CN108192912B

CN108192912B - A kind of maternal haploid method of induction generation corn

Info

Publication number: CN108192912B
Application number: CN201810023202.6A
Authority: CN
Inventors: 陈绍江; 刘晨旭; 钟裕; 陈琛
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2017-01-13
Filing date: 2018-01-10
Publication date: 2019-05-07
Anticipated expiration: 2038-01-10
Also published as: CN108192912A

Abstract

The invention discloses a kind of inductions to generate the maternal haploid method of corn.The present invention provides a kind of production plant female parent haploid method, includes the following steps: silencing or inhibits the expression of ZmPLA gene in purpose Plant Genome or knock out PLA gene, obtains transgenic plant or its offspring；Corn female parent monoploid can be obtained during being selfed or hybridizing as male parent with other materials.The experiment proves that the mutation of ZmPLA can result in the maternal haploid generation of corn, important basis has been established for the science of heredity and Biological Mechanism that disclose the generation of corn female parent monoploid.Meanwhile using this experiment or this method mutation single plant obtained, the haploid induction ability with corn female parent, the induction system novel for breeding further increases inductivity, and has great importance in terms of improving Haploid Breeding of Maize efficiency.

Description

A kind of maternal haploid method of induction generation corn

Technical field

The invention belongs to field of biotechnology, and in particular to a kind of maternal haploid method of induction generation corn.

Background technique

Corn is the first big crop in the world, has the versatiles such as edible, feeding and industrial processes.The volume increase of corn It is had a very important significance for supplying current edible, feeding and industrial processes demand.It is gradually decreased in current cultivated area In the case where, cultivate high yield, how anti-and extensively suitable corn hybrid seed is crucial.The incubation of corn hybrid seed depends on excellent selfing The breeding of system.The method of traditional breeding self-mating system is time-consuming and laborious, usually needs that a stable selfing more than generation can be bred as by 7 System.In recent years, haploid breeding technology is short, high-efficient with breeding cycle, is easy to binding molecule marker-assisted breeding method etc. Advantage has been increasingly becoming the major technique of selecting and breeding corn self-mating system.Currently, to be mainly derived from corn orphan female for monoploid in corn The induction of reproduction induction system, i.e. Stock6 or induction system derived from it are used as male parent, generate after hybridizing with other materials.Due to Most of induction systems have imported R1-nj label, thus embryo and the Endosperm Color label progress haploid identification of corn can be used. Thus substantially increase the efficiency of Haploid Breeding of Maize.

Due to induction system by produce single-female generation generate maternal haploid method be with a wide range of applications with Value, therefore, global more R&D institutions for Stock6 and its Derivative line induction generate maternal haploid hereditary basis and Basic of Biology has carried out a large amount of research.The result shows that corn single-female generation induction can generate corn female parent monoploid this One character is heritable, and the control by multiple genetic locus.(1999) etc. detect that 2 controls inductions are forthright The genetic locus of shape is located at No. 1 chromosome and No. 2 chromosomes.It can explain about 17% phenotypic variation.Barrant etc. (2008) it also detects that the genetic locus positioned at No. 1 chromosome, demonstrates the result of forefathers' research.Prigge etc. (2012) is utilized Multiple groups carry out genome-wide screening, the genetic locus of 8 control inductivities are found altogether, including positioned at No. 1 chromosome The main effect genetic locus of 1.04bin, and it is named as qhir1.It therefore, is that multiple control haploid-inductions are related positioned at qhir1 The QTL that effect in QTL is maximum, function is mostly important.Dong Xin etc. (2014) has carried out finely positioning to qhir1, and successfully will Positioning section is contracted to the range of 243Kb.The candidate gene of research qhir1 lures the breeding and single-female generation of novel induction system Leading is that induction generates maternal haploid science of heredity and Biological Mechanism is particularly important, is educated in view of monoploid in current breeding industry The popularity that kind of technology utilizes, the invention are widely used space and market prospects.

Summary of the invention

The object of the present invention is to provide a kind of haploid methods of production plant female parent.

Method provided by the invention, includes the following steps:

1) silencing or inhibit purpose Plant Genome in ZmPLA gene expression activity or knock out ZmPLA gene, obtain Transgenic plant；

2) transgenic plant or its offspring are selfed or are hybridized as male parent with other materials, is selfed Offspring or filial generation, as plant female parent monoploid.

In the above method, the expression of ZmPLA gene or activity or knockout in the silencing or inhibition purpose Plant Genome ZmPLA gene drops ZmPLA gene expression amount in purpose Plant Genome for ZmPLA gene in mutation purpose Plant Genome It is low or make in purpose Plant Genome ZmPLA gene that deletion mutation occur or insertion mutation occurs.

It is described that ZmPLA gene in purpose Plant Genome is made to occur to make described in missing or insertion mutation in the above method It is aobvious outside PLA gene First Exon and/or Second Exon and/or third exon and/or the 4th in purpose Plant Genome Son occurs missing and/or insertion mutation and/or can result in the SNP mutation of gene function forfeiture.

