- 239000000499 gel Substances 0.000 description 1
- 230000012010 growth Effects 0.000 description 1
- 238000003306 harvesting Methods 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- HNDVDQJCIGZPNO-UHFFFAOYSA-N histidine Natural products OC(=O)C(N)CC1=CN=CN1 HNDVDQJCIGZPNO-UHFFFAOYSA-N 0.000 description 1
- 102000057593 human F8 Human genes 0.000 description 1
- 208000018875 hypoxemia Diseases 0.000 description 1
- 230000009851 immunogenic response Effects 0.000 description 1
- 238000002991 immunohistochemical analysis Methods 0.000 description 1
- 238000011534 incubation Methods 0.000 description 1
- 102000006495 integrins Human genes 0.000 description 1
- 108010044426 integrins Proteins 0.000 description 1
- 238000004255 ion exchange chromatography Methods 0.000 description 1
- 238000002372 labelling Methods 0.000 description 1
- 210000004072 lung Anatomy 0.000 description 1
- 210000001165 lymph node Anatomy 0.000 description 1
- 208000025352 lymph node carcinoma Diseases 0.000 description 1
- 210000005075 mammary gland Anatomy 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 238000013507 mapping Methods 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 239000011159 matrix material Substances 0.000 description 1
- 239000002609 medium Substances 0.000 description 1
- 208000011645 metastatic carcinoma Diseases 0.000 description 1
- 206010061289 metastatic neoplasm Diseases 0.000 description 1
- 238000010369 molecular cloning Methods 0.000 description 1
- 229940126619 mouse monoclonal antibody Drugs 0.000 description 1
- 210000004877 mucosa Anatomy 0.000 description 1
- 230000017074 necrotic cell death Effects 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 239000003921 oil Substances 0.000 description 1
- 239000012188 paraffin wax Substances 0.000 description 1
- 230000032696 parturition Effects 0.000 description 1
- 230000007170 pathology Effects 0.000 description 1
- 238000005325 percolation Methods 0.000 description 1
- 229920001184 polypeptide Polymers 0.000 description 1
- 238000012805 post-processing Methods 0.000 description 1
- 239000002243 precursor Substances 0.000 description 1
- 238000004321 preservation Methods 0.000 description 1
- 108010028075 procathepsin L Proteins 0.000 description 1
- 108090000765 processed proteins & peptides Proteins 0.000 description 1
- 102000004196 processed proteins & peptides Human genes 0.000 description 1
- 210000002307 prostate Anatomy 0.000 description 1
- 230000001681 protective effect Effects 0.000 description 1
- 230000002797 proteolythic effect Effects 0.000 description 1
- 229940047431 recombinate Drugs 0.000 description 1
- 230000006798 recombination Effects 0.000 description 1
- 238000005215 recombination Methods 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 230000004044 response Effects 0.000 description 1
- 230000003248 secreting effect Effects 0.000 description 1
- 238000004062 sedimentation Methods 0.000 description 1
- 239000012679 serum free medium Substances 0.000 description 1
- 238000002415 sodium dodecyl sulfate polyacrylamide gel electrophoresis Methods 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 239000000758 substrate Substances 0.000 description 1
- 230000004083 survival effect Effects 0.000 description 1
- 238000004114 suspension culture Methods 0.000 description 1
- 238000010257 thawing Methods 0.000 description 1
- 230000001225 therapeutic effect Effects 0.000 description 1
- 229960000187 tissue plasminogen activator Drugs 0.000 description 1
- 238000012549 training Methods 0.000 description 1
- 230000001052 transient effect Effects 0.000 description 1
- 238000003146 transient transfection Methods 0.000 description 1
- 230000005748 tumor development Effects 0.000 description 1
- 230000004614 tumor growth Effects 0.000 description 1
- 238000000108 ultra-filtration Methods 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/914—Hydrolases (3)
- G01N2333/948—Hydrolases (3) acting on peptide bonds (3.4)
- G01N2333/95—Proteinases, i.e. endopeptidases (3.4.21-3.4.99)
- G01N2333/964—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue
- G01N2333/96425—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals
- G01N2333/96427—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general
- G01N2333/9643—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general with EC number
- G01N2333/96466—Cysteine endopeptidases (3.4.22)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Biotechnology (AREA)
- General Physics & Mathematics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Cell Biology (AREA)
- Organic Chemistry (AREA)
- Food Science & Technology (AREA)
- Pathology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Monoclonal antibody, hybridoma cell strain the invention discloses anti-human Legumain albumen and application thereof.The present invention provides a kind of for detecting the kit of Legumain albumen, including the monoclonal antibody pair formed by following monoclonal antibody A and monoclonal antibody B：Monoclonal antibody A：By entitled LGMN 1, the hybridoma cell strain secretion that preserving number is CGMCC NO.12994 generates；Monoclonal antibody B：By entitled LGMN 2, the hybridoma cell strain secretion that preserving number is CGMCC NO.12995 generates.The monoclonal antibody of the present invention has higher potency, and indirect method potency is up to 1:2.56×108.The monoclonal antibody of the present invention, with family's PROTEIN C athepsin B, Cathepsin H and Cathepsin L no cross reactions, has preferable specificity with Legumain.
Description
Technical field
The present invention relates to bio-pharmaceutical engineer technology domain more particularly to the monoclonal antibody of anti-human Legumain albumen,
Hybridoma cell strain and application thereof.
