CN108220324A

CN108220324A - A kind of method for promoting oleaginous yeast production grease

Info

Publication number: CN108220324A
Application number: CN201611128398.2A
Authority: CN
Inventors: 赵宗保; 杨晓兵; 张素芳
Original assignee: Dalian Institute of Chemical Physics of CAS
Current assignee: Dalian Institute of Chemical Physics of CAS
Priority date: 2016-12-09
Filing date: 2016-12-09
Publication date: 2018-06-29

Abstract

The invention discloses a kind of methods and applications that efficiently production microbial grease bacterial strain is built using metabolic engineering strategies.The present invention relates to phosphate based transferase is overexpressed in oleaginous yeast.This method can enhance the supply of oil synthesis precursor acetyl coenzyme A, improve oil yield, can effectively improve the economy of microbial grease.

Description

A kind of method for promoting oleaginous yeast production grease

Technical field

The present invention relates to phosphate based transferase PTA, specifically according to bacillus subtilis PTA protein sequences, The recombinant vector structure of phosphate based transferase PTA synthesized according to full genome after circle rhodosporidium toruloides codon preference optimization Build and metabolic engineering research in application.

Background technology

Grease is that a kind of oxygen content is low, energy density is high, the natural reproducible resource rich in carbon hydrogen element, is liquid bio The basic material of the productions such as fuel, oil and fat chemical product, food and material, is widely used in daily production and life various aspects [Jin MJ et al.Trends Biotechnol,2015,33:43-54.].Traditional animal and plant grease limits throughput, it is difficult to Meet the needs of growing, and the problem of there is striving grain with people, ground being striven with agriculture, and microorganism because growth is fast, substantially not Rely on arable land, can continuous production, convenient for transformation the features such as, the characteristics of showing its protrusion in recent years, [Zhao Zong protected Chinese biological works Journey magazine 2005,25 (2), 8-11].

Part microorganism can be more than its dry cell weight in intracellular accumulation in extreme case (such as nitrogen source shortage) in nature 20% grease, wherein based on triglycerides, these microorganisms are referred to as oleaginous microorganism, mainly including bacterium, yeast, mould Bacterium, algae etc. [Ratledge C, Wynn J P.Adv Appl Microbiol 2002,51,1-51].The synthesis of grease needs A large amount of acetyl coenzyme A and NADPH are as precursor and reducing power.Usual acetyl coenzyme A is the degradable glucide of microorganism It is generated by intracellular central metabolic pathway and tricarboxylic acids, has 1/3 carbon atom in this course with CO₂Form release It puts so that the theoretical yield (w/w) of glucide to grease is only 0.30-0.33, poor [the Bogorad IW of carbon atom economy et al.PNAS 2014,111,15928-15933]。

Phosphate based transferase (phosphate acetyltransferase, PTA) can be catalyzed acetyl phosphate to second The conversion of acyl coenzyme A, the synthesis for organism internal protein, carbohydrate, grease provide precursor [Bock AK et al.J.Bacteriol 1999,1861-1867].There are three types of approach altogether in the source of acetyl phosphate：1. acetic acid is through acetokinase Activation；2. xylulose phosphate is generated through xylulose phosphate zymogenesis；3. ketohexose phosphoric acid is catalyzed through ketohexose phosphokinase and gives birth to Into these enzymes are it is verified that be present in round rhodosporidium toruloides Yeast genome [Zhu ZW et al.Nat common 2012,3,1112].It thus introduces PTA and is likely to increase acetyl coenzyme A combined coefficient.In addition, it is catalyzed acetyl phosphate using PTA To acetyl coenzyme A, intracellular central metabolic pathway is can bypass, reduces CO₂Generation.Therefore, glucide can be arrived by being overexpressed PTA The raising theoretical yield [Bogorad IW et al.Nature 2013,502,693-697] of grease.

But non-someone carried out the overexpression of PTA genes in oleaginous yeast up to now, also nobody uses this A gene carried out the production of grease.

Invention content

The object of the present invention is to provide a kind of enhancing acetyl coenzyme A deliverabilities, improve substrate to oil quality yield Method.Specifically, it is the overexpression phosphate based transferase PTA in oleaginous yeast, increases the supply of intracellular acetyl coenzyme A, Come into force rate and the substrate of microbial grease are improved to the yield of grease.