It is described to make ZmPLA gene generation missing or the mode of insertion mutation in purpose Plant Genome in the above method CRISPER/Cas9 and/or TELLEN technology and/or T-DNA insertion and/or EMS mutagenesis.

It is described to make ZmPLA gene First Exon in purpose Plant Genome that missing occur or be inserted into prominent in the above method The mode of change into CRISPER/Cas9,

Specifically, the target sequence of the CRISPER/Cas9 is 264-286 alkali in the 1st exon shown in sequence 3 Base；

The sgRNA sequence of CRISPER/Cas9 is sequence 4.

It is described to make ZmPLA gene First Exon in purpose Plant Genome that missing occur or be inserted into prominent in the above method Change includes the following steps: to express in the CRISPER/Cas9 vector introduction purpose plant of the sgRNA, obtains transgenosis plant Object.

Further include following steps in step 2) in the above method: by the self progeny or the filial generation single plant into Row monoploid Characters Identification, blade Ploidy Identification and/or molecular markers for identification, choose any method be accredited as it is haploid after It is plant female parent monoploid for single plant.

In the above method, the plant is corn or other plant.

Silencing inhibits the expression of ZmPLA gene or activity or knockout ZmPLA gene in purpose Plant Genome producing Application in plant female parent monoploid is also the scope of protection of the invention.

The present invention also provides a kind of methods for preparing plant female parent haploid inducing line, are silencing or inhibition purpose plant The expression of ZmPLA gene or activity or knockout ZmPLA gene, obtain transgenic plant, as plant female parent list times in genome Body induction system.

Or, being also the scope of protection of the invention by plant female parent haploid inducing line prepared by the method；

Or, the application that the plant female parent haploid induction ties up in production plant female parent monoploid is also present invention protection Range.

Plant female parent haploid inducing line is that can induce the production haploid plant of plant female parent.

It is also the scope of protection of the invention by the plant female parent monoploid that above-mentioned method produces.

Above-mentioned method or above-mentioned plant female parent monoploid in Doubled haploid line breeding or are based on Doubled haploid line breeding System it is breeding hybridized in application be also the scope of protection of the invention.

Plant female parent haploid inducing line is plant Parthenogenesis haploid.

The present invention is predicted by candidate gene, and gene (PLA) life of a coding phosphatidase is obtained in the section qhir1 Target gene has successfully been obtained by CRISPER/Cas9 site-directed mutagenesis technique and Transgenic studies in entitled ZmPLA, the gene Mutant material, other corn materials are hybridized using heterozygous genotypes mutant and homozygous genotype mutant, are demonstrated Material after ZmPLA mutation can induce the maternal haploid function of generation as male parent.

The present invention also provides the mutant gene sequences that a kind of known corn Parthenogenesis haploid induction is Stock6, and It is named as ZmHIR1-Stock6, characteristic Z mHIR1-Stock6 causes to be selfed or hybridize as male parent with other materials There is monoploid in offspring.The sequence is that the present invention predicts and be sequenced by candidate gene to obtain, and is proved by Transgenic studies The function forfeiture of the gene results in the maternal haploid generation of corn.

The present invention also provides artificial directed mutants the answering in Haploid Breeding of Maize of the gene ZmPLA Use

Basic principle of the invention is as follows: being directed to candidate gene ZmPLA, designs target position on first exon of gene First exon of ZmPLA gene is carried out screen mutation by the method for CRISPER/Cas9 rite-directed mutagenesis by point sequence, Obtain the genetically modified mutant of ZmPLA gene lacks functionality.After the single plant that success is mutated is selfed, the T1 generation kind of acquisition Son, then plant, and with T1 for the pollen of plant Mutants homozygous and Heterozygous mutants to two corn hybrid seed Zheng Dan 958 and capital Section 968 hybridizes, and obtains offspring.By the filial generation kind in field, according to the growing way in offspring's single plant field, molecular labeling and streaming Whether the methods of cell ploidy identification verifying wherein there is maternal monoploid.

The experiment proves that the mutation of ZmPLA can result in the maternal haploid generation of corn, for disclosing corn The science of heredity and Biological Mechanism that Parthenogenesis haploid generates have established important basis.Meanwhile utilizing this experiment or we Method mutation single plant obtained, has corn female parent haploid induction ability, and the induction system novel for breeding further increases Inductivity, and have great importance in terms of improving Haploid Breeding of Maize efficiency.

Detailed description of the invention

Fig. 1 is the setting of ZmPLA gene structure display and the target site using Crisper/Cas9 technology.

Fig. 2 is the ZmPLA site-directed point mutation and sequencing result mediated using PCR and Sanger sequencing detection CRISPER.

Fig. 3 is ZmPLA after hybridizing with cenospecies Zheng Dan 958, capital section 968, the monoploid photo of appearance.

Fig. 4 is field monoploid blade ploidy identification result.

Fig. 5 is field monoploid molecular markers for identification result.

Specific embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

Embodiment 1, induction generate the maternal haploid method of corn

One, the positioning of corn female parent monoploid phenotype correlation gene

By being positioned to the inductivity correlation QTL in the derivative induction system of corn female parent monoploid Stock6, obtain Main effect QTL-the qhir1 for controlling haploid induction, by pre- to the gene progress functional annotation and candidate gene that position in section It surveys, a candidate gene ZmPLA has finally been determined.

