CN108192979B - Female specific marker of Chinese giant salamander and application - Google Patents
Female specific marker of Chinese giant salamander and application Download PDFInfo
- Publication number
- CN108192979B CN108192979B CN201710594198.4A CN201710594198A CN108192979B CN 108192979 B CN108192979 B CN 108192979B CN 201710594198 A CN201710594198 A CN 201710594198A CN 108192979 B CN108192979 B CN 108192979B
- Authority
- CN
- China
- Prior art keywords
- sex
- giant salamander
- giant
- female
- specific
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a female specific marker of Chinese giant salamanders and application thereof, comprising the following steps: A. cloning and verifying specific fragments: 1) analyzing candidate female specific fragments of Chinese giant salamander RAD; 2) PCR product recovery, cloning and sequencing, and 3) clone sequencing sequence analysis. B. Tissue section identification of physiological sex: 1) and fixing and storing the collected giant salamander gonadal sample. 2) Dehydrating the sample with ethanol step by step; 3) slicing gonad tissues, observing and identifying the physiological sex of the giant salamanders; C. establishing a genetic sex identification system: 1) extracting genome DNA; 2) designing a specific primer: cloning nucleotide sequences shown as sequences SEQ ID NO.1 and SEQ ID NO.2 after verification; 3) carrying out PCR amplification according to a reaction system; D. the application of the specific molecular marker in sex identification of ordinary giant salamander individuals and sex-reversed individuals. The marking operation is simple, accurate and reliable, and the genetic sex of the giant salamander can be identified through non-invasive sampling. The giant salamander sex and sex reversal giant salamander identification system is established for the first time, a simple and feasible molecular biological method is provided for the genetic sex identification of the giant salamander, and a way is also provided for the subsequent sex control breeding of the giant salamander.
Description
Technical Field
The invention belongs to the technical field of aquatic organisms, and relates to a molecular marker and a genetic sex identification technology, in particular to a Chinese giant salamander sex specific molecular marker, and also relates to application of the Chinese giant salamander sex specific molecular marker, in particular to a molecular biological method for identifying the early sex and sex reversal of the giant salamander.
Background
Traditional giant salamanders (Andrias davidianus), also known as giant salamanders, belong to the amphibian, urodele, cryptogil family, giant salamander (yan nan et al, 2010) in classification, and are widely distributed in 17 provinces (in phoenix, orchid, etc., 2006) in shanxi, jiangxi, sichuan, hunan, hubei, etc. In recent years, the number of giant salamander populations is sharply reduced due to human killing and giant salamander habitat destruction. In 1988, the giant salamander is listed as a national secondary protection animal and is listed in appendix I of International trade Convention (CITES) of endangered and extinct wild animals and plants (depending on the content of the giant salamander and the like, 2002). In addition, the Chinese giant salamander is an economic animal with extremely high edible and medicinal values, is tender and delicious in meat quality, contains high-quality protein, rich amino acids and trace elements (Zhangli and the like, 2009), and has the effects of nourishing yin, tonifying kidney, enriching blood and promoting qi (Zhangshenhu, 2001). The giant salamander skin powder mixed with tung oil can be used for treating burn and scald, especially for treating facial burn and scald without scar (Yangyefeng, 2004). Therefore, the giant salamander is one of important developed varieties in agricultural industrialization. Giant salamanders also have potential application values in the aspects of scientific research, eating, medicine, appreciation and the like, and for the purpose of protecting, proliferating and utilizing giant salamander resources, domestic researchers carry out the research of giant salamander domestication and breeding, so that the technical achievements of artificial giant salamander domestication, industrial breeding, artificial mixed feed and the like are obtained, and the artificial breeding of the giant salamanders is initially successful (houshishishishishihui et al, 2004). The development of the giant salamander breeding industry is further accelerated by the promulgation of the law of legal commercialized sale of the artificially bred second-generation giant salamanders in 2006. In order to further promote the industrial development and species protection, since 2015, 6.1, an identity management system and a traceable system of the giant salamander are established by the department of agriculture, and an operation and utilization license and a transportation license are cancelled, so that the issuing of the statue provides a more convenient mode for the operation and transportation of the giant salamander. However, the artificial breeding of giant salamanders needs to be done, and the breeding of the parents is the most important in all links, so that how to discriminate the sex of the giant salamander parents and perform targeted culture is very important. In addition, the breeding parents need reasonable ratio matching, and the female and male parents have different dosage and effect time when the oxytocic is injected. The sex identification of the giant salamanders is a recognized difficult problem, and the sex identification of the giant salamanders in the near breeding period mainly comprises the following methods: the head of the giant salamander is used for male and female distinction (Odongsheng et al, 2007), the gender of the giant salamander is differentiated in a behavioral way (Lianggang et al, 2010), and some scholars can identify the gender by observing the characteristics of the cloaca of the giant salamander and identify the gender of the giant salamander by using an ultrasonic technology (Leyujie, 2016). The method has low accuracy or high difficulty in actual operation, is expensive, and is not suitable for large-scale popularization. Therefore, the nondestructive sex identification of the giant salamanders by using the specific molecular markers is simple and convenient to operate, accurate and efficient, and the technology can provide great help for the giant salamander breeding work, so that the yield of the giant salamanders is improved, and great economic benefits are brought.