The protein sequence of phosphate based transferase PTA is originated from bacillus subtilis in the present invention, and commission Suzhou is expanded fast Bio tech ltd carries out nucleic acid to phosphate based transferase PTA genes according to R.toruloides codon preferences Sequence design and full genome synthesis, the gene order after optimization is different from source gene order, and G/C content is improved by 42% to 62% Difference, particular sequence is shown in SEQ ID No.1.

The promoter Pgpd that the strain construction method of the present invention is related to, terminator Thsp are cloned from R.toruloides, Sequence is shown in annex.

To test above-mentioned purpose, the technical solution adopted by the present invention is：

First, according to oleaginous yeast codon preference full genome de novo formation PTA nucleic acid sequences.Then by being led Enter in oleaginous yeast and be overexpressed, obtain a large amount of fat contents and the bacterial strain of yield raising.

It should be appreciated by those skilled in the art that the phosphate based transferase that full genome synthesis and codon optimization will be encoded The nucleotide sequence of PTA or recombinant vector comprising PTA nucleotide sequences import host cell can be according to the routine of this field Technology carries out, for example, can be carried out by converting, transfecting the routine techniques such as (for example, agriculture bacillus mediated transfection) or electroporation.

For the ease of transgenic cell line or recombinant bacterial strain are identified and screened, used carrier can be modified, The enzyme (such as green fluorescent protein) of color change or the gene of luminophor are generated as being introduced into the coding that can be expressed in cell (such as kanamycins marker gene, rich Lay are mould for (such as gus gene, luciferase gene), resistant antibiotic marker genes Plain marker gene, hpt marker gene) or anti-chemical reagent marker gene (such as anti-herbicide gene) and nutrition screening mark Remember gene (such as LEU2, URA3, URA3, LYS2, LYS5, MET15).

The present invention provides following：

A kind of method for improving oleaginous yeast grease production, using technique for gene engineering, expresses phosphoric acid in oleaginous yeast Acetyltransferase, and ferment in oil-producing culture medium, improve oil yield.

The oleaginous yeast belongs to Lipomyces, Trichosporon Trichosporon, Cryptococcus for saccharomyces oleaginosus One kind in Cryptococcus, winter spore saccharomyces Rhodosporidium, Rhodotorula Rhodotorula.

The encoding gene PTA of the phosphate based transferase, for derive from bacillus subtilis sequence or according to The sequence that oleaginous yeast codon preference optimizes, sequence is as shown in SEQ ID No.1 after optimization.

Engineering strain in oil-producing culture medium is fermented, obtains oil-containing thalline, extracted isolated grease.

The carbon source of the oil-producing culture medium is glucose, xylose, arabinose, galactolipin, mannose, acetic acid, glycerine, sugarcane It is one or more in sugar, fructose, starch or ligno-cellulose hydrolysate.

The grease of the production is as oil and fat chemical raw material, for biodiesel, surfactant, paint, ink, lubrication Agent or medical cosmetic field.

Description of the drawings

Fig. 1 is compared for de novo formation PTA gene orders and source sequence.

Fig. 2 is amplification PTA as a result, amplified band is about 1kb.M is molecular weight standard, and swimming lane 1 is PTA amplified productions.

Fig. 3 is the structure of PTA expression vector pZPK-GPD-PTA in circle rhodosporidium toruloides.

Fig. 4 is that oil fermentation result after PTA is expressed in circle rhodosporidium toruloides.Every group of data are that three plants of recombinant bacterial strains are surveyed Allocate mean value.

Specific embodiment

Following embodiment will be helpful to those of ordinary skill in the art and further understand the present invention, but not in any form The limitation present invention.Experimental method in following embodiments is conventional method unless otherwise specified.It is used in following embodiments Experiment material, be to be commercially available from conventional biochemical reagent company unless otherwise specified.

Circle rhodosporidium toruloides (R.toruloides) CGMCC 2.1389 used in the embodiment of the present invention, Trichosporon cutaneum CGMCC 2.571, Lipomyces starkeyi CGMCC 2.1608 are common purchased from China Culture Collection (CGMCC, preserving number are CGMCC 2.1389).Cryptococcus curvatus ATCC 20509 derive from American Type Culture collection).

Involved culture medium prescription and purposes are as follows in following embodiment：

(1) YEPD culture mediums (g/L)：Dusty yeast 10, peptone 10, glucose 20, pH 6.0, solid medium then add again Enter agar powder 15；For strain activation and culture, seed liquor prepares and strain short term storage.