Two, corn female parent haploid induction ability is obtained after knocking out corn ZmPLA gene

1, CRISPER/Cas9 system knocks out corn ZmPLA gene

1) selection of sgRNA sequence

Fig. 1 is gene structure and target site schematic diagram.

The genome sequence of corn ZmPLA gene is as shown in sequence table 1.The sequence of the First Exon of corn ZmPLA gene Column (sequence 2 sequence 1 91-450) as shown in sequence table 2.

Target site sequence is designed in the First Exon sequence of corn ZmPLA gene, length 21bp is located at outside first Show the 264-286 base position of son.

Target site sequence is GCTGCAGGAGCTGGACGGACCGG (sequence 3).

Target position point design sgRNA sequence is GCUGCAGGAGCUGGACGGACCGG (sequence 4), the coding DNA of the sgRNA Molecule is sequence 3.

2), the building of CRISPER/Cas9 carrier

CRISPER/Cas9 carrier is that the non-coding DNA molecules of sgRNA shown in sequence 3 in sequence table are inserted into pBUN411 Carrier (is recorded in the following literature: Xing H L, Dong L, Wang Z P, et al.A CRISPR/Cas9toolkit for Multiplex genome editing in plants [J] .BMC plant biology, 2014,14 (1): 1.) obtains Carrier.

3), the acquisition of transgenic corns

CRISPER/Cas9 carrier is gone into Agrobacterium competent cell EHA105 by heat-shock transformed, obtains recombinant bacterium EHA105/CRISPER/Cas9。

Agrobacterium EHA105 competent cell is purchased from Hua Yue ocean Biotechnology Co., Ltd, and the public can be obtained by purchase.

Again by recombinant bacterium EHA105/CRISPER/Cas9 using Agrobacterium infestation method (recombinational agrobacterium carry out 28 DEG C of expansions it is numerous, Using expand it is numerous after bacterium solution maize immature embryos are infected) maize transformation Xu178 (and record in the following literature: Xiang Yan, Wu great By force, Jiang Haiyang waits foundation [J] laser biology journal of Plant Regeneration System from Mature Embryos of Maize Elite Inbred Lines, 2007,16 (5): 649-654., the public can obtain from country, China Agricultural University corn improvement center) rataria, by screening, breaks up and takes root T0 is obtained afterwards for transgenic corn plant.

4) the ZmPLA gene transgenic corn identification, to mutate

T0 is acquired for transgenic corn plant blade, and extracts genomic DNA as template, carries out PCR with following primer Amplification, obtains the pcr amplification product of different strains.

ZmPLA mutant nucleotide sequence detection primer:

1240F:CCCTCGACGAGTATCTATAGC

1240R:GAAGATGATAGGCTGCAGC

The pcr amplification product of different strains is subjected to Sanger sequencing, according to sequencing result and wild-type corn ZmPLA base The First Exon (sequence 2) of cause is compared, and whether identification T0 dashes forward for ZmPLA gene in transgenic corns difference strain Become.

As a result as follows: 21 plants of T0 are in transgenic corn plant, and the ZmPLA gene in 8 plants mutates, specific mutant form Formula is as follows, and part is as shown in Figure 2:

ZmPLA mutated gene ZmHIR1-1 is that T alkali is inserted between ZmPLA gene nucleotide series 1 the 280th -281 Base, DNA molecular shown in obtained sequence；

ZmPLA mutated gene ZmHIR1-2 is the 271st -281 11 base deletions of ZmPLA gene nucleotide series 1, DNA molecular shown in obtained sequence.

ZmPLA mutated gene ZmHIR1-3 is the 281st bit base G of ZmPLA gene nucleotide series 1 missing, obtained sequence DNA molecular shown in column；

The plant that ZmPLA gene mutates is denoted as positive T0 for transgenic corns.

5) genotype identification for the transgenic corns that T1 mutates for ZmPLA gene

The positive T0 that above-mentioned 1 is obtained sows again after harvesting seed for transgenic corns, obtains T1 for transgenic corns.

Identify T1 for transgenic corns ZmPLA gene whether be mutation genotype, it is specific as follows: T1 for transgenosis jade The genomic DNA of rice is used as template, utilizes ZmPLA mutant nucleotide sequence detection primer: 1240F:CCCTCGACGAGTATCTATAGC with 1240R:GAAGATGATAGGCTGCAGC is expanded, and PCR product is carried out Sanger sequencing, according to sequencing result to T1 generation The genotype of transgenic corns is classified.