Background technology
Legumain (C13) (EC 3.4.22.34) is also known as asparagine endopeptidase (asparaginyl endopep-
Tidase, AEP), it is a kind of lyase cysteine proteinase, is one newcomer of cysteine proteinase C13 families.People's
The Legumain assignments of genes gene mapping encode the polypeptide chain being made of 433 amino acid residues, become after deglycosylation in No. 14 chromosomes
Biologically active maturase has 83% homology with mouse.The legumain albumen of people has 3 kinds of forms, respectively
For the zymogen precursor of 56kD, 46kD and 36kD maturases.The active catalytic center of Legumain is by histidine (His) and half Guang
Propylhomoserin (Cys) composition catalysis dyad, be Legumain play catalytic activity necessary to and each C13 family into
The structure that member must have.
Compared with normal structure, Legumain high expression in mouse and a variety of solid tumor mass of the mankind, especially swollen
Oncocyte, neovascular endothelium cell and tumor-associated macrophage (Tumor-Associated Macrophages, TAMs)
In, and do not expressed in the corresponding tumor cell line cultivated in vitro.Liu et al. reports Legumain and tumor development at first
It is related.They are had found in a variety of mouse tumour cells, Legumain expression increases by Western blot and immunohistochemical analysis
Height, and do not expressed then in each tumor cell line cultivated in vitro.Liu et al. also has detected Normal human tissue and a variety of solid tumor groups
Knit, as a result show in the normal tissue, Legumain expression it is extremely low, and in a variety of solid tumor mass (such as mammary gland, colon, lung,
Prostate, ovarian neoplasm and central nervous system malignant tumour) Legumain high expression.
Invasion and transfer be malignant tumour send out mode and influence tumor patient therapeutic effect and prognosis it is important
Factor.Legumain forms compound with integrin, in the hypoxemia and acidic micro-environment of entity tumor, has and activates tumour thin
The function of born of the same parents Pro-MMP2 and Pro-Cathepsin L promote tumour growth, invasion and transfer.In order to confirm Legumain's
Whether expression is related to the differentiation degree of tumour, necrosis, apoptosis and prognosis.Murthy etc. passes through Western blot and immune group
Weave chemistry method, to 164 primary colon cancers, 34 distal end normal mucosa tissues, 89 cancer beside organisms and 33 lymph nodes
Metastatic carcinoma tissue sample carries out clinical pathology detection, the results showed that, in primary colon cancer, Legumain expression is apparently higher than
Distal end normal structure and cancer beside organism (P<0.05), but with lymph node carcinoma tissue samples without significant difference (P>0.05).Together
When, when expression (P=0.04) of the Legumain in tumor patient knurl (P=0.01) or matrix is horizontal relatively low, prognosis compared with
It is good.It, can be using one of Legumain indexs judged as disease diagnosis and prognosis using this correlation.
Legumain is as a kind of new biological indicator, at present clinically temporarily without being directed to its detection method,
The application monitored in the occurrence and development of tumour also belongs to blank.
Invention content
Based on the blank in above-mentioned field, the present invention provides a kind of for detecting the kit of Legumain albumen.
The kit provided by the present invention for being used to detect Legumain albumen, including by following monoclonal antibody A and list
The monoclonal antibody pair of the composition of clonal antibody B：
Monoclonal antibody A：By entitled LGMN-1, the hybridoma cell strain secretion that preserving number is CGMCC NO.12994 is produced
It is raw；
Monoclonal antibody B：By entitled LGMN-2, the hybridoma cell strain secretion that preserving number is CGMCC NO.12995 is produced
It is raw.
The present invention also provides a kind of hybridoma cell strain, entitled LGMN-1, preserving number is CGMCC NO.12994.
Hybridoma cell strain LGMN-1CGMCC NO.12994 provided by the present invention were preserved on October 24th, 2016
China Committee for Culture Collection of Microorganisms's common micro-organisms center (abbreviation CGMCC, address：Chaoyang District, Beijing City North Star west
The institute 3 of road 1, Institute of Microorganism, Academia Sinica, postcode 100101).
A kind of monoclonal antibody of anti-human Legumain albumen is secreted by hybridoma cell strain LGMN-1 and generated.
The present invention also provides a kind of hybridoma cell strain, entitled LGMN-2, preserving number is CGMCC NO.12995.
Hybridoma cell strain LGMN-2CGMCC NO.12995 provided by the present invention were preserved on October 24th, 2016
China Committee for Culture Collection of Microorganisms's common micro-organisms center (abbreviation CGMCC, address：Chaoyang District, Beijing City North Star west
The institute 3 of road 1, Institute of Microorganism, Academia Sinica, postcode 100101).
A kind of monoclonal antibody of anti-human Legumain albumen is secreted by hybridoma cell strain LGMN-2 and generated.
The monoclonal antibody identifies that the antibody purposes of people's Legumain albumen also belongs in as antigen-antibody reaction
Protection scope of the present invention.
The present invention constructs people's Legumain eukaryon expression plasmids pCDNA3.1-tpa- first with the method for molecular cloning
HLGMN is transfected HEK293T cells using the method for transient transfection, albumen is carried out using affinity chromatography and ion-exchange chromatography
Purifying purifies from cells and supernatant and obtains destination protein.
The present invention is prepared for two kinds of people's Legumain monoclonals by the use of the people Legumain albumen of vivoexpression as antigen
Antibody, both monoclonal antibodies are respectively by numbering the hybridoma cell strain for being CGMCC NO.12994 and CGMCC NO.12995
It is secreted.
Specifically, the monoclonal that the present invention prepares people Legumain using murine myeloma cell hybridoma technology resists
Body is realized by following technology：By the way that the mouse boosting cell of immune people Legumain antigens is merged with myeloma cell, detach
Go out to secrete the hybridoma of anti-human Legumain monoclonal antibodies, Mice Inoculated abdominal cavity is prepared containing anti-human
The ascites of Legumain antibody by post-processing and verifies, obtains that specificity is good, antibody level is high and can preserve for a long time anti-
People's Legumain monoclonal antibodies.