(2) glucose-limit nitrogen culture medium (g/L)：Dusty yeast 0.75, (NH₄)₂SO₄ 0.1,KH₂PO₄ 1.0,MgSO₄· 7H₂O 1.5, pH 5.6, and the trace element liquid of 1% (V/V) is added, for bacterial strain oil and fat accumulation and rich in fat drips thalline Culture, initial glucose concentration according to embodiment subject to.

(3) acetic acid-limit nitrogen culture medium (g/L)：NH₄Cl 1.07,yeast extract 0.5,peptone 0.5,H₃PO₄ 0.58,KCl 0.15,Na₂SO₄1.2,CaCl₂ 0.22,MgCl₂·6H₂O 0.41,FeCl₂·4H₂O0.0004, microorganism are female Liquid 10mL/L, initial pH 7.0, initial acetate concentration according to embodiment subject to.

(4) trace element solution formula (g/L)：CaCl₂·2H₂O 4.0,FeSO₄·7H₂O 0.55,citric acid·H₂O 0.52,ZnSO₄·7H₂O 0.10,MnSO₄·H₂O 0.076 and H₂SO₄ 1.75。

(5) acetic acid culture is with trace element solution formula (g/L)：Na₂EDTA·2H₂O 5,ZnSO₄·7H₂O 2.2, H₃BO₃ 1.14,MnCl₂·4H₂O 0.5,FeSO₄·7H₂O 0.5,CoCl₂·6H₂O0.16,CuSO₄·5H₂O 0.16, (NH₄)₆Mo₇O₂₄·4H₂O 0.11。

(6) acetic acid-vitamin stock solution (mg/L)：Thiamine hydrochloride 50, riboflavin 50, niacin 50, pantothenic acid 50, hydrochloric acid pyrrole are trembled Alcohol 10, biotin 20, folic acid 20, p-aminobenzoic acid 50, cyanocobalamin 50, lipoic acid 50. pass through 0.22 μm of micropore with preceding Membrane filtration degerming.

Embodiment 1：The structure of PTA expression recombination Rhodosporidium toruloides strains Rtcg-PTA

Oleaginous yeast Rhodosporidium toruloides CGMCC 2.1389 are purchased from China General Microbiological strain Preservation administrative center.Following primer is designed according to the nucleotide sequence of PTA, is expressed in R.toruloides for building PTA Carrier (the underscore part with EcoR V carries lower stroke of Spe I for EcoR V restriction enzyme sites, in primer name in primer name Line part be Spe I restriction enzyme sites, italicized item His-Tag)：

PTA-EcoV-F：CCATGGGATATCATGCACCACCACCACCACCACGCTGACCTCTTCTCGAC

PTA-spe I-R：GGACTAGTCTAGAGAGCCTGAGCCGCC

Following primer is designed according to the nucleotide sequence of GPD-p, for building composing type cloning vector pZPK (primers The underscore part of Pgpd-Xbal I-F is I restriction enzyme sites of Xba, and the underscore part of primer Pgpd-Eco V-R is EcoR V Restriction enzyme site) wherein clone GPD-p used in special primer be：

Pgpd-Xbal I-F 5’-CTAGTCTAGATCCATGCTGCTGCGATCTGGGAGTG-3’

Pgpd-Eco V-R 5’-CCATGGGATATCTGTGACTGATCTGGTGTTGTTCTGA-3’

Thsp-F

5’-CGAAAGAACACCACCATCACCATCACTAGACGATTCCGCCCCGTCTCACCTCGCAT-3’

Thsp-R

The step 1 of 5 '-GCATGCTGCAGGTCGACTCTAGAGGATCCCGCGCACTTCTCTGCACTGCATCTTTG -3 ' Express the structure of binary expression vector pZPK-GPD-PTA