Then it is heterozygous genotypes with the sequence of double-peak feature from target site sequence in sequencing result, then turns for T1 generation Gene corn heterozygous ZmPLA gene mutation (the middle ZmPLA gene mutation of 1 of homologue, another 1 of homologue Middle ZmPLA gene is unmutated)；

There is the sequence of special unimodal feature, the First Exon (sequence with corn ZmPLA gene from target site sequence 2) it compares, if equally, for wild type, there is no mutation, lower surface analysis does not consider；If there is mutation, for T0 for plant from The homozygous mutation obtained after friendship, then it is homozygous (in 2 of homologue for transgenic corns ZmPLA gene mutation for T1 ZmPLA gene mutates).T1 has ZmHIR1-1, ZmHIR1- for transgenic corns heterozygous ZmPLA gene mutation strain 2, and the mutation type of each strain is as follows:

T1 contains for 1 in homologue in transgenic corns ZmPLA gene mutation heterozygous strain ZmHIR1-1 ZmPLA mutated gene, the mutated gene are insertion T base between ZmPLA gene nucleotide series 1 the 280th -281, and its DNA molecular shown in the constant obtained sequence of his base, another contains wild type ZmPLA gene；

T1 contains for 1 in homologue in transgenic corns ZmPLA gene mutation heterozygous strain ZmHIR1-2 ZmPLA mutated gene, the mutated gene are the 271st -281 missing GAGCTGGACGG alkali of ZmPLA gene nucleotide series 1 Base, and DNA molecular shown in the constant obtained sequence of other bases, another contains wild type ZmPLA gene；

T1 in two homologues in the homozygous strain ZmHIR1-3 of transgenic corns ZmPLA gene mutation for containing ZmPLA mutated gene, which is the 281st missing G base of ZmPLA gene nucleotide series 1, and other bases are constant DNA molecular shown in obtained sequence.

2, CRISPER/Cas9 system knocks out the identification of the haploid induction ability of the obtained mutant of corn ZmPLA gene 1) T1 is identified for heterozygous genotypes transgenic corns ZmPLA gene mutation single plant haploid induction ability

(1) field phenotypic evaluation

T1 is authorized respectively for the pollen of transgenic corns ZmPLA genetic heterozygosis mutating strain series ZmHIR1-1, ZmHIR1-2 Cenospecies Zheng Dan 958 (blocks up pure letter, Cao Chunjing, Cao Qing wait the breeding of corn hybrid seed Zheng Dan 958 and apply [J] corn section Learn, 2006,14 (6): 43-45 is obtained from Rui Jin Zhong Ye difficult to understand limited liability company) and (cenospecies capital section, cenospecies capital section 968 968 are purchased from Beijing Tun Yuzhong industry Co., Ltd, and article No. is the capital Tun Yu section 968, and the public can collect beautiful kind of an industry by Beijing to be had Responsible company's purchase is limited to obtain), obtain filial generation；

T1 is selfed for transgenic corns ZmPLA genetic heterozygosis mutating strain series ZmHIR1-2, obtains self progeny.

Above-mentioned gained offspring is seeded in field, observes offspring's single plant phenotype, monoploid has plant short and small, blade compared with Narrow, and upper punching, plant type is compact, the features such as male sterility, and diploid then shows as that plant is tall and big, and blade is roomy, hangs down loosely, fertility is just Often.

It is compareed with wild-type corn (ZmPLA gene is unmutated) with the offspring of cenospecies.Each strain amount detection is such as Shown in table 1.

Statistical result is as shown in table 1 and Fig. 3:

T1 hybridize for transgenic corns ZmPLA heterozygous gene mutation strain ZmHIR1-1 with cenospecies Zheng Dan 958 54 1 is obtained in a offspring and shows as monoploid character single plant, is drafted as haplobiont；

T1 hybridize for transgenic corns ZmPLA heterozygous gene mutation strain ZmHIR1-1 with cenospecies capital section 968 50 1 is obtained in a offspring and shows as monoploid character single plant, is drafted as haplobiont；

T1 hybridize for transgenic corns ZmPLA heterozygous gene mutation strain ZmHIR1-2 with cenospecies Zheng Dan 958 93 2 are obtained in a offspring and shows as monoploid character single plant, are drafted as haplobiont；

T1 hybridize for transgenic corns ZmPLA heterozygous gene mutation strain ZmHIR1-2 with cenospecies capital section 968 57 2 are obtained in a offspring and shows as monoploid character single plant, are drafted as haplobiont；

1 is obtained in 27 offsprings that T1 is selfed for transgenic corns ZmPLA heterozygous gene mutation strain ZmHIR1-2 It is a to show as monoploid character single plant, it drafts as haplobiont.

(2) FCM analysis blade ploidy

By identification in above-mentioned (1) ZmHIR1-1 and cenospecies offspring obtain totally 2 show as monoploid character plant, In ZmHIR1-2 and cenospecies offspring identification obtain totally 4 show as monoploid character plant, in ZmHIR1-2 self progeny 1 of identification acquisition shows as monoploid character plant and carries out FCM analysis, the method is as follows:

The nucleus for extracting plant young leaflet tablet to be measured, using diploid maize leaf as control；Flow cytometer is used again Device detects signal, first detection diploid cell nuclear signal, and diploid cell nuclear signal peak position is set as 100 (due to two times Inhereditary material in body cell is twice of inhereditary material in haploid cell, and therefore, haploid cell nuclear signal peak position is 50 Nearby occur)；If the signal peak of plant to be measured appears near 100, then it is assumed that it is enriched with diploid cell nuclear signal intensity Position is identical, which is diploid.If plant cell nuclear signal to be measured peak appears near 50, then it is assumed that the plant to be measured Strain is haplobiont.