To the monoclonal antibody of the present invention, the labeled monoclonal antibody obtained after biomarker or chemical labeling is also at this
The protection domain of patent.
Further, the said monoclonal antibody marked through enzyme belongs to the protection domain of this patent.
The enzyme is horseradish peroxidase or alkaline phosphatase.
Anti-human Legumain monoclonal antibodies provided by the invention have following features and advantages：
(1) monoclonal antibody of the invention has higher potency, and indirect method potency is up to 1:2.56×108。
(2) monoclonal antibody of the invention and Legumain with family PROTEIN C athepsin B, Cathepsin H and
Cathepsin L no cross reactions have preferable specificity.
(3) the monoclonal antibody affinity costant of hybridoma LGMN-1 and LGMN-2 of the present invention secretion be respectively 1.48 ×
107With 1.32 × 107, the detection of people's Legumain antigens is can be widely applied to, is differentiated, screening, cancer diagnosis and prognostic evaluation
In.
Description of the drawings
Fig. 1 is the digestion qualification result figure of recombinant plasmid pCDNA3.1-tpa-LGMN；Wherein 1 is tpa-hLGMN PCR pieces
Section, 2 be pcDNA3.1-tpa-hLGMN double digestions, and M is DNA molecular amount standard Marker DL2000 (Takara, Cat
No.3427A)。
Fig. 2 is that the SDS-PAGE of recombined human Legumain purifying antigens schemes；Wherein, P1 is what affinitive layer purification obtained
Legumain (pH 8.0), MW are Protein Marker.
Fig. 3 is the immunogenicity figure that Western blot detect recombined human Legumain；Wherein P1 is people Legumain, MW
For albumen component standard.
Fig. 4 is the western blot figure of the monoclonal antibody of hybridoma secretion；Wherein P1 is monoclonal antibody LGMN-A,
P2 is Protein Marker for monoclonal antibody LGMN-B, MW, and C is positive control.
Specific embodiment
Embodiment 1, the monoclonal antibody for preparing anti-human Legumain albumen
First, prepared by Legumain antigens
1) acquisition of Legumain gene orders
Legumain encoding genes are located on No. 14 chromosome of people (14q32.12), the sequence in ncbi database
Number be CCDS:CCDS9904.1.The plasmid pLEXSY-sat2-hLGMN of carrier's Legumain genes is by Austrian Salzburg
Elfriede doctors Dall of university give, and record the non-patent literature of eukaryon expression plasmid pLEXSY-sat2-hLGMN and are
E.Dall and H.Brandstetter, Activation of legumain involves proteolytic and
conformational events,resulting in a context-and substrate-dependent activity
Profile., Acta Crystallogr Sect F Struct Biol Cryst Commun.2012Jan 1；68(Pt 1):
24–31.
2) structure of recombinant plasmid and digestion identification
In order to make the Legumain of people that can be secreted into after expression extracellularly, added in cloning procedure in hLGMN front ends
Tissue plasminogen activator (tpa) signal peptide sequence, rear end add in 6 × His labels.
PCR sense primers：
5’-NheI-CCAGCTAGCATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTT
CGTTTCGCCCAGCCAGGAAATCCATGCCCGATTCAGAAGAGGAGCCAGATCC ATGGTTTGGAAAGTAGC-3’
Downstream primer：
5’-TGCCTTGGTCACTACTGA AAGCTTAAG-HindIII-3’
PCR reaction systems：
PCR response procedures：
PCR fragment purifying rapidly purifies kit (Qigen) after purification through PCR product, through NheI and HindIII digestions,
1 μ L DnpI are added in the reaction system after the completion of digestion, are reacted 30min in 37 DEG C, are digested template DNA.
PcDNA3.1 (+) carrier (being purchased from Invitrogen, Cat No.V790-20) is also by NheI and HindIII digestions.
Digestion system：
Digestion products are analyzed through 1% agarose gel electrophoresis, target fragment are cut, through gel purification kit
(Qigen, Cat No.20021) extracts target fragment, is attached reaction later.
Coupled reaction system is：About 0.1pmol tpa-hLGMN segments, about 0.01pmol pcDNA3.1 carrier DNA pieces
Section, 1 μ L T4DNA ligase buffer solutions (NEB), 1 μ L T4DNA ligases (NEB) add deionized water to supply to 10 μ L systems,
16 DEG C of connections are overnight.3 μ L reaction products is taken to convert into 100 μ L competent cells XL-1blue (Agilent).
After 37 DEG C are cultivated 12h, plasmid is extracted, and to extraction with the small extraction reagent kit of plasmid (Qigen) for picking positive colony
Plasmid carry out digestion identification.
Digestion identification is carried out to institute's upgrading grain using NheI and HindIII, digestion system is：
Digestion qualification result is shown in Fig. 1.As seen from Figure 1, Lane 2pcDNA3.1-tpa-hLGMN obtained after digestion compared with
Small segment and the PCR fragment of Lane 1 are in the same size, illustrate construction of recombinant plasmid success.
3) transfection and protein purification
The previous day is carried with serum free medium F17Medium (Invitrogen, cat.0050092DK) suspension cultures
HEK293 6E cells (are purchased from National Research Council Canada), and cell density is 1.0 × 106/ ml, training
The condition of supporting is 130rpm, 37 DEG C of .and 5%CO2.
Using the pCDNA3.1-tpa-LGMN plasmids of above-mentioned structure, the method (Jager transiently transfected by linear PEI
V.et al.,High level transient production of recombinant antibodies and
antibody fusion proteins in HEK293cells,BMC Biotechnology 13(1):52·June
2013.)