In recent years, many sex-specific molecular markers have been developed for fish sex studies. For example, Wang et al (2009) utilize AFLP technology to screen out molecular markers linked with X and Y chromosomes of Pelteobagrus fulvidraco for identifying the sex of Pelteobagrus fulvidraco. Chen et al (2007) scanned the male and female genome pool of Cynoglossus semilaevis Gunther with 64 pairs of AFLP primers to obtain 5 female specific fragments to identify the genetic sex. Iturra et al (1998) used RAPD technology to obtain two polymorphic DNA sequences on the Y chromosome of rainbow trout (Oncorhynchus mykiss). Chen et al (2010) screened male yellow river carp (Cyprinus carpio haematopterius) specific fragments by the technique of Suppressed Subtractive Hybridization (SSH). However, sex-specific molecular marker development is relatively delayed in amphibians, and only a few species are currently seen, such as Rana nigromaculata (Hyla arbor group) (2006) and Rana nigromaculata (Rana amurensis Boulenge) (2009). Therefore, the development of the sex specific molecular markers of the Chinese giant salamanders can be used for identifying the early sex of the giant salamanders and enriching the sex specific molecular markers of amphibious types.
Disclosure of Invention
The invention aims to provide a Chinese giant salamander gender specific molecular marker, and the Chinese giant salamander gender specific molecular marker is screened to obtain a gender specific marker sequence, wherein the marker is simple to operate, accurate and reliable, and the verification accuracy rate is 100%.
The invention also aims to provide application of the Chinese giant salamander sex specific molecular marker in sex identification of the common giant salamander individuals and sex-reversed giant salamander individuals, the marker provides a simple and feasible molecular technology for the early sex identification of the giant salamander and the sex-reversed giant salamander through a PCR amplification technology, and also provides a technical method for sex control breeding of the giant salamander.
In order to achieve the purpose, the invention adopts the following technical measures:
the technical conception is as follows: A. cloning and verifying female specific fragments of Chinese giant salamander RAD; B. tissue slices are used for identifying the physiological sex; C. establishing a genetic sex identification system; D. female specific labeling applications.
A preparation method of a Chinese giant salamander sex specific molecular marker comprises the following steps:
A. cloning and verifying female specific fragments of Chinese giant salamander RAD:
1) and (3) analyzing candidate female specific fragments of the Chinese giant salamander RAD, namely comparing RAD sequencing data with male genome data to obtain candidate female specific fragments of the RAD, and designing specific primers according to the candidate fragments.
2) And (4) recovering a PCR product, cloning and sequencing.
And (3) cutting and recovering the amplified product, connecting a PMD-18T cloning vector (Tiangen, Beijing) for 16 ℃, after 4 hours, transforming TOP10 competent cells, coating the competent cells on an ampicillin-containing agar plate for overnight culture at 37 ℃, selecting clones, culturing the clones in an ampicillin-free LB culture medium at 37 ℃ for 90 minutes after 250 ℃ transfer, carrying out PCR detection on the bacterial liquid by using an M13 universal primer, determining the clones which are positive clones with the expected size, and carrying out sample sequencing.
3) Analysis of clone sequencing sequences.