Each strain amount detection is as shown in table 1.

As a result as shown in figure 4, upper figure is wild-type corn FCM analysis as a result, the following figure is T1 for transgenic corns ZmPLA gene mutation heterozygous strain FCM analysis result；

As a result as follows:

The pseudohaploids that ZmHIR1-1 goes out with 2 in cenospecies filial generation through phenotypic evaluation are through flow cytomery Afterwards, ploidy is monoploid, is denoted as T1 for transgenic corns ZmPLA heterozygous gene mutation strain ZmHIR1-1 pseudohaploid Plant.

The pseudohaploids that ZmHIR1-2 goes out with 4 in cenospecies filial generation through phenotypic evaluation are through flow cytomery Afterwards, ploidy is monoploid, is denoted as T1 for transgenic corns ZmPLA heterozygous gene mutation strain ZmHIR1-2 pseudohaploid Plant.

For the pseudohaploid that 1 phenotypic evaluation goes out in ZmHIR1-2 self progeny after flow cytomery, ploidy is equal For monoploid, T1 is denoted as transgenic corns ZmPLA heterozygous gene mutation strain ZmHIR1-2 pseudohaploid plant.

(3) molecular markers for identification

Random Design 30 utilizes transgenic line Xu178 (Xiang Yan, Wu great Qiang, Jiang Hai to molecular labeling in the genome Foundation [J] laser biology journal of Plant Regeneration System from Mature Embryos of Maize Elite Inbred Lines is waited, 2007,16 (5) in ocean: 649-654., The public can obtain from country, China Agricultural University corn improvement center) and cenospecies Zheng Dan 958, capital section 968 genomic DNA As template, amplification and polymorphic molecular marker screening are carried out, final to obtain a pair of of molecular labeling, PCR product is in Xu178 For 500bp, and it is 300bp in cenospecies Zheng Dan 958 and the product length of cenospecies capital section 968, there is larger difference, Ke Yili It is differentiated with agarose gel electrophoresis, Xu178PCR product is larger, and electrophoretic velocity is slow, and cenospecies Zheng Dan 958 and cenospecies The PCR product segment of capital section 968 is smaller, and electrophoretic velocity is fast, and therefore, the band of Xu178 is located at cenospecies Zheng Dan 958 and cenospecies The top of 968 band of capital section.(Fig. 5,3,4 swimming lanes are respectively cenospecies Zheng Dan 958,968 banding pattern of cenospecies capital section, and 5 swimming lanes are Xu178 banding pattern)

To above-mentioned T1 for 2 quasi-simple times occurred in heterozygous gene mutation strain ZmHIR1-1 and cenospecies filial generation Body plant and T1 are for the 4 pseudohaploid plant occurred in heterozygous gene mutation strain ZmHIR1-2 and cenospecies filial generation Extracting genome DNA, PCR and the detection of agarose banding pattern are carried out, if single plant to be measured only has the band (Fig. 5,1 swimming lane) of Zheng Dan 958, Then think that the banding pattern of male parent material is not present in the single plant, therefore is maternal monoploid.If being existed simultaneously in filial generation single plant The band (Fig. 5,2 swimming lanes) of 958/ capital section 968 of Xu178 and Zheng Dan, then it is assumed that the single plant is the offspring of normal hybridisation, is two times Body.

As a result as shown in figure 5, M:Marker, 5 be male parent Xu178 banding pattern, and 4 be female parent 958 banding pattern of Zheng Dan, and 3 be maternal capital 968 banding pattern of section, 1 is monoploid banding pattern in offspring, and 2 be heterozygous diploid banding pattern in offspring.

Molecular markers for identification result is as follows:

The molecular markers for identification result table of 2 ZmHIR1-1 and the pseudohaploid gone out in cenospecies offspring through phenotypic evaluation It is bright, it is maternal haplobiont.

The molecular markers for identification result table of 4 ZmHIR1-2 and the pseudohaploid gone out in cenospecies offspring through phenotypic evaluation It is bright, it is maternal haplobiont.

Therefore, the offspring's single plant or Heterozygous transgenic strain self progeny's single plant of Heterozygous transgenic strain and cenospecies In, if being accredited as monoploid according to any method in above-mentioned 3 kinds of method qualification results, which is or candidate is corn mother This monoploid；If above-mentioned 3 kinds of method qualification results are not monoploid, which is not or candidate is not maternal single times of corn Body.

It is as shown in table 1 to count above-mentioned qualification result, inductivity (%)=(maternal monoploid strain number/total strain number) * 100 can To find out, hybridize after ZmPLA gene mutation with other materials, can get corn female parent monoploid in offspring.

The frequency of occurrences of haplobiont in 1 heterozygous mutant strain test progeny of table

Note: control is the offspring obtained after being pollinated with wild type Xu178 material and cenospecies Zheng Dan 958 and capital section 968.