By taking the cell for the culture that suspends in 125ml culture bottles as an example：Day before transfection adjustment cell density is 1.0 × 106/
Ml, volume of culture 22.5ml, for 24 hours after, cell density be 1.5-2.0 × 106/ ml can carry out transfection experiment at this time.
Culture medium is infected in 25-37 DEG C of preheating first, and thaw DNA and PEI (Polyethylenimine (linear,
25kDa),Polysciences,CatNo.23966)：
Prepare DNA solution：
1.5ml transfection medias F17 is added in 15ml centrifuge tubes
Add in 25 μ g DNA to be transfected
Vortex mixing
Prepare PEI solution：
1.5ml transfection medias F17 is added in 15ml centrifuge tubes
Add in 50 μ l PEI solution (1 μ g/ul) (50 μ g)
Vortex mixing
Prepare DNA-PEI compounds：
PEI solution is added in DNA solution
Vortex mixing
It is stored at room temperature 15min
Transfection：
DNA-PEI compounds are added in culture cell, and rotation culture bottle is allowed to mixing rapidly, and culture bottle is put back into
Continue the culture that suspends in 5% carbon dioxide incubator.Add in the fresh Freestyle F17expression of 25ml afterwards for 24 hours
Medium (is purchased from Invitrogen, Cat No.A1383501), doubles culture volume, cell culture medium is harvested after 120h,
10000rpm, 30min, centrifugation removal cell, harvest cell conditioned medium carry out protein purification.
Affinity chromatography is carried out to hLGMN-his using Ni-NTA agarose (Qigen, Cat No.30230), on cells
Buffer solution (50mM NaHPO4, pH 7.6,300mM NaCl) is exchanged for by percolation first clearly, uses 1ml Ni-NTA fine jades
Sepharose column carries out affinity chromatography.
Use 30ml cleaning solutions B (50mM NaHPO4, pH 7.6,300mM NaCl, 30mM imidazoles) washing, 5ml eluents
C(50mM NaHPO4, pH 7.6,300mM NaCl, 300mM imidazoles) and elution.Take a small amount of elution protein liquid do electrophoretic analysis and
Western blot are identified.The results are shown in Figure 2 for electrophoretic analysis, from Figure 2 it can be seen that target fragment size after purification is 56kD,
It is consistent with theoretical value.
Western blot flows：
Using the recombined human Legumain albumen of expression, PAGE gel electrophoresis is carried out, and by protein delivery to nitric acid
On cellulose membrane, after the closing overnight of 5% 4 DEG C of skimmed milk power, add 1:1000 times of diluted anti-Legumain polyclonal antibodies of goat
(Santa Cruz Biotechnology, Inc., Cat No.sc-47105) is incubated at room temperature 1h, washes film 3 times, add in HRP- mountains
Goat anti-mouse igg (H+L) (Invitrogen, Cat No.62-6520), be eventually adding DAB colour reagents box (Shanghai give birth to work,
Cat No.PW017) in reaction solution and the mixed liquor of solution A and solution C, be protected from light colour developing 10min after, add in terminate liquid, take pictures
Record experimental result (Fig. 3).As seen from Figure 3, the albumen of expression and purification has colour developing band at 56kD, illustrates to recombinate legumain
Albumen has good immunogenicity.
Residual protein is with 0.85% NaCl solution in 4 DEG C of dialysis 48h.5mg/ml is concentrated into the ultrafiltration membrane of 30kD, i.e.,
People's Legumain antigens are prepared.
2nd, animal immune
People Legumain antigens and Freund's adjuvant (are immunized as Freund's complete adjuvant (Sigma, Cat No. for 0 day：
F5881), it is immunized as incomplete Freund's adjuvant (Sigma, Cat No. within 14 days, 28 days, 35 days：F5506)) isometric mixing and emulsifying
BALb/c mouse are immunized (purchased from Beijing dimension tonneau China experimental animal technology after 0 day, 14 days, 28 days, 35 days dorsal sc multiple spots
Co., Ltd), 0.2mg/ is only.
Final immunization is taken a blood sample after a week, indirect ELISA detection antibody titer, serum dilution 104Times when OD values be 1.116,
In final immunization after a week using the selected mouse of people's Legumain antigens abdominal cavity impact, mouse spleen is taken after 3 days, carries out cell
Fusion.
3rd, cell fusion and strain is built
(1) recovery culture SP2/0 cell strains (are purchased from Sigma Aldrich, Cat before cell fusion
No.85072401 it) need to be cultivated in the RPMI 1640 containing 10% fetal calf serum (Gibco, Cat No.10099133)
In liquid (Gibco, Cat No.11875093), 37 DEG C of cultures are put in 5%CO2 incubators, it is primary to change within every 2~3 days culture solution, 3~
It changes the liquid once within 5 days.Be viewed as under inverted microscope round bright, marshalling, form are complete, appropriate density (0.1~1 ×
106/ ml), survival rate be more than 95% when, both for cell fusion use.Expand culture within 3 days before fusion, remove within 1 day before fusion
1640 cell culture fluids of RPMI add culture solution again, prepare SP2/0 cells.
(2) splenocyte suspension is prepared：The mouse of booster immunization before taking 3 days, the neck that breaks are put to death, be soaked in 3 in 75% ethyl alcohol~
5min.Spleen is taken out in sterile working, prepares splenocyte suspension, living cell counting.
(3) appropriate RPMI-1640 culture solutions, SP2/0 cells are separately added into according to splenocyte and SP2/0 cell counts
Mixing is shaken, splenocyte is blown and beaten uniform with pipette.Then splenocyte and SP2/0 cells are pressed 1:5 together in 50ml centrifuge tubes,
Mixing.