It is bis- through Xba I/EcoR V using two primer amplification GPD-p segments of Pgpd-Xbal I-F and Pgpd-Eco V-R The pZPK of similary digestion is connected into after digestion (purchased from Biovector).It will identify and be can release about through Xba I/Eco V digestions The recombinant plasmid of 0.8kb Insert Fragments send TaKaRa to be sequenced, and correct recombinant plasmid is sequenced and is named as pZPK-GPD.Using Two primer amplification Thsp segments of Thsp-F and Thsp-R, being inserted into pZPK-GPD carriers through RF cloning process, (Maas is good, waits micro- Biological journal 2015,55,1505-1511).Thsp-F and Thsp-R bacterium colonies PCR can be released and amplify about 0.4kb Insert Fragments Recombinant plasmid send TaKaRa to be sequenced, and correct recombinant plasmid is sequenced and is named as pZPK-GPD-MCS-Thsp.Using PTA-EcoV-F With two primer amplification PTA segments of PTA-spe I-R, the pZPK-GPD- of similary digestion is connected into after Spe I/Eco V double digestions MCS-Thsp (is purchased from Biovector).The recombination matter of about 1kb Insert Fragments will be can release through Spe I/Eco V digestions identification Grain send TaKaRa to be sequenced, and correct recombinant plasmid is sequenced and is named as pZPK-GPD-PTA (Fig. 2).The expression vector is carried anti- Property gene is respectively hygromycin.Wherein GPD-p PCR Cloning processes are as follows：First, using R.toruloides genomes as template, According to the Pgpd-Xbal I-F and Pgpd-Eco of Prime STARMax 100uL, R.toruloides genomes 40ng, 20uM Each 2uL of R V-R, add water to 200uL, are added separately in PCR reaction systems, and reaction condition is：

PCR Cloning processes parameter is identical with GPD-p used by PTA, and the difference lies in 72 DEG C of extension of time to be by Thsp 5s。

Soil Agrobacterium, gained conversion strain was named are converted by the way of electroporated to correct plasmid is sequenced Then PTA genetic transformation is entered R.toruloides by AGL-GPD-PTA using the mode of soil Agrobacterium mediated transformation, containing Have and screened on the YEPD tablets of hygromycin.Picking transformant justifies rhodosporidium toruloides engineered strain and is named as Rtcg- accordingly PTA.Fermented and cultured is carried out in using 50g/L glucose as the limit nitrogen culture medium of carbon source, thalline is collected simultaneously when glucose exhausts Extract grease.Compared with control strain R.toruloides CGMCC 2.1389, circle rhodosporidium toruloides Rtcg-PTA intracellulars are recombinated Fat content increases 65% by 55%, and oil quantity increases to 7.5g/L by 5.5g/L.It is round red that this proves that PTA genes can promote Winter packet yeast fat content dramatically increases.

Wherein, prepared by soil Agrobacterium competence and mediated transformation circle rhodosporidium toruloides step bibliography carries out (Lin XP, et al.FEMS Yeast Res.2014,14 (6), 547-555.) picking transformant carries out continuous 5 pickup kind and verifies that it is steady It is qualitative, verify stable transformant after PCR verifications are correct for ferment Lipid-producing.

Recombinant bacterial strain Rtcg-PTA is as follows for the process of the middle fermentation Lipid-producing of carbon source in 50g/L glucose：

1. picking yeast strain single bacterium colony is inoculated in 50ml YEPD culture mediums, 30 DEG C, 200rpm shakes overnight incubation 24h；

2. about 5mL overnight cultures of transferring limit nitrogen in the 50g/L glucose of 50mL for carbon source, make initial OD_600nm=1.0, In 30 DEG C, 200rpm cultures stop fermentation when glucose exhausts；

3. biomass estimation and grease extraction step reference literature (Li YH et al.Enzyme Microb.Technol.2007,41(3),312-317.)

Embodiment 2：The structure of PTA expression recombination Rhodosporidium toruloides strains Rtat-PTA

Oleaginous yeast Rhodosporidium toruloides ATCC 10788 are purchased from American Type Tissue Culture pipe Reason center.Primer is designed according to the nucleotide sequence of PTA, PTA-EcoV-F and PTA-spe I-R exist for building PTA The carrier pZPK-GPD-PTA expressed in R.toruloides, detailed process is the same as embodiment 1.Then electroporated mode is utilized PTA genetic transformation is entered into R.toruloides, is screened on the YEPD tablets containing hygromycin.Picking transformant is in 30g/ Fermented and cultured, Lipid-producing are carried out in L acetic acid-limit nitrogen.Corresponding circle rhodosporidium toruloides engineered strain is named as Rtat-PTA.With it is right It is compared according to strains A TCC 10788, recombinates circle rhodosporidium toruloides Rtat-PTA intracellulars fat content and increase 35% by 24%, Biomass is improved by 1.5g/L to 7.5g/L.This proves that PTA genes can promote to justify red winter packet yeast bio amount and fat content is shown Writing increases.