2) T1 is identified for homozygous genotype transgenic corns ZmPLA gene mutation single plant haploid induction ability

(1) field phenotypic evaluation

T1 is authorized to cenospecies Zheng Dan 958 for the pollen of transgenic corns ZmPLA homozygous mutation strain ZmHIR1-3, Obtain filial generation；

T1 is selfed for transgenic corns ZmPLA genetic heterozygosis mutating strain series ZmHIR1-3, obtains self progeny.

As a result as follows:

T1 is miscellaneous for 256 of transgenic corns ZmPLA homozygous gene mutating strain series ZmHIR1-3 and cenospecies Zheng Dan 958 4 are obtained in friendship offspring and shows as monoploid character single plant, are drafted as haplobiont；

T1 has obtained 2 in 30 self progenies of transgenic corns ZmPLA homozygous gene mutating strain series ZmHIR1-3 A single plant for showing as monoploid character, is drafted as haplobiont.

(2) FCM analysis blade ploidy

After T1 is hybridized for transgenic corns ZmPLA homozygous gene mutating strain series ZmHIR1-3 with cenospecies Zheng Dan 958 2 pseudohaploid single plants carry out fluidic cell in 4 pseudohaploids and ZmHIR1-3 homozygous mutation self progeny in offspring Detection, the method is as follows:

The nucleus of plant young leaflet tablet to be measured is extracted, with wild-type corn (ZmPLA gene is unmutated, diploid) blade As control；Signal is detected with fluidic cell instrument again, first detection diploid cell nuclear signal, and diploid cell core is believed Number peak position be set as 100 (since the inhereditary material in diploid cell is twice of inhereditary material in haploid cell, it is single Times somatic cell nuclear signal peak position occurs near 50)；If the signal peak of plant to be measured appears near 100, then it is assumed that it is with two Times somatic cell nuclear signal strength enrichment positions are identical, which is diploid.If plant to be measured carefully each strain testing number Amount is as shown in table 2.

As a result as shown in figure 4, upper figure is wild-type corn FCM analysis as a result, the following figure is T1 for transgenic corns ZmHIR1-3 homozygous lines offspring's pseudohaploid FCM analysis result；

As a result as follows:

4 pseudohaploids occurred in ZmHIR1-3 and 958 filial generation of Zheng Dan are after flow cytomery, ploidy It is monoploid.

2 pseudohaploid plant that the self progeny of ZmHIR1-3 homozygous mutation material generates are through flow cytomery Afterwards, ploidy is monoploid.

(3) molecular markers for identification

Random Design 30 marks agarose molecules in the genome, utilizes transgenic line Xu178 and cenospecies Zheng Dan 958, the genomic DNA of capital section 968 carries out amplification and polymorphic molecular marker screening as template, obtains a pair of of molecular labeling, Its PCR product is 500bp in Xu178, and is 300bp in cenospecies Zheng Dan 958 and the product length of cenospecies capital section 968, With larger difference, can use can be differentiated using agarose gel electrophoresis, and Xu178PCR product is larger, and electrophoretic velocity is slow, And the PCR product segment of cenospecies Zheng Dan 958 and cenospecies capital section 968 is smaller, electrophoretic velocity is fast, therefore, the band position of Xu178 In the top of 968 band of cenospecies Zheng Dan 958 and cenospecies capital section.(Fig. 5,3,4 swimming lanes are respectively cenospecies Zheng Dan 958, hybridization 968 banding pattern of Zhong Jing section, 5 swimming lanes are Xu178 banding pattern)

The ZmHIR1-3T1 selected to field is for transgenic corns homozygous gene mutating strain series and 958 filial generation of Zheng Dan In 4 pseudohaploid plant carry out extracting genome DNA, PCR and agarose banding pattern detection, if single plant to be measured only has Zheng Dan 958 band (Fig. 5,1 swimming lane), then it is assumed that the banding pattern of male parent material is not present in the single plant, therefore is maternal monoploid.If hybridization The band (Fig. 5,2 swimming lanes) of Xu178 and Zheng Dan 958 is existed simultaneously in offspring's single plant, then it is assumed that after the single plant is normal hybridisation Generation is diploid.

As a result as shown in figure 5, M:Marker, 5 be Xu178 banding pattern, and 4 be 958 banding pattern of cenospecies Zheng Dan, and 3 be cenospecies capital 968 banding pattern of section, 1 is monoploid banding pattern in offspring, and 2 be zygoid banding pattern in offspring；

As a result as follows:

T1 is for 4 obtained in the filial generation of transgenic corns ZmHIR1-3 homozygous mutation strain and Zheng Dan 958 Pseudohaploid shows as maternal monoploid after molecular markers for identification.

Therefore, the offspring's single plant or Transgenic wheat line self progeny's single plant of Transgenic wheat line and cenospecies In, if being accredited as monoploid according to any method in above-mentioned 3 kinds of method qualification results, which is or candidate is corn mother This monoploid；If above-mentioned 3 kinds of method qualification results are not monoploid, which is not or candidate is not maternal single times of corn Body.