Comparing and analyzing the sequence after clone sequencing with the original sequence, and the homology reaches more than 96 percent. No sequence with no errors is confirmed to be subjected to Blast comparison analysis in a GenBank database, and no homology with any sequence is found temporarily.
B. Tissue section identification of physiological sex:
1) fixing the collected giant salamander gonadal sample in 4% (mass to volume ratio) paraformaldehyde for 24h, and then replacing the sample with 70% (volume ratio) ethanol for storage.
2) And (3) carrying out ethanol dehydration step by step on the tissue sample, carrying out xylene transparency treatment, carrying out paraffin embedding, slicing by a slicer and carrying out dyeing treatment.
3) The prepared gonad tissue sections are observed under a 40-fold microscope to identify the physiological sex of the giant salamanders, wherein follicular cells are female, follicular cells are absent, and spermatocyte is male (figure 1).
C. Establishing a genetic sex identification system:
1) extracting genome DNA: the genomic DNA was extracted by phenol chloroform method. Firstly, the giant salamander muscle tissue is cut into small pieces and added into a 1.5mL centrifuge tube with 500ul of tissue lysate. Add 10. mu.L proteinase K and 5. mu.L LRNaseA to the lysate and mix well, digest in 55 ℃ water bath, shake once every 20min, digest to clarify. Add 500. mu.L of phenol: chloroform: shaking the isoamyl alcohol mixed solution for 10min, centrifuging at 12000rpm for 10min, and taking supernatant; precooled 600. mu.L of absolute ethanol was added to the supernatant to precipitate DNA, the supernatant was centrifuged at 10000rpm and washed 2 times with 70% ethanol. After the alcohol was completely volatilized, the solution was dissolved in 100. mu.L of sterilized ultrapure water. And carrying out agarose electrophoresis on the DNA to detect the integrity and the purity, and detecting the DNA concentration by using the NanoDrop.
2) Designing specific primers according to the verified female specific sequences: according to the nucleotide sequence shown as SEQ ID NO.1 after clone verification (adf431) and the nucleotide sequence shown as SEQ ID NO.2 after clone verification (adf340), Primer premiers are utilized to design specific primers adf431a, adf431s, adf340a and adf340 s;
3) and carrying out PCR amplification according to the optimized reaction system and the reaction conditions.
PCR amplification, reaction conditions and procedures were as follows: the PCR reaction system is DNA 50 ng; 2XPCR mix7.5 μ L; the upstream and downstream primers were 0.2. mu.M, and sterile water was added to 15. mu.L.
Through the technical measures, the problem of sex identification of the giant salamander is solved, and compared with the conventional identification technology, the technology is simpler and easier to implement, lower in cost and more accurate in identification result. Provides a technical method for the sex identification of the giant salamander and lays a foundation for the subsequent parthenocarpy breeding.
The application of Chinese giant salamander sex specific molecular marker in sex identification of common giant salamander individuals and sex-reversed individuals comprises the following steps:
1) identifying the common giant salamander individual by using a female specific marker: the sex identification of the ordinary giant salamander individual is carried out by utilizing the established giant salamander sex identification system, and the result shows that a primer is designed according to two female specific fragments adf431 (the nucleotide sequence is shown as SEQ ID NO.1) and adf340 (the nucleotide sequence is shown as SEQ ID NO. 2):
adf431a：TCCAGAATGAAGTCCTGGCCT，
adf431s：CGAGCCTCCATTGTGCCTT；
adf340a：TTAACGGCCCTAACACCAGG，
adf340s：GGTTTAGGGCGGCTCTGATT；
PCR amplification is respectively carried out on 24 female 24 male giant salamander individuals, strips with the same size as expected can be amplified by two pairs of primers in 24 female individuals, and detection results show that the male giant salamander individuals are hereditary and the two pairs of primers can be accurately identified by 100% (fig. 2 and 3).
2) Identifying the giant salamander individual induced by high temperature by using a female specific marker: according to the tissue slice and microscopic observation, the physiological sex of the giant salamander is identified, and primers are used:
adf340a：TTAACGGCCCTAACACCAGG，
adf340s：GGTTTAGGGCGGCTCTGATT；
the genetic sex identification is carried out on 12 male and 12 female giant salamander individuals after high-temperature induction, and the bands with the same size as expected can be amplified to be genetic females (figure 4). The tissue section is identified as physiological male, the female specific marker is identified as genetic female, and the giant salamander is sex reversal.