Wherein, prepared by electrocompetent and step of converting is as follows：

1. picking yeast strain single bacterium colony is inoculated in 5mL YEPD culture mediums, 30 DEG C, 200rpm overnight incubations 16h；

2. 2mL overnight cultures of transferring are in the YEPD culture mediums of 50mL, in 30 DEG C of 200rpm overnight incubation 16h, until Cell density reaches 1 × 10⁸Cell/mL (OD_600nm=0.8-1.0)；

Following 3-7 steps operation carries out at 0-4 DEG C：

3. 2000g centrifugations 10min collects somatic cells；

4. the sterile water washing thalline cell of 20mL ice precooling 2 times, 2000g centrifugations 10min collects somatic cells；

5. the 1mol/L sorbitol washes somatic cells of 20mL ice precooling 2 times, it is thin that 2000g centrifugations 10min collects thalline Born of the same parents；

6. somatic cells are resuspended in the 1mol/L sorbierites of 0.4mL ice precooling, often pipe dispenses 50 μ l；

7. cell and DNA to be transformed (200-600ng, total volume≤5ul) are transferred to the electricity in the 0.2cm gaps of ice precooling In revolving cup, pulse conversion is done with 1.5KV, 25uF, 200 Ω；

8. the 1mol/L sorbierites of 1mL ice precooling are rapidly added in electric revolving cup, pipette tips gently pressure-vaccum mixing, in 30 DEG C of trainings Support 1-3h；

9. saccharomycete is coated on sorbierite Selective agar medium tablet (sorbierite 180g/l, YNB 1.7g/l, NH₄SO₄ 5g/l, glucose 20g/l, histidine 20mg/l, agar powder 13g/l), it is cultivated 3-6 days in 30 DEG C, until transformant occurs.

The process of recombinant bacterial strain Rtat-PTA fermentation Lipid-producings in acetic acid is carbon source culture medium is as follows：

1. picking yeast strain single bacterium colony is inoculated in 50mL YPD culture mediums, 30 DEG C, 200rpm shakes overnight incubation 24h；

2. about 10mL overnight cultures of transferring make initial OD in the YEPD culture mediums of 100mL_600nm=1.05, in 30 DEG C, 200rpm is cultivated for 24 hours；Then the 3-L bioreactors that the working volume being inoculated with by 5% inoculum concentration is 2L, initial acetate concentration It it is 30 DEG C in the limit nitrogen culture medium of 30g/L, dissolved oxygen 45%-55%, pH 7.0 ferments to acetic acid and exhaust；

Embodiment 3：PTA recombinates the structure of rhodotorula glutinis

Rhodotorula glutinis CGMCC 2.703 are purchased from China General Microbiological culture presevation administrative center.Profit Rhodotorula glutinis is converted with AGL-GPD-PTA, by PTA channel genes rhodotorula glutinis, idiographic flow with embodiment 1, through Hygromycin resistance plate screening, it is final to obtain rhodotorula glutinis engineered strain Rg-PTA.

Rhodotorula glutinis engineered strain Rg-PTA and starting strain will be recombinated, will be inoculated in respectively in YEPD culture mediums, 28 DEG C, 200rpm, culture for 24 hours, are then forwarded to 10% inoculum concentration in xylose-limit nitrogen culture medium of 50mL 70g/L, 30 DEG C, 200rpm.As a result, it has been found that compared with control strain R.glutinis, rhodotorula glutinis engineered strain Rg-PTA will be all wooden in 8d Sugar has consumed, and control strain R.glutinis then needs 10.5d, and xylose could be exhausted.And rhodotorula glutinis engineered strain Rg-PTA intracellulars fat content increases 65% by control strain 45%, and oil yield is improved by 0.15 to 0.28.Prove PTA Gene can promote glutinous Rhodotorula sp fat content to dramatically increase.

Grease obtained, fatty acid methyl ester (Li YH et al.Enzyme are prepared in bibliography Microb.Technol.2007,41(3),312-317.).Analysis finds that its aliphatic acid composition is：Myristic acid 2%, palmitic acid 35%, palmitoleic acid 0.5%, stearic acid 11.5%, oleic acid 45%, linoleic acid 3%, leukotrienes 1%, aliphatic acid composition with it is big The transesterification product of soya-bean oil it is similar.It therefore, can be as the raw material of biodiesel using the grease that methanol is substrate production.