The results are shown in Table 2, inductivity (%)=(maternal monoploid strain number/total strain number) * 100, it can be seen that ZmPLA Hybridize after gene mutation with other materials, can get corn female parent monoploid in offspring.

The frequency of occurrences of haplobiont in 2 heterozygous mutant strain test progeny of table

Three, the genotype identification of corn female parent haploid inducing line Stock6

Stock6 is that capable of inducing of reporting for the first time generates maternal haploid special material (Coe EH (1959) A of corn Line of maize with high haploid frequency.Am Nat 93:381-382) by inductivity main effect The finely positioning and candidate gene of QTL is predicted, is found compared with B73, and it is prominent that there are many places SNP on the gene ZmPLA of Stock6 Change and the insertion (table 3) of a 4bp, so that the gene loses normal function.Using Crisper technology to wild-type corn After the ZmPLA gene of material carries out rite-directed mutagenesis, it was demonstrated that it pollinates after the gene mutation as male parent and other materials, energy in offspring There is the monoploid of certain frequency.ZmPLA gene in Stock6 genome is by the generation of gene ZmPLA shown in sequence 1 Obtained mutant nucleotide sequence after following mutation, is named as ZmHIR-Stock6.

The exons mutation form of 3 gene ZmPLA of table

5 ' the UTR regions of gene ZmPLA are mutated are as follows: 45-46 base position lacks two base TA, and 65-67 is base CAA is replaced with by TCG, is inserted into two base TC between 67-68 base position, 80-81 bit base replaces with CG by TT；

The introne region mutagenesis of gene ZmPLA are as follows: 499-503 bit base GTAC missing, 524 bit base C sport G, 530 bit base G sport T, 553-560 bit base GCATGCAT missing, 806-809 bit base GTAC missing.

3 ' the UTR regions of gene ZmPLA are mutated are as follows: and the 1741st bit base G sports A, and the 1781st bit base C sports T, 1787th bit base A sports T.

Above-mentioned induction is that the ZmPLA mutated gene 4 in Stock6 is occurred compared to the ZmPLA wild type gene in B73 SNP and Insertion mutation, specific mutant form is as follows:

ZmHIR-Stock6 mutant nucleotide sequence is inserted into CGAG, and the 409th after being ZmPLA gene nucleotide series 1 the 1569th The C of position sports T, the 421st C sports G, and the 441st T sports C, and the 887th T sports G, the 1210th G sports C, and the 1306th T sports C, and the 1435th G sports A, and the 1471st C sports A, the 1541st A C is sported, the 1588th T sports C, and the 1591st C sports A, DNA molecular shown in obtained sequence.1687th Bit base A sports C, and the 1691st bit base G sports A, and the 1706th bit base T sports C, and the 1708th bit base G is sported C, 45-46 base position lack two base TA, and 65-67 replaces with CAA by TCG for base, and 67-68 base position interleaves Enter two base TC, 80-81 bit base replaces with CG, 499-503 bit base GTAC missing by TT, and 524 bit base C are sported G, 530 bit base G sport T, 553-560 bit base GCATGCAT missing, and 806-809 bit base GTAC is lacked, and the 1741st Bit base G sports A, and the 1781st bit base C sports T, and the 1787th bit base A sports T.

The above-mentioned CGAG insertion being located at after 1482 bases causes the gene that frameshift mutation has occurred.Positioned at 319 bases, 331 SNP variation at base and 1120 bases results in the variation of amino acid, also affects the function of protein.

From monoploid character, FCM analysis blade times in the single plant of corn female parent haploid inducing line Stock6 offspring Property and molecular markers for identification prove there is monoploid.

Therefore, no matter corn ZmPLA gene which kind of mutation can form it into corn Parthenogenesis haploid.

Sequence table

<110>China Agricultural University

<120>a kind of induction generates the maternal haploid method of corn

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 1795

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 1

agttcatcac taatcacact tattgtgccc tcgacgagta tctatagcta gctcattaat 60

cgattcgggg gtgtgttgtc gaaggcggca atggcgagct actcgtcgcg gcgtccatgc 120

aatacctgta gcacgaaggc gatggccggg agcgtggtcg gcgagcccgt cgtgctgggg 180

cagagggtga cggtgctgac ggtggacggc ggcggcgtcc ggggtctcat cccgggaacc 240

atcctcgcct tcctggaggc caggctgcag gagctggacg gaccggaggc gaggctggcg 300

gactacttcg actacatcgc cggaaccagc accggcggtc tcatcaccgc catgctcacc 360

gcgcccggca aggacaagcg gcctctctac gctgccaagg acatcaacca cttttacatg 420

cagaactgcc cgcgcatctt tcctcagaag tgagtccgat gctgccgcca ttgttcttgc 480

atccatccag catcgtacgt acgtcctcta tacatctgcg gatcatcatg tgcgcatgtt 540

tgtggcatgc atgcatgcat gtgagcagga gcaggcttgc ggccgccatg tccgcgctga 600

ggaagccaaa gtacaacggc aagtgcatgc gcagcctgat taggagcatc ctcggcgaga 660

cgagggtaag cgagacgctg accaacgtca tcatccctgc cttcgacatc aggctgctgc 720

agcctatcat cttctctacc tacgacgtac gtacgtcgtc acgaatgatt catctgtacg 780

tcgtcgcatg cgaatggctg cctacgtacg ccgtgcgcta acatactcag ctctttccta 840

tctgctgcgc caatttgcag gccaagagca cgcctctgaa gaacgctctg ctctcggacg 900

tgtgcattgg cacgtccgcc gcgccgacct acctcccggc gcactacttc cagactgaag 960

acgccaacgg caaggagcgc gaatacaacc tcatcgacgg cggtgtggcg gccaacaacc 1020

cggtaactga ctagctaact ggaaaacgga cgcacagact ccatgtccat ggcggcccac 1080

aaggtcgatg ctaattgttg cttatgtatg tcgcccgatt gcacatgcgt agacgatggt 1140

tgcgatgacg cagatcacca aaaagatgct tgccagcaag gacaaggccg aggagctgta 1200

cccagtgaag ccgtcgaact gccgcaggtt cctggtgctg tccatcggga cggggtcgac 1260

gtccgagcag ggcctctaca cggcgcggca gtgctcccgg tggggtatct gccggtggct 1320

ccgcaacaac ggcatggccc ccatcatcga catcttcatg gcggccagct cggacctggt 1380

ggacatccac gtcgccgcga tgttccagtc gctccacagc gacggcgact acctgcgcat 1440

ccaggacaac tcgctccgtg gcgccgcggc caccgtggac gcggcgacgc cggagaacat 1500

gcggacgctc gtcgggatcg gggagcggat gctggcacag agggtgtcca gggtcaacgt 1560

ggagacaggg aggtacgaac cggtgactgg cgaaggaagc aatgccgatg ccctcggtgg 1620

gctcgctagg cagctctccg aggagaggag aacaaggctc gcgcgccgcg tctctgccat 1680

caacccaaga ggctctagat gtgcgtcgta cgatatctaa gacaagtggc tttactgtca 1740

gtcacatgct tgtaaataag tagactttat tttaataaaa cataaaaata tatat 1795

<210> 2

<211> 360

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 2

atggcgagct actcgtcgcg gcgtccatgc aatacctgta gcacgaaggc gatggccggg 60

agcgtggtcg gcgagcccgt cgtgctgggg cagagggtga cggtgctgac ggtggacggc 120

ggcggcgtcc ggggtctcat cccgggaacc atcctcgcct tcctggaggc caggctgcag 180

gagctggacg gaccggaggc gaggctggcg gactacttcg actacatcgc cggaaccagc 240

accggcggtc tcatcaccgc catgctcacc gcgcccggca aggacaagcg gcctctctac 300

gctgccaagg acatcaacca cttttacatg cagaactgcc cgcgcatctt tcctcagaag 360

<210> 3

<211> 23

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 3

gctgcaggag ctggacggac cgg 23

<210> 4

<211> 23

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 4

gcugcaggag cuggacggac cgg 23

Claims

1. a kind of haploid method of production plant female parent, includes the following steps:

1) silencing or inhibit purpose Plant Genome in ZmPLA gene expression activity or knock out ZmPLA gene, obtain turning base Because of plant；

2) transgenic plant or its offspring are selfed or are hybridized as male parent with other materials, obtain self progeny Or filial generation, as plant female parent monoploid；

The silencing inhibits the expression of ZmPLA gene or activity in purpose Plant Genome or knocks out ZmPLA gene, for mutation ZmPLA gene makes ZmPLA gene in purpose Plant Genome that deletion mutation occur or occur to be inserted into prominent in purpose Plant Genome Become；

It is described that ZmPLA gene in purpose Plant Genome is made to occur to make in purpose Plant Genome described in missing or insertion mutation Missing and/or insertion mutation occur for ZmPLA gene First Exon；

It is described to make ZmPLA gene First Exon generation missing or the mode of insertion mutation in purpose Plant Genome CRISPR/Cas9；

The target sequence of the CRISPR/Cas9 is 264-286 bit base in the 1st exon shown in sequence 3；

The sgRNA sequence of the CRISPR/Cas9 is sequence 4；

The plant is corn.

2. according to the method described in claim 1, it is characterized by: described make ZmPLA gene first in purpose Plant Genome Missing occurs for exon or insertion mutation includes the following steps: the CRISPR/Cas9 vector introduction purpose that will express the sgRNA In plant, genetically modified plants are obtained.

3. method according to claim 1 or 2, it is characterised in that:

Further include following steps in step 2: the self progeny or the filial generation single plant are subjected to monoploid character mirror Fixed, blade Ploidy Identification and/or molecular markers for identification, choosing any method and being accredited as haploid offspring's single plant is that plant is female This monoploid.

4. the plant female parent monoploid produced by method as claimed in any one of claims 1-3.

5. method as claimed in any one of claims 1-3 or plant female parent monoploid as claimed in claim 4 are in Doubled haploid line Application in breeding or breeding hybridized based on Doubled haploid line breeding line.