(4) add RPMI-1640 culture solutions to 50ml, 1000rpm 5 clocks of centrifugation, evacuation supernatant.Fusion is gently tapped with finger
Tube bottom makes sedimentation cell loosely uniform, and centrifuge tube puts 37 DEG C of water-baths, prepares fusion.
(5) 50% PEG4000 of 37 DEG C of preheatings of 1ml is drawn, is slowly dropped into cell mixing pipe, is added in 1min, side
Side rotation centrifuge tube is dripped, cell is made to be stored in mixing state.
(6) the RPMI-1640 culture mediums (37 DEG C) of 15ml serum-frees, 800rpm, centrifugation are slowly added to after standing 90s immediately
5 clocks, discard supernatant.
(7) the RPMI-1640 culture solutions that 15ml contains 10% calf serum are added in, mixes and hooks, suspension is added to 96 holes respectively
In tissue culture plate, 100ul/ holes are placed in 37 DEG C, 5%CO2It is cultivated in incubator.
(8) the 2nd days cell plates add HAT culture solutions, and (RMPI-1640 contains 1 × HAT (Sigma, Cat No.H0262) 100ul/
Hole.
(9) it changes a HAT culture solution within every 3 days, the 1/2 new liquid of change of the old liquid of culture hole is sucked out every time, sees whether occur
Hybridoma, changing HT culture mediums after two weeks, (MDM (Sigma, Cat No.H0137) containing 1 × HT observes fused cell upgrowth situation.
(10) start within the 7th day after cell fusion observe Growth of Hybridoma Cell situation, treat its length to bottom hole area 1/10 with
Supernatant was sucked out when upper and carries out antibody test using 96 systems of Fortebio octet (ForteBio).Use HIS2 bio-sensings
Device (Fortebio, Part No:18-5116) the recombined human Legumain antigens of 6 × His of capture zone labels (dilute 5 μ with PBS
g/ml)；0.1mg/ml BSA are closed；It draws cells and supernatant to add in hole to be checked, if containing anti-human in supernatant
Legumain antibody and recombined human Legumain antigen bindings, the optical signal that system captures can change, according to optical signal
Judge whether the positive.Positive hole cell is transferred to 24 orifice plates and expands culture, is subcloned in time.
The biomembrane interference technique that ForteBio Octet systems are used is a kind of label-free technology.It utilizes
ForteBio Octet systems do the advantage of monoclonal antibody screening without liquid is marked without using label to antibody
Secondary antibody, precision are higher than ELISA, and test speed is a kind of full automatic operating system without hand washing step faster.
(11) cell line of 2 plants of stably excreting antibody is obtained through 3 subclones, respectively protects hybridoma cell strain
It hides, preserving number is respectively CGMCC NO.12994 and CGMCC NO.12995, and Classification And Nomenclature is respectively LGMN-1 and LGMN-2.
Legumain antigen monoclonal antibody hybridoma cell strains, preservation time：On October 24th, 2016；Depositary institution：The micro- life of China
Object culture presevation administration committee common micro-organisms center (abbreviation CGMCC, address：Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3
Number, Institute of Microorganism, Academia Sinica, postcode 100101).
4th, the freezen protective of hybridoma cell strain and recovery
Positive hybridoma will be accredited as, adds in cells frozen storing liquid (30% calf serum (Gibco, Cat
No.16010159), 60%RPMI-1640,10%DMSO), adjustment cell concentration is 1~5 × 106A/ml.By cell suspension
It is dispensed into cryopreservation tube, first 4 DEG C of precooling 10min, then be placed in 30min in -20 DEG C of refrigerators then move to -80 DEG C of 16~18h of refrigerator
(or overnight), it finally puts into liquid nitrogen and preserves for a long time.
During recovery hybridoma, hybridoma cryovial from liquid nitrogen is taken out, puts into 38~40 DEG C of water-baths immediately
In, after cell suspension defrosting, 10ml RPMI-1640 culture solutions are added in, cell is moved in 25ml culture bottles, puts 37 DEG C of CO2
It is cultivated in incubator.3~4h is crossed, after cell is adherent, outwells old culture medium, fresh RPMI-1640 culture mediums is added in and continues
Culture.
5th, prepared by monoclonal antibody cell strain ascites and antibody titer detects
It is prepared by odd contradictive hydroperitoneum：When more than the 50% Tissue Culture Flask bottom of bottle of cell covering 25ml, the SPF grades of health are selected
BALB/c mouse (is purchased from Beijing Vital River Experimental Animals Technology Co., Ltd.), and 0.3ml paraffin oils are injected prior to mouse peritoneal,
Hybridoma 0.5~5 × 10 is injected after every mouse peritoneal within 7~10 days8It is a.When mouse web portion significantly expands, with No. 9
Syringe needle extracts ascites or puts ascites with No. 16 syringe needles, can extract repeatedly repeatedly.Ascites after 10min centrifugations, takes through 12000rpm
Clear liquid dispenses, and puts -20 DEG C and saves backup.
Monoclonal antibody bioactivity：
Monoclonal antibody bioactivity：Monoclonal antibody cell strain titer of ascites is measured using 96 systems of Fortebio Octet, is made
With HIS2 biosensors capture recombined human Legumain antigens (diluting 5 μ g/ml with PBS), action time 10min；PBST is washed
Wash 2min；0.1mg/ml BSA close 5min；PBST washs 2min；LGMN-A the and LGMN-B ascites of gradient dilution is added in, is made
Use 10min.Using the mouse ascites of not immune overweight group of people's Legumain albumen as negative control.The results show that two plants of lists
Anti-cell strain ascites antibody potency is respectively 1:2.05×107, 1:2.56×108, potency is higher.