Embodiment 4：PTA recombinates the structure of rhodotorula mucilaginosa

Glue red yeast Rhodotorula mucilaginosa (Rhodotorul arubra) CGMCC2.1515 is purchased from China General Microbiological culture presevation administrative center.R.mucilaginosa is converted using AGL-GPD-PTA, by PTA Channel genes rhodotorula glutinis, idiographic flow is with embodiment 1, through in hygromycin resistance plate screening, finally obtaining Rhodotorula mucilaginose Strain Rm-PTA.

It by recombinant C Rm-PTA and starting strain, is inoculated in 50mL YEPD culture mediums, 28 DEG C, 200rpm, cultivates respectively For 24 hours, sucrose -30 DEG C of limit nitrogen culture medium is then forwarded to 10% inoculum concentration, 200rpm is sampled every for 24 hours, treats that sucrose exhausts When, supplement 30g/L sucrose is three times.As a result, it has been found that compared with control strain bacterial strain R.mucilaginosa takes 8d, recombination glue is red Yeast engineering bacterium strain Rm-PTA terminates to ferment in 5.5d, and biomass improves 33%, reaches 40g/L, and intracellular grease contains Amount increases 49% by 38%.Proving the PTA genes of optimization can promote rhodotorula mucilaginosa fat content to dramatically increase.

It is grease obtained, bibliography (Fu J et al.Chemsuschem, 2011,4 (4):481-486) method carries out Catalytic hydrogenation treatment prepares hydrocarbon mixture of the carbon chain lengths in 14-18, as aviation fuel.

Embodiment 5：The structure of PTA recombination Lipomyces starkeyis Ls-PTA

Oleaginous yeast Lipomyces starkeyi Lypomyces starkeyi CGMCC 2.1560 are purchased from the common micro- life of China Object culture presevation administrative center.L.starkeyi is converted using AGL-GPD-PTA, by PTA channel genes L.starkeyi, idiographic flow is with embodiment 1, through in hygromycin resistance plate screening, final acquisition Lipomyces starkeyi work Journey bacterial strain Ls-PTA.

Recombination Lipomyces starkeyi engineered strain Ls-PTA and L.starkeyi inoculations of setting out are inoculated in respectively In YEPD culture mediums, 28 DEG C, 200rpm, culture for 24 hours, is then forwarded to 15-L of the working volume as 10L using 10% inoculum concentration Bioreactor.Fructose-limit nitrogen culture medium, initial fructose concentration are 70g/L, 30 DEG C, dissolved oxygen 40%-55%, pH 6.0, are carried out During which fermentation carries out feed supplement by carbon source of fructose, fructose concentration is 70g/L at the end of supplement every time, is terminated after 4 feed supplements Fermentation.As a result, it has been found that compared with control strain L.starkeyi, when recombination Lipomyces starkeyi engineered strain Ls-PTA ferments Between 7.4d shorten to by 11d, intracellular fat content increases 70% by 50%, and biomass increases to 120g/L by 100g/L. Proving the PTA genes of optimization can promote Lipomyces starkeyi fat content to dramatically increase.

It is grease obtained, bibliography (Voeste T et al.Journal of the American Oil Chemists Society,1984,61(2):Fatty alcohol 350-352) is prepared.It is used to prepare surfactant.

Embodiment 6：The structure of PTA recombination bending Cryptococcus

Oleaginous yeast Cryptococcus curvatus CGMCC 2.1389 are purchased from China General Microbiological culture presevation Administrative center.C.curvatus is converted using AGL-GPD-PTA, by PTA channel genes C.curvatus, idiographic flow With embodiment 1, through in hygromycin resistance plate screening, final obtain is bent Cryptococcus engineered strain Cc-PTA.

Recombination bending Cryptococcus engineered strain Cc-PTA and C.curvatus inoculations of setting out are inoculated in respectively In YEPD culture mediums, 28 DEG C, 200rpm, culture for 24 hours, is then forwarded to 3-L of the working volume as 2L using 10% inoculum concentration and gives birth to Object reactor.Corn stalk hydrolysis-limit nitrogen culture medium initial glucose concentration is 30g/L, xylose concentration 15g/L, Arabic Sugared 1.8g/L, galactolipin 1g/L, mannose 1.2g/L.Condition of culture is 30 DEG C, dissolved oxygen 45%-60%, pH 7.0.As a result it sends out Existing, compared with control strain C.curvatus, fermentation time reduction 30%, biomass increases to 22.5g/L by 20g/L, recombination Cc-PTA intracellulars fat content increases 69% by 55%.Prove that the PTA genes of optimization can promote to be bent Cryptococcus grease Content dramatically increases.