3) Identifying the hormone-induced giant salamander individual by using a female specific marker: according to the tissue slice and microscopic observation, the physiological sex of the giant salamander is identified, and primers are used:
adf431a：TCCAGAATGAAGTCCTGGCCT，
adf431s：CGAGCCTCCATTGTGCCTT；
the genetic sex identification of 19 female 3 male giant salamander individuals after estrogen induction can amplify the band with the same size as expected to be a genetic female and can not amplify the female specific band to be a genetic male (figure 5). The tissue section is identified as a physiological female, the female specific marker is identified as a genetic male, and the giant salamander is sex reversal.
Through the application, female specific markers adf431(SEQ ID NO.1) and adf340(SEQ ID NO.2) of the giant salamanders can accurately identify the sex of the giant salamanders, and the identified sex-reversed giant salamanders are screened by combining the result of tissue microscopic observation, so that a giant salamander sex-reversed individual screening and identifying system is established for the first time, a relatively effective molecular identification method is provided for sex identification of the giant salamanders and screening of the sex-reversed giant salamanders, and a foundation is laid for subsequent breeding of giant salamander unisexual offspring seeds.
Compared with the prior art, the invention has the following advantages and effects:
the invention selects Chinese giant salamanders as materials, obtains Chinese giant salamander female specific fragments adf431(SEQ ID NO.1) and adf340(SEQ ID NO.2) through early screening, performs sequence cloning, verification and analysis on the fragments, designs female specific primers adf431a, adf431s, adf340a and adf340s, accurately identifies 24 tails of common female giant salamanders and 24 tails of male giant salamanders, and has the verification accuracy rate of 100%. In addition, genetic sex identification is carried out on 12 males and 12 females induced by high temperature and 19 females and 3 males after estrogen treatment, and the physiological sex is observed by combining tissue slices, and the result shows that 3 of 12 high temperature induced males are derived from genetic female individuals, and 3 individuals are subjected to sexual inversion; estrogen treatment 11 of 19 female individuals were derived from genetically male individuals, and these 11 individuals underwent sexual inversion.
The technology has the advantages of accuracy, rapidness, simplicity, easiness and the like, a giant salamander common individual and sex-reversed giant salamander sex identification system is established for the first time, a simple, convenient, rapid and feasible technical method is provided for the sex identification of the giant salamander and the sex-reversed giant salamander, the breeding and the domestication of the giant salamander are facilitated, a new technical approach is developed for the sex-controlled breeding of the giant salamander, and the technology has important significance and application value for the breeding industry of the giant salamander.
Drawings
FIG. 1 is a schematic view of microscopic observation of tissue sections of female and male Chinese giant salamanders individuals.
A. Observing the tissue slices of female and male Chinese giant salamanders individuals; B. observation of tissue sections of male individual of Chinese giant salamander
FIG. 2 is a schematic diagram of the genetic sex determination result of female specific adf431 segment of Chinese giant salamander.
In the figure, 1-12 and 25-36 show that 178bp specific bands can be amplified by female individuals, 13-24 and 37-48 show that male individuals can not be amplified, and M shows marker 2000;
FIG. 3 is a schematic diagram of the genetic sex determination result of female specific adf340 fragment of Chinese giant salamander.
In the figure, 1-12 and 25-36 show that 210bp specific bands can be amplified by female individuals, 13-24 and 37-48 show that male individuals can not be amplified, and M shows marker 2000;
FIG. 4 is a schematic diagram of the result of identification of high temperature induced reversal giant salamander by a female specific adf340 fragment of Chinese giant salamander.
In the figure, 1-12 male individuals and 13-24 female individuals, M represents marker2000, and a specific amplification band is a genetic female.
FIG. 5 is a schematic diagram of the result of identifying estrogen-induced reversal giant salamanders by Chinese giant salamander female specific adf431 fragments.
In the figure, 1-19 female individuals, 22-24 male individuals, M represents marker2000, a specific amplification band is a genetic female, and no band is a genetic male.
Detailed Description
According to the invention, a genome sequencing technology and a comparative omics are adopted to screen out candidate female specific segments of the Chinese giant salamander, then the female specific segments of the Chinese giant salamander are obtained through PCR screening verification, and the identification technology of the early sex and sex reversal giant salamander of the Chinese giant salamander is established, so that the problem of sex identification of the giant salamander is solved, great help is provided for the culture and reproduction of the giant salamander, and a foundation is laid for the unisexual breeding of the giant salamander.