96 systems of Fortebio octet (ForteBio) carry out antibody test.Use HIS2 biosensors
(Fortebio,Part No:18-5116) the recombined human Legumain antigens of the label of capture zone His × 6 (dilute 5 μ g/ with PBS
ml)；0.1mg/ml BSA are closed；It draws cells and supernatant to add in hole to be checked, if containing anti-human Legumain in supernatant
Antibody and recombined human Legumain antigen bindings, the optical signal that system captures can change, be judged whether according to optical signal
It is positive.Positive hole cell is transferred to 24 orifice plates and expands culture, is subcloned in time.
6th, Western detects the combination of monoclonal antibody and antigen
Using the recombined human Legumain albumen of expression, PAGE gel electrophoresis is carried out, and by protein delivery to nitric acid
On cellulose membrane, after the closing overnight of 5% 4 DEG C of skimmed milk power, add 1:1000 times diluted to contain LGMN-1 and LGMN-2 monoclonals
The ascites of antibody, positive control be purchase the anti-Legumain polyclonal antibodies of goat (Santa Cruz Biotechnology,
Inc., Cat No.sc-47105), 1h is incubated at room temperature, washes film 3 times, secondary antibody is respectively HRP- goat anti-mouse IgGs (H+L)
(Invitrogen, Cat No.62-6520) and HRP- rabbit-antis goat IgG (Invitrogen, Cat No.61-1620), finally
The reaction solution and the mixed liquor of solution A and solution C in DAB colour reagents box (giving birth to work, Cat No.PW017 in Shanghai) are added in, is protected from light
It develops the color after 10min, adds in terminate liquid, photograph to record experimental result (Fig. 4).From fig. 4, it can be seen that the goat that C is purchase resists
Legumain polyclonal antibody positive controls, P1, P2 are two plants of monoclonal antibodies with recombinating reacting for Legumain albumen, explanation
Two plants of monoclonal antibodies have good immunogenic response with recombination Legumain albumen.
6th, Subclass of antibody measures
People Legumain antigens are diluted to 5 μ g/ml, 100ul/ holes coated elisa plates using 0.01M PBS, are placed in 4 DEG C
Overnight, with 5% skimmed milk power, 37 DEG C of closing 1h, then using mouse monoclonal antibody parting kit (Sigma, IS02-1KT) according to monoclonal antibody
Subclass kit specification is tested, and as a result shows monoclonal antibody LGMN-A of the present invention as IgG2a types, monoclonal antibody
LGMN-B is IgG2b types.
7th, the Detection of Stability of hybridoma cell line secretion monoclonal antibody
Respectively behind 3 months and 9 months, the hybridoma cell strain LGMN-1 and LGMN-2 frozen is taken out from liquid nitrogen and is carried out
Recovery, expand culture after, prepare ascites, carry out indirect ELISA detection antibody titer, with early period prepare ascites, LGMN-A and
LGMN-B odd contradictive hydroperitoneums are carried out at the same time detection in (0 day) for control.The result shows that Dan Ke prepared by hybridoma cell strain of the invention
Grand antibody titer of ascites reaches 107More than, with titer of ascites indifference early period, show the potency of the ascites prepared after cyropreservation
Do not decline.Therefore the activity of monoclonal cell strain secretory antibody does not reduce, and has good stability.
8th, affinity costant measures
Monoclonal antibody LGMN-A and LGMN-B that the hybridoma cell strain of the present invention is secreted are detected into its protein after purification respectively
Content.Using 1:5,1:10,1:20,1:The Legumain antigen transverse direction coated elisa plates of 40 diluted various concentrations, 100ul/
Hole, 4 DEG C of coatings are overnight.Second day board-washing rear enclosed 2 hours pats dry for use.By LGMN-A and LGMN-B points of monoclonal antibody after purification
Other 2 times of gradient dilutions, longitudinal direction add in the ELISA Plate after coating, using the OD values of indirect elisa method detection antigen-antibody reaction.With
The OD values of plateau section under each antigen concentration are calculated as 100%, calculate 50%OD values, investigate the corresponding list put of 50%OD values
Anti- concentration [Ab] t can obtain monoclonal antibody LGMN-A of the present invention further according to affinity costant calculation formula K=(n-l)/2 (nAb'-Ab)
Affinity costant be 1.48 × 107.The affinity costant of LGMN-B is 1.32 × 107(table 1).
1 affinity costant testing result of table
9th, the specificity of monoclonal antibody
By people's Legumain antigens, Cathepsin B (Sigma Aldrich, Cat No.SRP0289), Cathepsin
H (Biovision, Cat No.1023-5) and Cathepsin L (Sigma Aldrich, Cat No.SPR0291) is used
0.01M PBS are diluted to 5 μ g/ml, 100ul/ holes coated elisa plates, each albumen is coated with four holes, and each two hole is as one
It repeats, is placed in 4 DEG C overnight, 5% 37 DEG C of skimmed milk power closing 1h, washing three times, is then respectively adding monoclonal antibody LGMN-A
With 37 DEG C of incubation 1h of LGMN-B, washing three times, adds in 1:1000 times of diluted HRP- goat anti-mouse IgGs (H+L), washing three
After secondary, the colour developing of TMB developing solutions is added in, 2M sulfuric acid terminates, and absorbance is measured in 450nm.
The OD450 values and blank well on standard curve for adding Cathepsin B, Cathepsin H and Cathepsin L holes
OD450 values are close, with Legumain albumen hole otherness significantly (P>0.05), therefore the specificity of this method is preferable.