It is grease obtained, reference literature (Aoshima H et al.International Journal of Pharmaceutics,2005,293(1-2):25-34) method, the lubricant being prepared can be used as producing tablet medicine Lubricant.

Embodiment 7：The structure of PTA recombination trichosporon cutaneums Tc-PTA

Oleaginous yeast trichosporon cutaneum Trichosporon cutaneum CGMCC 2.138 are purchased from the common micro- life of China Object culture presevation administrative center.T.cutaneum is converted using AGL-GPD-PTA, by PTA channel genes T.cutaneum, idiographic flow is with embodiment 1, through in hygromycin resistance plate screening, final acquisition trichosporon cutaneum engineering Bacterial strain Tc-PTA is equipped with explanatory note as possible.

Recombination trichosporon cutaneum engineered strain Tc-PTA and the T.cutaneum bacterial strains that set out are inoculated in YEPD trainings respectively It supports in base, 28 DEG C, 200rpm, culture for 24 hours, is then seeded in glycerine limit nitrogen culture medium with the inoculum concentration of 15% (v/v), initial sweet Oil is 70g/L, and 30 DEG C, 200rpm, pH 5.6 is sampled every for 24 hours, and glycerol depletion terminates to ferment.As a result, it has been found that with compareing bacterium Strain T.cutaneum is compared, and recombination trichosporon cutaneum engineered strain Tc-PTA fermentation times foreshorten to 7.5d, biomass by 10d It is improved by 15g/L to 20g/L intracellulars fat content and increases 69% by 58%.Skin shape can be promoted by proving the PTA genes of optimization Trichosporon cutaneum fat content dramatically increases.

Embodiment 8：The structure of the sub- Roche solution fat yeast Yl-PTA of PTA recombinations

Sub- Roche solution fat yeast Yarrowia lipolytica CGMCC 2.1398 (are purchased from China General Microbiological strain Preservation administrative center).Y.lipolytica is converted using AGL-GPD-PTA, by PTA channel genes Y.lipolytica, idiographic flow is with embodiment 1, through in hygromycin resistance plate screening, the final sub- Roche solution fat yeast of acquisition Engineered strain Yl-PTA.

Recombination Asia Roche solution fat Yeast engineering bacterium strain Yl-PTA and the Y.lipolytica bacterial strains that set out are inoculated in respectively In YEPD culture mediums, 28 DEG C, 200rpm, culture for 24 hours, is then forwarded to shallow lake of the working volume as 100mL using 10% inoculum concentration Powder hydrolyzate-limit nitrogen culture medium, fermentation condition is 30 DEG C, 200rpm, pH 7.0 of total reducing sugar initial concentration 50g/L, with 2M NaOH Adjust pH.It is primary every sampling for 24 hours.As a result, it has been found that compared with control strain Y.lipolytica, sub- Roche solution fat yeast is recombinated Engineered strain Yl-PTA fermentation times foreshorten to 2.5d intracellulars fat content by 3.5d and increase 29% by 12%, biomass by 7g/L is improved to 12g/L.Proving the PTA genes of optimization can promote the accumulation of Yl-PTA biomass and fat content to increase.

Although illustrative embodiment carries out the present invention particularly shown and description, this field it is common It, can be with it is to be understood by the skilled artisans that under conditions of without departing substantially from by spirit and scope as defined by the claims of the present invention The variation of various forms and details is carried out wherein, can carry out the arbitrary combination of various embodiments.

SEQUENCE LISTING

<110>Dalian Inst of Chemicophysics, Chinese Academy of Sciences

<120>A kind of method for promoting oleaginous yeast production grease

<130>

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 972

<212> DNA

<213>Bacillus subtilis

<220>

<221> DNA

<222> (1)..(972)

<400> 1

atggctgacc tcttctcgac cgtccaggag aaggtcgccg gcaaggacgt caagatcgtc 60

ttcccagagg gcctcgacga gcgcatcctc gaggctgtct cgaagctcgc cggcaacaag 120

gtcctcaacc ctatcgtcat cggcaacgag aacgagatcc aggctaaggc taaggagctc 180

aacctcaccc tcggcggcgt caagatctac gaccctcaca cctacgaggg catggaggac 240

ctcgtccagg ctttcgtcga gcgccgcaag ggcaaggcta ccgaggagca ggctcgcaag 300

gctctcctcg acgagaacta cttcggcacc atgctcgtct acaagggcct cgccgacggc 360

ctcgtctcgg gcgctgctca ctcgacggct gacaccgtcc gcccagctct ccagatcatc 420

aagaccaagg agggcgtcaa gaagacctcg ggcgtcttca tcatggctcg cggcgaggag 480

cagtacgtct tcgcggactg cgctatcaac atcgctccag actcgcagga cctcgccgag 540

atcgctatcg agtcggctaa caccgctaag atgttcgaca tcgagcctcg cgtcgctatg 600

ctctcgttct cgaccaaggg ctcggctaag tcggacgaga ccgagaaggt cgccgacgcc 660

gtcaagatcg ctaaggagaa ggctccagag ctcaccctcg acggcgagtt ccagttcgac 720

gccgctttcg tcccttcggt cgccgagaag aaggctccag actcggagat caagggcgac 780

gctaacgtct tcgtcttccc ttcgctcgag gccggcaaca tcggctacaa gatcgctcag 840

cgcctcggca acttcgaggc tgtcggccct atcctccagg gcctcaacat gccagtcaac 900

gacctctcgc gcggctgcaa cgctgaggac gtctacaacc tcgctctcat cacggcggct 960

caggctctct ag 972

<210> 2

<211> 50

<212> DNA

<213>It is artificial synthesized

<220>

<221> DNA

<222> (1)..(50)

<400> 2

ccatgggata tcatgcacca ccaccaccac cacgctgacc tcttctcgac 50

<210> 3

<211> 27

<212> DNA

<213>It is artificial synthesized

<220>

<221> DNA

<222> (1)..(27)

<400> 3

ggactagtct agagagcctg agccgcc 27

<210> 4

<211> 35

<212> DNA

<213>It is artificial synthesized

<220>

<221> DNA

<222> (1)..(35)

<400> 4

ctagtctaga tccatgctgc tgcgatctgg gagtg 35

<210> 5

<211> 37

<212> DNA

<213>It is artificial synthesized

<220>

<221> DNA

<222> (1)..(37)

<400> 5

ccatgggata tctgtgactg atctggtgtt gttctga 37

<210> 6

<211> 56

<212> DNA

<213>It is artificial synthesized

<220>

<221> DNA

<222> (1)..(56)

<400> 6

cgaaagaaca ccaccatcac catcactaga cgattccgcc ccgtctcacc tcgcat 56

<210> 7

<211> 56

<212> DNA

<213>It is artificial synthesized

<220>

<221> DNA

<222> (1)..(56)

<400> 7

gcatgctgca ggtcgactct agaggatccc gcgcacttct ctgcactgca tctttg 56

Claims

A kind of 1. method for improving oleaginous yeast grease production, it is characterised in that：Using technique for gene engineering, in oleaginous yeast Phosphate based transferase is expressed, and is fermented in oil-producing culture medium, improves oil yield；

The oleaginous yeast belongs to Lipomyces, Trichosporon Trichosporon, Cryptococcus for saccharomyces oleaginosus One kind in Cryptococcus, winter spore saccharomyces Rhodosporidium, Rhodotorula Rhodotorula.
2. method according to claim 1, it is characterised in that：

The encoding gene PTA of the phosphate based transferase, to derive from the sequence of bacillus subtilis or according to oil-producing The sequence that yeast codons Preference optimizes, optimization postorder are classified as the nucleotide sequence shown in SEQ ID No.1.
3. method according to claim 1, it is characterised in that：Engineering strain is fermented in oil-producing culture medium, Obtain oil-containing thalline, extracted isolated grease.
4. method according to claim 3, it is characterised in that：The carbon source of the oil-producing culture medium for glucose, xylose, I One or both of uncle's sugar, galactolipin, mannose, acetic acid, glycerine, sucrose, fructose, starch or ligno-cellulose hydrolysate with On.
5. according to 1 or 3 the method for claim, it is characterised in that：The grease of the production is used for as oil and fat chemical raw material The production of biodiesel, surfactant, paint, ink, lubricant or medical cosmetic.