The following is a detailed description of the specific female Chinese giant salamander marker and the specific application thereof, with reference to the accompanying drawings.
Example 1:
a preparation method of a Chinese giant salamander sex specific molecular marker comprises the following steps:
A. cloning and verifying female specific fragments of Chinese giant salamander RAD:
1) analysis of candidate female-specific fragments of giant salamander RAD candidate female-specific fragments candidate RAD female-specific fragments adf (SEQ ID No.1) and 39340 (SEQ ID No.2) were obtained by aligning RAD sequencing data with male genome data, and specific primers were designed using Primer Premier 5.0 software (Premier Biosoft International, Palo Alto, CA) based on the candidate fragment sequences, adf431a, adf431s, adf 35340, adf s.
2) And (4) recovering a PCR product, cloning and sequencing.
And (3) performing gel cutting recovery on an amplification product, connecting the amplification product with a PMD-18T cloning vector at 16 ℃, connecting for 4 hours, transforming TOP10 competent cells (Tiangen, Beijing), coating an ampicillin-containing plate for overnight culture at 37 ℃, selecting and cloning in an ampicillin-free LB culture medium at 37 ℃ for 250-turn culture for 90 minutes, performing PCR detection on a bacterial liquid by using an M13 universal primer (Populidae, Wuhan), and sending a sample for sequencing, wherein the bacterial liquid is a positive clone with the expected size.
3) Analysis of clone sequencing sequences.
Comparing and analyzing the sequence after clone sequencing with the original sequence, and the homology is more than 96%. No sequence confirmed to be error-free was analyzed by Blast alignment in GenBank database, and no homology was found with other sequences.
B. Tissue section identification of physiological sex:
1) fixing the collected andrias davidianus gonadal samples in 4% (mass volume ratio) paraformaldehyde for 24h, and then replacing the samples with 70% ethanol for storage.
2) And (3) carrying out ethanol dehydration step by step on the tissue sample, carrying out xylene transparency treatment, carrying out paraffin embedding, slicing by a slicer and carrying out dyeing treatment.
3) The prepared gonad tissue sections are observed under a 40-fold microscope to identify the physiological sex of the giant salamanders, wherein follicular cells are female, follicular cells are absent, and spermatocyte is male (figure 1).
C. Establishing a genetic sex identification system:
1) extracting genome DNA: the genomic DNA was extracted by phenol chloroform method. First, 10mg of giant salamander muscle tissue was cut into small pieces and added to 500ul of a 1.5mL centrifuge tube containing tissue lysate (10mM/L Tris-HCl pH 8.0; 100mM/L EDTA pH 8.0; 100mM/L NaCl; 0.5% SDS). Add 10. mu.L proteinase K (10mg/mL) and 5. mu.L RNaseA (100mg/mL) to the lysate, mix well, digest in a water bath at 55 ℃ for 1h, shake every 20min, digest until clear. Add 500. mu.L of phenol: chloroform: shaking the mixed solution of isoamyl alcohol (25:24:1) for 10min, centrifuging at 12000rpm for 10min, and collecting supernatant (300 μ L); the DNA was precipitated by adding 600. mu.L (2 times the volume of the supernatant) of dehydrated ethanol to the supernatant, centrifuged at 10000rpm for 10min to remove the supernatant, and washed twice with 70% ethanol. After the alcohol was completely volatilized, the solution was dissolved in 100. mu.L of sterilized ultrapure water. And carrying out agarose electrophoresis on the DNA to detect the integrity and the purity, and detecting the DNA concentration by using the NanoDrop.
2) Designing specific primers according to the verified female specific sequences: specific primers adf431a, adf431s and adf340a, adf340s were designed using Primer Premier 5.0 software according to clone validation sequences adf431 and adf 340:
the nucleotide sequence of the specific fragment adf431 is shown as SEQ ID NO.1, and the primer sequence of adf431 is as follows:
Adf431a：TCCAGAATGAAGTCCTGGCCT；
Adf431s：CGAGCCTCCATTGTGCCTT。
the nucleotide sequence of the specific fragment adf340 is shown as SEQ ID NO.2, and the primer sequence of adf340 is as follows:
adf340a：TTAACGGCCCTAACACCAGG；
adf340s：GGTTTAGGGCGGCTCTGATT。
3) and carrying out PCR amplification according to the optimized reaction system and the reaction conditions.