<110>Li Wei
<120>The monoclonal antibody of anti-human Legumain albumen, hybridoma cell strain and application thereof
<130> P160658/JFQ
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 1302
<212> DNA
<213> Artificial Sequence
<220>
<223>Legumain encoding genes
<400> 1
atggtttgga aagtagctgt attcctcagt gtggccctgg gcattggtgc cgttcctata 60
gatgatcctg aagatggagg caagcactgg gtggtgatcg tggcaggttc aaatggctgg 120
tataattata ggcaccaggc agacgcgtgc catgcctacc agatcattca ccgcaatggg 180
attcctgacg aacagatcgt tgtgatgatg tacgatgaca ttgcttactc tgaagacaat 240
cccactccag gaattgtgat caacaggccc aatggcacag atgtctatca gggagtcccg 300
aaggactaca ctggagagga tgttacccca caaaatttcc ttgctgtgtt gagaggcgat 360
gcagaagcag tgaagggcat aggatccggc aaagtcctga agagtggccc ccaggatcac 420
gtgttcattt acttcactga ccatggatct actggaatac tggtttttcc caatgaagat 480
cttcatgtaa aggacctgaa tgagaccatc cattacatgt acaaacacaa aatgtaccga 540
aagatggtgt tctacattga agcctgtgag tctgggtcca tgatgaacca cctgccggat 600
aacatcaatg tttatgcaac tactgctgcc aaccccagag agtcgtccta cgcctgttac 660
tatgatgaga agaggtccac gtacctgggg gactggtaca gcgtcaactg gatggaagat 720
tcggacgtgg aagatctgac taaagagacc ctgcacaagc agtaccacct ggtaaaatcg 780
cacaccaaca ccagccacgt catgcagtat ggaaacaaaa caatctccac catgaaagtg 840
atgcagtttc agggtatgaa acgcaaagcc agttctcccg tccccctacc tccagtcaca 900
caccttgacc tcacccccag ccctgatgtg cctctcacca tcatgaaaag gaaactgatg 960
aacaccaatg atctggagga gtccaggcag ctcacggagg agatccagcg gcatctggat 1020
gccaggcacc tcattgagaa gtcagtgcgt aagatcgtct ccttgctggc agcgtccgag 1080
gctgaggtgg agcagctcct gtccgagaga gccccgctca cggggcacag ctgctaccca 1140
gaggccctgc tgcacttccg gacccactgc ttcaactggc actcccccac gtacgagtat 1200
gcgttgagac atttgtacgt gctggtcaac ctttgtgaga agccgtatcc gcttcacagg 1260
ataaaattgt ccatggacca cgtgtgcctt ggtcactact ga 1302
Claims (6)
1. a kind of kit for being used to detect Legumain albumen, it is characterised in that：Including by following monoclonal antibody A and Dan Ke
The monoclonal antibody pair of the composition of grand antibody B：
Monoclonal antibody A：By entitled LGMN-1, the hybridoma cell strain secretion that preserving number is CGMCC NO.12994 generates；
Monoclonal antibody B：By entitled LGMN-2, the hybridoma cell strain secretion that preserving number is CGMCC NO.12995 generates.
2. a kind of hybridoma cell strain, entitled LGMN-1, preserving number are CGMCC NO.12994.
3. a kind of monoclonal antibody of anti-human Legumain albumen is secreted as the hybridoma cell strain described in claim 2 and generated.
4. a kind of hybridoma cell strain, entitled LGMN-2, preserving number are CGMCC NO.12995.
5. a kind of monoclonal antibody of anti-human Legumain albumen is secreted as the hybridoma cell strain described in claim 4 and generated.
6. the monoclonal antibody described in claim 3 and/or claim 5 identifies people in as antigen-antibody reaction
The antibody purposes of Legumain albumen.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710083179.5A CN108226508B (en) | 2017-02-16 | 2017-02-16 | The monoclonal antibody of anti-human Legumain albumen, hybridoma cell strain and application thereof |
| CN201811513406.4A CN109694856B (en) | 2017-02-16 | 2017-02-16 | Monoclonal antibody of anti-human Legumain protein, hybridoma cell strain LGMN-2 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710083179.5A CN108226508B (en) | 2017-02-16 | 2017-02-16 | The monoclonal antibody of anti-human Legumain albumen, hybridoma cell strain and application thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811513406.4A Division CN109694856B (en) | 2017-02-16 | 2017-02-16 | Monoclonal antibody of anti-human Legumain protein, hybridoma cell strain LGMN-2 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108226508A true CN108226508A (en) | 2018-06-29 |
| CN108226508B CN108226508B (en) | 2019-02-01 |
Family
ID=62657262
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710083179.5A Expired - Fee Related CN108226508B (en) | 2017-02-16 | 2017-02-16 | The monoclonal antibody of anti-human Legumain albumen, hybridoma cell strain and application thereof |
| CN201811513406.4A Expired - Fee Related CN109694856B (en) | 2017-02-16 | 2017-02-16 | Monoclonal antibody of anti-human Legumain protein, hybridoma cell strain LGMN-2 and application thereof |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811513406.4A Expired - Fee Related CN109694856B (en) | 2017-02-16 | 2017-02-16 | Monoclonal antibody of anti-human Legumain protein, hybridoma cell strain LGMN-2 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN108226508B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111157725A (en) * | 2020-01-09 | 2020-05-15 | 南京拂晓生物科技有限公司 | Human Legumain chemiluminescence detection kit and application thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115704020A (en) * | 2021-08-11 | 2023-02-17 | 中国科学院分子细胞科学卓越创新中心 | Medicine for inhibiting tumor cell metastasis and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007083100A2 (en) * | 2006-01-17 | 2007-07-26 | Cancer Research Technology Limited | Enzyme |
| CN101726602A (en) * | 2009-12-11 | 2010-06-09 | 南开大学 | Method for judging ovarian cancer prognosis by detecting Legumain protein |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015094018A2 (en) * | 2013-12-16 | 2015-06-25 | Universal Biosystems Limited Company (Ubs Ltd) | Humanized monoclonal antibody specific to legumain |
-
2017
- 2017-02-16 CN CN201710083179.5A patent/CN108226508B/en not_active Expired - Fee Related
- 2017-02-16 CN CN201811513406.4A patent/CN109694856B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007083100A2 (en) * | 2006-01-17 | 2007-07-26 | Cancer Research Technology Limited | Enzyme |
| CN101726602A (en) * | 2009-12-11 | 2010-06-09 | 南开大学 | Method for judging ovarian cancer prognosis by detecting Legumain protein |
Non-Patent Citations (1)
| Title |
|---|
| DONGTAO NI LI ET AL.: "Multistep Autoactivation of Asparaginyl Endopeptidase in Vitro and in Vivo", 《THE JOURNAL OF BIOLOGICAL CHEMISTRY》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111157725A (en) * | 2020-01-09 | 2020-05-15 | 南京拂晓生物科技有限公司 | Human Legumain chemiluminescence detection kit and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109694856A (en) | 2019-04-30 |
| CN109694856B (en) | 2020-02-04 |
| CN108226508B (en) | 2019-02-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107037212B (en) | Porcine circovirus 2 type antigen immue quantitative detection reagent box | |
| CN105695420A (en) | Mouse bone marrow hybridoma cell strains, monoclonal antibody generated by same and application | |
| CN105675873A (en) | Detection kit and application thereof | |
| CN102775473B (en) | The B cell epitope peptide fragment of human neutrophil gelatinase-associated lipocalin and its application | |
| CN116693681B (en) | Monoclonal antibody for resisting helicobacter pylori cytotoxin related protein A and application thereof | |
| CN108997499A (en) | A kind of anti human PD-L 1 antibody and its application | |
| CN110218252A (en) | A kind of application of the preparation method and the antibody of anti-AMH specific antibody in detection AMH kit | |
| CN103333864B (en) | Monoclonal antibody of toxoplasma gondii resistant MIC3 protein and application monoclonal antibody | |
| CN102702323B (en) | Application of procalcitonin B cell epitope peptide fragment and monoclonal antibody thereof | |
| CN108226508B (en) | The monoclonal antibody of anti-human Legumain albumen, hybridoma cell strain and application thereof | |
| CN108287241A (en) | Detect ELISA detection kit and its application of people Legumain | |
| CN106318912B (en) | Hybridoma cell strain SCCA1 and its monoclonal antibody and application of secretion | |
| CN102702324B (en) | Application of human procalcitonin B cell epitope peptide fragment and monoclonal antibody thereof | |
| CN102643332B (en) | Application of B cell epitope peptide of human PCT (Procalcitonin) and monoclonal antibody of B cell epitope peptide | |
| CN103509115A (en) | Nanometer antibodies to human cystatin C and application thereof | |
| CN104789535B (en) | Anti- methadone metabolin EDDP hybridoma cell strains and its preparation method and application | |
| CN106771216B (en) | Improve the method and its application of immunoreagent detection specificity | |
| CN104745536B (en) | A kind of toxoplasma protein TgVP1 monoclonal antibody hybridomas 3A6 and monoclonal antibody | |
| CN105424928A (en) | Immunochromatography strip detecting porcine reproductive and respiratory syndrome virus antibodies and preparation method and application thereof | |
| CN114213542B (en) | CPS-I antibodies and uses thereof | |
| CN115960226B (en) | Magnetic particle immunochromatography rapid reaction method and detection kit | |
| CN115960225B (en) | Monoclonal antibodies for use in magnetic particle immunochromatography rapid reaction methods | |
| CN106831984A (en) | A kind of preparation and application of anti-BEX2 monoclonal antibodies | |
| CN104046594B (en) | A kind of Orf virus protein ORFV086 monoclonal antibody hybridoma cell strain 2G8D10 and monoclonal antibody thereof | |
| CN103261221B (en) | The immunological assay method of Cofilin1 protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20180710 Address after: 102208 Hualong Yuan Nan Li District, Ji Yuan Street, Changping District, Beijing Applicant after: Li Wei Applicant after: Nanjing Hanlui Baike Biotechnology Co.,Ltd. Address before: 102208 Hualong Yuan Nan Li District, Ji Yuan Street, Changping District, Beijing Applicant before: Li Wei |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| PE01 | Entry into force of the registration of the contract for pledge of patent right | ||
| PE01 | Entry into force of the registration of the contract for pledge of patent right |
Denomination of invention: Monoclonal antibodies against human legumain protein, hybridoma cell lines and their applications Effective date of registration: 20200922 Granted publication date: 20190201 Pledgee: Bank of China Limited Nanjing Chengdong Branch Pledgor: Nanjing Hanlui Baike Biotechnology Co.,Ltd. Registration number: Y2020980006320 |
|
| PC01 | Cancellation of the registration of the contract for pledge of patent right | ||
| PC01 | Cancellation of the registration of the contract for pledge of patent right |
Date of cancellation: 20220107 Granted publication date: 20190201 Pledgee: Bank of China Limited Nanjing Chengdong Branch Pledgor: Nanjing Hanlui Baike Biotechnology Co.,Ltd. Registration number: Y2020980006320 |
|
| PE01 | Entry into force of the registration of the contract for pledge of patent right | ||
| PE01 | Entry into force of the registration of the contract for pledge of patent right |
Denomination of invention: Monoclonal antibody against human legumain protein, hybridoma cell line and its application Effective date of registration: 20220112 Granted publication date: 20190201 Pledgee: Bank of China Limited Nanjing Chengdong Branch Pledgor: Nanjing Hanlui Baike Biotechnology Co.,Ltd. Registration number: Y2022980000359 |
|
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190201 |