PCR amplification, reaction conditions and procedures were as follows: the PCR reaction system is DNA 50 ng; 2XPCR mix7.5 μ L; the upstream and downstream primers are 0.2 mu M, and the sterilized water is supplemented to 15 mu L; the reaction conditions were as follows: denaturation at 95 deg.C for 5 min; followed by denaturation at 95 ℃ for 30s, annealing at 59.5 ℃ for 30s, extension at 72 ℃ for 20s, amplification for 35 cycles, and extension at 72 ℃ for 5 min. The specific band can be amplified to be a genetic female individual, and the specific band can not be amplified to be a genetic male individual.
The giant salamander sex identification system is established by the technical measures, is simple and feasible, has low cost, accurately identifies the sex of the giant salamander, solves the problem of identifying the sex of the giant salamander in the past, and provides guidance for breeding, breeding and the like of the giant salamander.
Example 2:
the application of Chinese giant salamander sex specific molecular marker in sex identification of common giant salamander individuals and sex-reversed individuals comprises the following steps:
1) and identifying the common giant salamander individual by using the female specific marker.
The established andrias davidianus sex identification system is used for sex identification of 24-female 24-male individuals, and the result shows that two female specific fragments adf431 (the nucleotide sequence is shown as SEQ ID NO.1) and adf340 (the nucleotide sequence is shown as SEQ ID NO.2) are used for designing primers
adf431a:TCCAGAATGAAGTCCTGGCCT，
adf431s：CGAGCCTCCATTGTGCCTT；
adf340a：TTAACGGCCCTAACACCAGG，
adf340s：GGTTTAGGGCGGCTCTGATT
The female specific band with the same size as the target size can be amplified in 24 female individuals, the female specific band can not be amplified in 24 male individuals (figure 2 and figure 3), and the identification accuracy reaches 100%.
2) And (3) identifying the high-temperature induced reversal giant salamander by using a female specific marker.
And (3) carrying out physiological sex identification on the individual subjected to the giant salamander high-temperature treatment by using the tissue slice in combination with microscopic observation. Using the sex determination system established above, adf340 (nucleotide sequence is SEQ ID NO.2) female specific marker primers were used
adf340a：TTAACGGCCCTAACACCAGG，
adf340s：GGTTTAGGGCGGCTCTGATT
The genetic sex identification and screening of the 12 female giant salamanders and the 12 male giant salamanders induced by high temperature shows that 12 female individuals can amplify specific strips, 3 male individuals in 12 male individuals can amplify female strips (figure 4), the genetic sex is different from the physiological sex, and the 3 male individuals are sex-inverted giant salamanders.
3) And (3) identifying the hormone-induced reversal giant salamanders by using the female specific marker.
And (3) carrying out physiological sex identification on the individuals treated by the giant salamander estrogen by using tissue sections and microscopic observation. Using the above-established genetic sex determination system, adf431 (nucleotide sequence shown in SEQ ID NO.1) was used to label the primers
adf431a:TCCAGAATGAAGTCCTGGCCT，
adf431s：CGAGCCTCCATTGTGCCTT；
The genetic sex identification is carried out on the estrogen-treated 19 females and 3 males, only 8 females in the 19 females can amplify female specific strips, 11 females can not amplify female specific strips (figure 5), and 3 males can not amplify female strips, which indicates that 11 females are genetically male and reverse to female individuals.
Through the application, the giant salamander sex and sex reversal giant salamander identification system is established for the first time, and the problem of the conventional giant salamander sex identification is solved. By utilizing the sex identification system, the genetic sex of the ordinary giant salamander can be accurately identified, meanwhile, the genetic sex of the giant salamander induced by high temperature and estrogen is also identified, and the sex-reversed giant salamander with genetic female to male conversion and genetic male to female conversion is screened out by combining the observation result of a tissue slice. The system has the characteristics of accuracy, reliability, convenience in operation, low cost, no damage to the identification of the genetic sex of the giant salamander and the like, provides a molecular biological method for screening and identifying the sex of the giant salamander and sex-reversed giant salamanders, and also provides a way for the subsequent unisexual breeding of the giant salamanders.
SEQUENCE LISTING
<110> Changjiang aquatic products institute of aquatic science and research in China
<120> female specific marker of Chinese giant salamander and application thereof
<130> Chinese giant salamander female specific marker and application thereof
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 431
<212> DNA
<213> Chinese giant salamander
<400> 1
aattccagaa tgaagtcctg gcctcgggca gtgcccagcc ccgctttcat ggtcttatgg 60
acacgtggag ttcttattct cacttgttca ttggttcgta acgctcgagt gttctgaggg 120
tgacagaacc ttttggtgac atagggcggg cctgattgat agaaggcaca atggaggctc 180
gagggggacc ttaaacagga ccctaaatct gactgggaag cgaggaagaa ttttcaggat 240
cgggcaatat gtcctcgtag tcgtgtgtct gatataaggc gggccacagt gttttgtact 300
ttccggagct ttctgatctg ccccagtggt acattaagcg ggaccgaggt tccagcagtc 360
atggcatgag ctgacaattt ctctacaagc ttccgggaca tgctgcagca cttgtcgcag 420
gaatcttatg t 431
<210> 2
<211> 340
<212> DNA
<213> Chinese giant salamander
<400> 2
aattcactga ccaatttatg taatggataa atgatcggtt gctcaagagc acacctaaaa 60
tcatccccag tgatgtcaaa ttatggttta acggccctaa caccaggatc cccactgtga 120
acctagaaaa tcccttcttc agccacattg ataattacac caccaactcg agtggccact 180
tacaagaccc caattttata aagggcctca accatcacca ctgagccacc ggagttagtc 240
aattggtctg tccacacagt gaccctcttc cacatcccaa tccctcatga tccagctaag 300
cgctctgaca ccatcaccaa tcagagccgc cctaaacctt 340
Claims (5)
1. A Chinese giant salamander sex specific molecular marker adf431 is characterized in that: the sequence of the fragment adf431 is a nucleotide sequence shown in SEQ ID NO. 1.
2. A Chinese giant salamander sex specific molecular marker adf340, which is characterized in that: the sequence of the fragment adf340 is the nucleotide sequence shown in SEQ ID NO. 2.
3. The Chinese giant salamander sex-specific molecular marker adf431 according to claim 1, wherein: the specific amplification primer of fragment adf 431:
Adf431a：TCCAGAATGAAGTCCTGGCCT；
Adf431s：CGAGCCTCCATTGTGCCTT。
4. the Chinese giant salamander sex-specific molecular marker adf340 according to claim 2, wherein: the specific amplification primer of the fragment adf 340:
adf340a：TTAACGGCCCTAACACCAGG；
adf340s：GGTTTAGGGCGGCTCTGATT。
5. use of a reagent for detecting the presence of the Chinese giant salamander sex-specific molecular marker fragment adf431 and/or adf340 according to claim 1 or 2 in sex identification of ordinary giant salamander individuals and sex-reversed individuals.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710594198.4A CN108192979B (en) | 2017-07-20 | 2017-07-20 | Female specific marker of Chinese giant salamander and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710594198.4A CN108192979B (en) | 2017-07-20 | 2017-07-20 | Female specific marker of Chinese giant salamander and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108192979A CN108192979A (en) | 2018-06-22 |
| CN108192979B true CN108192979B (en) | 2021-03-23 |
Family
ID=62572707
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710594198.4A Active CN108192979B (en) | 2017-07-20 | 2017-07-20 | Female specific marker of Chinese giant salamander and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108192979B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113088574B (en) * | 2021-04-15 | 2022-05-31 | 中国科学院成都生物研究所 | Environmental DNA method for detecting giant salamander distribution |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013097143A1 (en) * | 2011-12-29 | 2013-07-04 | 深圳华大基因科技服务有限公司 | Method and device for estimating genome heterozygosity rate |
| CN106591429A (en) * | 2016-09-30 | 2017-04-26 | 中国水产科学研究院 | Screening method, kit and applications of cynoglossus semilaevis gunther sex conversion genetic control site |
| CN106947827A (en) * | 2017-05-09 | 2017-07-14 | 中国科学院水生生物研究所 | One kind obtains flathead sex specific molecular marker and its screening technique and application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103223109B (en) * | 2013-04-28 | 2015-04-15 | 赵道全 | Traditional Chinese medicine for promoting andrias davidianus male parent fish gonad maturation, and preparation method thereof |
-
2017
- 2017-07-20 CN CN201710594198.4A patent/CN108192979B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013097143A1 (en) * | 2011-12-29 | 2013-07-04 | 深圳华大基因科技服务有限公司 | Method and device for estimating genome heterozygosity rate |
| CN106591429A (en) * | 2016-09-30 | 2017-04-26 | 中国水产科学研究院 | Screening method, kit and applications of cynoglossus semilaevis gunther sex conversion genetic control site |
| CN106947827A (en) * | 2017-05-09 | 2017-07-14 | 中国科学院水生生物研究所 | One kind obtains flathead sex specific molecular marker and its screening technique and application |
Non-Patent Citations (3)
| Title |
|---|
| A reference gene set construction using RNA-seq of multiple tissues of Chinese giant salamander, Andrias davidianus;Xiaofang Geng等;《Gigascience》;20170215;第6卷(第3期);第1-7页 * |
| 大鲵亲本性别鉴定的几种方法;汤亚斌等;《中国水产》;20121005(第10期);第67页 * |
| 大鲵生殖腺转录组解析及性别决定和分化基因的筛选;曲彬;《中国优秀硕士学位论文全文数据库 农业科技辑》;20160430;第D052-3页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108192979A (en) | 2018-06-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101240348B (en) | Rapid identification method for half-smooth tongue-sole genetic sex | |
| CN111187862A (en) | Recombinase-based micropterus salmoides rhabdovirus isothermal amplification detection kit | |
| Zhang et al. | Isolation and identification of a viral haemorrhagic septicaemia virus (VHSV) isolate from wild largemouth bass Micropterus salmoides in China | |
| CN113502333A (en) | Molecular marker C42257 for rapidly identifying genetic sex of penaeus japonicus and application thereof | |
| CN113755566B (en) | PCR primer set, site, method and kit for rapidly identifying sex of wattle-necked softshell turtle | |
| CN107354219B (en) | Method and kit for identifying penguin sex | |
| CN111996261A (en) | Macrobrachium rosenbergii sex molecular marker primer and application thereof | |
| CN111560401A (en) | Molecular breeding method for thickening interpuscular spurs of erythroculter ilishaeformis and megalobrama amblycephala | |
| CN102277361A (en) | Method for screening protective antigens of Singapore grouper iridovirus | |
| CN114657264A (en) | Clarias fuscus gender-specific molecular marker primer and application thereof | |
| CN106011276B (en) | For identifying that the species specificity PCR of the balcony frog identifies primer and method and application | |
| CN108192979B (en) | Female specific marker of Chinese giant salamander and application | |
| CN102382878B (en) | Molecular marking method for discriminating different family of Cyprinus carpiovar jian | |
| CN102912017B (en) | Method for quickly and accurately identifying northern snakehead, Taiwan snakehead and hybrid snakehead | |
| CN102643912B (en) | Amplification primer for detecting mink derived ingredients | |
| CN103555847A (en) | Method for paternity identification of tilapia mossambica | |
| CN102876777B (en) | The special primer of brown croaker EST microsatellite marker and screening method | |
| CN103409516A (en) | Identification method of channel catfish species | |
| CN105039502A (en) | Chicken mtDNA D-loop region complete-sequence amplifying and sequencing method and special-use primer | |
| CN113718043B (en) | Specific molecular marker and primer for identifying genetic sex of Chaptera multiflora and method and application thereof | |
| CN102134600B (en) | PCR (Polymerase Chain Reaction) method for sex appraisal of Nipponia nippon | |
| CN104073557B (en) | The reference gene of long oyster Poly (I:C) stress tests fluorescent quantitation and primer thereof and application | |
| CN113502334B (en) | Molecular marker C27449 for rapidly identifying genetic sex of Penaeus japonicus and application thereof | |
| CN104611327A (en) | Amplification and sequencing method of chicken mtDNA Cytb gene complete sequence and special primer | |
| CN111118130B (en) | Method for rapidly identifying sex of macrobrachium rosenbergii |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |