CN108192878B - Monochamus alternatus endogenous laccase protein Ma-Lac1, encoding gene and application thereof - Google Patents

Abstract

The invention provides a monochamus alternatus endogenous laccase protein Ma-Lac1, an encoding gene and application thereof, and belongs to the technical field of lignocellulose. The monochamus alternatus endogenous laccase protein Ma-Lac1 has an amino acid sequence shown as SEQ ID No.1 in a sequence table. The monochamus alternatus endogenous laccase protein Ma-Lac1 codes 1 protein containing 687 amino acids, the molecular weight of the coded protein is 78.26kDa, and the isoelectric point is 5.30. The Malac-1 instability coefficient was 31.69, the fat coefficient was 80.26, and the overall average hydrophilicity was-0.313. The Malac-1 gene coding protein has 2 transmembrane domains and 1 suspected transmembrane domain. Each transmembrane domain has 17-18 amino acid residues. The main backbone constituting the protein is a random coil. The monochamus alternatus endogenous laccase has high enzyme activity for degrading lignocellulose.

Description

Monochamus alternatus endogenous laccase protein Ma-Lac1, encoding gene and application thereof

Technical Field

The invention belongs to the technical field of lignocellulose, and particularly relates to monochamus alternatus endogenous laccase protein Ma-Lac1, an encoding gene and application thereof.

Background

Laccase (polyphenol oxidase (EC1.10.3.2Lacccase, Lac for short)) is one of two lignin enzyme systems of a blue oxidase family, and can directly reduce molecular oxygen into water through high oxidation-reduction potential of 430-790 mV, namely, without H₂O₂And other secondary metabolites in the presence of dissolved oxygenThe substrate can be oxidized directly (Silva-Olivares et al 2003; Korean, Lei.e., 2005). Thus, laccases have much more research value than peroxidases (lignin peroxidase EC 1.11.1.13 and manganese-dependent peroxidase EC 1.11.1.14) in lignin-degrading enzymes (Wangle 2011). Laccase has been found to be associated with the pathogenicity and detoxification mechanisms of conidia (Johannes and Majcherczyk 2000; Larson et al 1992). For this reason, laccases are also recognized as virulence factors for many fungal diseases and defense factors against phytoalexins and the like (Lidecheng, 2003).

Insect laccases are mainly classified into laccase 1(lac1) and laccase 2(lac2) according to the physiological role of the enzyme. lac1 is distributed in various tissues and organs of insects, such as salivary gland, midgut, and Malpighian; while lac2 is mainly distributed in tissues such as epidermis and egg shell. Among these, lac2 has been shown to be involved in tanning of the stratum corneum and studies on the insect laccase lac1 speculate that this enzyme is mainly involved in detoxification of food. These are often due to different insect species, and the biological functions of laccases of different animal origin are unknown.

Disclosure of Invention

In view of the above, the invention aims to provide Monochamus alternatus (Monochamus alternatus Hope) source laccase protein Ma-Lac1, an encoding gene and application thereof, wherein the Monochamus alternatus (Monochamus alternatus Hope) source laccase protein Ma-Lac1 has high capacity of degrading lignocellulose.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides monochamus alternatus endogenous laccase protein Ma-Lac1 which has an amino acid sequence shown as SEQ ID No.1 in a sequence table.

The invention provides an encoding gene of monochamus alternatus endogenous laccase protein Ma-Lac1, which has a nucleotide sequence shown as SEQ ID No.2 in a sequence table.

The invention provides a primer for amplifying the coding gene, which comprises a 5 'RACE primer and a 3' RACE primer; the 5' RACE primer comprises a primer GSP1, a primer GSP1 and a primer GSP 3;

the primer GSP1 has a nucleotide sequence shown as SEQ ID No.3 in the sequence table;

the primer GSP2 has a nucleotide sequence shown as SEQ ID No.4 in the sequence table;

the primer GSP3 has a nucleotide sequence shown as SEQ ID No.5 in the sequence table;

the 3 ' RACE primer comprises 3 ' 978-1 and 3 ' 978-2;

the 3' 978-1 has a nucleotide sequence shown as SEQ ID No.6 in the sequence table;

the 3' 978-2 has a nucleotide sequence shown as SEQ ID No.7 in the sequence table.

The invention provides a recombinant plasmid containing the coding gene.

The invention provides a recombinant strain, which comprises the recombinant plasmid.

The invention provides application of the monochamus alternatus endogenous laccase protein Ma-Lac1 or the recombinant strain in degradation of lignocellulose.

Preferably, the degradation temperature is 25-45 ℃.

Preferably, the pH value of the degradation process is 2.8-6.8.

Preferably, the concentration of the lignocellulose in the degradation process is 100-120 mmol/L.

The invention provides monochamus alternatus endogenous laccase protein Ma-Lac1 which has an amino acid sequence shown as SEQ ID No.1 in a sequence table. The monochamus alternatus endogenous laccase protein Ma-Lac1 is a protein containing 687 amino acids, the molecular weight of the protein is 78.26kDa, and the isoelectric point is 5.30. The atomic composition of Malac-1 protein is C₃₄₉₇H₅₃₀₂N₉₄₀O_1039S35The instability coefficient is 31.69. The fat index was 80.26 and the overall average hydrophilicity was-0.313. The Malac-1 gene coding protein has 2 transmembrane domains and 1 suspected transmembrane domain. Each transmembrane domain has 17-18 amino acid residues. The main backbone constituting the protein is a random coil. The monochamus alternatus endogenous laccase has high enzyme activity for degrading lignocellulose, and through determination, the enzyme activity of monochamus alternatus endogenous laccase protein Ma-Lac1 is 112.35U/mg.

Drawings

FIG. 1 is an electrophoretogram of the full-length cDNA sequence of the gene encoding Ma-lac1 in example 1;

FIG. 2 is the Malac-1 hydrophobicity/hydrophilicity curves of example 1;

FIG. 3 is a diagram showing transmembrane structure prediction of Malac-1 protein in example 1;

FIG. 4 shows prediction of the tertiary structure of Malac-1 protein in example 1;

FIG. 5 shows the multiple alignment of the amino acid sequences of the Malac-1 encoding gene and partial plant Malac gene of example 1; wherein fig. 5-1 is a result of multiple alignment of the amino acid sequences of MaLac-1 and a portion of the plant MaLac gene, fig. 5-2 is a result of multiple alignment of the amino acid sequences of MaLac-1 and a portion of the plant MaLac gene, fig. 5-3 is a result of multiple alignment of the amino acid sequences of MaLac-1 and a portion of the plant MaLac gene, fig. 5-4 is a result of multiple alignment of the amino acid sequences of MaLac-1 and a portion of the plant MaLac gene, fig. 5-5 is a result of multiple alignment of the amino acid sequences of the MaLac-1 encoding gene and a portion of the plant MaLac gene, fig. 5-6 is a result of multiple alignment of the amino acid sequences of MaLac-1 and a portion of the plant MaLac gene; FIGS. 5-7 show the results of multiple alignments of the amino acid sequences of Malac-1 and partial plant Malac genes, FIGS. 5-8 show the results of multiple alignments of the amino acid sequences of Malac-1 and partial plant Malac genes, FIGS. 5-9 show the results of multiple alignments of the amino acid sequences of Malac-1 and partial plant Malac genes, and FIGS. 5-10 show the results of multiple alignments of the amino acid sequences of Malac-1 and partial plant Malac genes;

FIG. 6 shows the amino acid sequence of Malac-1 protein in example 1 to construct a phylogenetic tree;

FIG. 7 is the expression profile of Malac-1 identified by qPCR in example 3 at different developmental stages of Monochamus alternatus.

Detailed Description

The invention provides monochamus alternatus endogenous laccase protein Ma-Lac1 which has an amino acid sequence shown as SEQ ID No.1 in a sequence table.

The invention uses ProtParam software and ProtScale software to predict physicochemical properties of protein such as molecular weight, isoelectric point, instability coefficient, hydrophobicity and the like, and results are shownNow: the monochamus alternatus endogenous laccase protein Ma-Lac1 is a protein containing 687 amino acids, the molecular weight of the encoded protein is 78.26kDa, and the isoelectric point is 5.30; atomic composition of C₃₄₉₇H₅₃₀₂N₉₄₀O₁₀₃₉S₃₅The instability coefficient is 31.69. The fat index was 80.26 and the overall average hydrophilicity was-0.313.

The invention uses TMpredServer software and MobyePortal software to predict the transmembrane structure and topological structure of target gene coding protein, and the result shows that: the Malac-1 gene coding protein has 2 transmembrane domains and 1 suspected transmembrane domain. Using the SOPMA software and the Swiss-model software to predict the secondary structure and the tertiary structure of the protein encoded by the target gene, it was found that: each transmembrane domain has 17-18 amino acid residues, and the main framework constituting the protein is a random coil.

The invention provides an encoding gene of monochamus alternatus endogenous laccase protein Ma-Lac1, which has a nucleotide sequence shown as SEQ ID No.2 in a sequence table.

The invention provides a primer for amplifying the coding gene, wherein the primer comprises a 5 'RACE primer and a 3' RACE primer; the 5' RACE primer comprises a primer GSP1, a primer GSP1 and a primer GSP 3. The primer GSP1 has a nucleotide sequence shown as SEQ ID No.3 in the sequence table; the primer GSP2 has a nucleotide sequence shown as SEQ ID No.4 in the sequence table; the primer GSP3 has a nucleotide sequence shown as SEQ ID No.5 in the sequence table. The 3 ' RACE primer comprises 3 ' 978-1 and 3 ' 978-2. The 3' 978-1 has a nucleotide sequence shown as SEQ ID No.6 in the sequence table. The 3' 978-2 has a nucleotide sequence shown as SEQ ID No.7 in the sequence table.

In the invention, the full-length sequence of the encoding gene of the monochamus alternatus endogenous laccase protein Ma-Lac1 is preferably obtained by amplifying by using an RACE method, and the method comprises the following steps:

a. respectively amplifying total RNA extracted from the intestinal tract of Monochamus alternatus by using a 5 'RACE primer and a 3' RACE primer to respectively obtain a 5 'end PCR product and a 3' end PCR product;

b. sequencing the 5 'end PCR product and the 3' RACE PCR product to obtain a sequencing result;

c. comparing and analyzing the sequencing result to verify the transcriptome sequence to obtain 5 'RACE and 3' RACE sequence information;

d. according to the sequence information of the 5 'RACE and the 3' RACE, the full-length cDNA sequence of the Ma-lac1 gene is obtained by utilizing the VectorNTI10.3.0 software for splicing.

The method for extracting total RNA is not particularly limited in the present invention, and a total RNA extraction method well known in the art may be used. In the embodiment of the invention, the total RNA extraction method adopts a kit method.

In the present invention, the method for amplifying by using 5' RACE primer, preferably by using kit method, comprises the following steps:

(1) synthesizing the first strand cDNA of the target gene of the total RNA by using Superscript II RT enzyme and a primer GSP1, and purifying the cDNA treated by the RNAase by using a DNA Purification System, GLASSMAX DNA isolation spin card to obtain purified cDNA;

(2) subjecting the purified cDNA to end-up poly-C using TdT enzyme and dCTP to obtain dC tailed cDNA;

(3) and (3) carrying out PCR first round amplification on cDNA added with dC tail by using a primer GSP-2 and a bridging rivet primer AAP in the inner surface of the kit, then carrying out nested PCR second round amplification by using a primer GSP-3 and a bridging universal amplification primer AUAP in the inner surface of the kit, and finally recovering and purifying the target fragment to obtain a 5' end PCR product.

In the present invention, the method of amplification using 3' RACE primers preferably comprises the following steps

A. Using reverse transcriptase SMARTScribe^TMReverse transcription of total RNA to synthesize cDNA with Reverse Transcriptase and primer 3' CDS primer A;

B. performing first round PCR amplification by using the synthesized cDNA as a template by using a primer 3' 978-1 and UPM to obtain a first round PCR amplification product;

C. and (3) diluting the first round PCR amplification product by 50 times, performing second round PCR amplification on the diluted first round PCR amplification product by using a primer 3 '978-2 and UPM, and performing electrophoresis recovery and purification on the obtained second round PCR product to obtain a 3' end PCR product.

The present invention does not require any special splicing method known in the art.

The invention provides a recombinant plasmid, which comprises a vector plasmid and the coding gene.

The vector plasmid of the recombinant plasmid is not particularly limited in the present invention, and any plasmid known in the art may be used. In the embodiment of the invention, the vector plasmid adopts pMD 18T. The method for constructing the recombinant plasmid is not particularly limited in the present invention, and any method known in the art may be used.

The invention provides a recombinant strain, which comprises a recombinant plasmid of a vector strain.

The present invention is not particularly limited in the kind of the vector strain of the recombinant strain, and a recombinant strain well known in the art may be used. In an embodiment of the invention, the vector strain is escherichia coli. The method for constructing the recombinant strain is not particularly limited in the present invention, and a method for constructing a recombinant strain known in the art may be used.

The invention provides the monochamus alternatus endogenous laccase protein Ma-Lac1 and application of the recombinant strain in degradation of lignocellulose.

In the present invention, the method for degrading lignocellulose preferably comprises the following steps:

mixing 120 mu L of sodium acetate buffer solution, 30 mu L of lignocellulose solution and 50 mu L of monochamus alternatus endogenous laccase protein Ma-Lac1 or the recombinant strain, performing enzymolysis at 25-55 ℃, determining the light absorption value of the enzymolysis mixed solution at 420nm, determining the light absorption value once every 5min, and reacting for 1 h.

In the invention, the temperature of degradation is preferably 35-50 ℃, and more preferably 45 ℃.

In the invention, the pH value of the degradation process is preferably 2.8-6.8, more preferably 3.6-5.2, and most preferably 4.4.

In the invention, the concentration of the lignocellulose in the degradation process is preferably 100-120 mmol/L, and more preferably 110 mmol/L. The mass of the lignocellulose is preferably 10 g/L.

The endogenous laccase protein Ma-Lac1 of Monochamus alternatus, the encoding gene and the application thereof provided by the invention are described in detail by the following examples, but the invention is not to be construed as being limited by the scope of the invention.

Example 1

Sample collection

The Chinese red pine insect pest wood is collected from Town (N26.150 degree; E119.593 degree) in Lianjiang province, Fujian province, and is sawn into wood sections with the length of about 1m, and the wood sections are placed in an insect breeding cage with the length of 1.5m, the width of 1.5m and the height of 1.0m, and the insect breeding cage is sealed by an iron sand net with the net diameter smaller than 2 mm. The larva and pupa are directly collected from the gallery and pupa chamber of Monochamus alternatus larva in the damaged lignum Pini nodi section, and the imago is collected from the imago which has just emerged in the insect cage.

RNA extraction procedure and results

1.1 ml Trizol were added and after homogenization the Trizol/tissue mixture was left at room temperature for 5min so that the sample was sufficiently lysed by Trizol.

1.2 Add 200. mu.l chloroform (chloroform) per 1ml Trizol lysed sample.

1.3 cover the tube cover tightly and shake the tube cover up and down for 15 seconds. Standing at room temperature for 3 min. Centrifuge at 12000g for 15min at 4 ℃.

1.4 after centrifugation, the tube contents will be stratified, transferring the uppermost colorless liquid (about 50% of the total volume) to a new RNase-free EP tube. Note that: tens of millions cannot suck the liquid in the lower layer and the white precipitate suspended in the middle. During the suction, the EP tube was tilted at an angle of 45 °.

1.5 to the new supernatant liquid 500. mu.l of 100% isopropanol were added. Standing at room temperature for 10 min. Centrifugation was carried out at 12000g for 10min at 4 ℃. Note that: when the centrifuge tube is placed, the tube handle is uniformly outward, and after centrifugation, RNA is precipitated at the bottom of one side of the tube handle.

1.6 carefully aspirate the supernatant and add 75% ethanol. (75% ethanol to DEPC water preparation) up and down reverse eight times, 7500g, 4 degrees C centrifugal 5 min.

1.7 after removing the ethanol, opening the cover and standing for 5-10min at room temperature to obtain the purified RNA.

1.8 the agarose electrophoresis detection after the DEPC water dissolution is shown in figure 1-1, wherein MARKER is DL 2000.

Synthesis of first Strand of cDNA

(RevertAId First Strand cDNA Synthesis Kit from Fermentas Co., Ltd.) was used

2.1 Add 1ug of total RNA, and 1ul of 100uM oligo (dT) primer to RNase-free PCR tube and bring to a volume of 12ul with DEPC treated sterile water.

2.2 the mixture was treated at 65 ℃ for 5 minutes and then immediately cooled on ice for 1 minute.

2.3 then 4ul of 5X reaction buffer, 1ul of RiboLock RNase Inhibitor (20 u/. mu.l), 2ul of 10mM dNTPmix, and 1ul of Reversaid M-MuLV Reverse Transcriptase (200 u/. mu.l) were added to the reaction mixture in this order.

2.4 mix gently and centrifuge briefly.

2.5 incubation at 42 ℃ for 1 hour on a PCR instrument.

The reaction was terminated by giving 5 minutes at 2.670 ℃.

3. Transcriptome sequence validation

3.1 design and sequence of primers

The design of experimental primers was verified using the transcriptome sequences provided by the customers and the Primer Premier 5.0 software, and synthesized by Biotechnology engineering (Shanghai) Ltd.

Table 1 verification of primer names and sequences

Primer name	Sequence (5 'to 3')
		A409F	CATTAAATGGATGGAACAATG(SEQIDNo.8)
A409R2	GCTTTATGGAAGTGAGGATTGT(SEQIDNo.9)

3.2 PCR reaction System and conditions

Table 2 verification of PCR reaction System

Table 3 verification of PCR reaction conditions

3.3 recovery and purification of the fragment of interest

And (3) carrying out electrophoresis on the PCR product in 1.0% agarose gel, adjusting the voltage to 120V, carrying out electrophoresis for 0.5h, recording the electrophoresis result by photographing, observing under an ultraviolet lamp, and quickly cutting off a target band. Recovering the target fragment with gel recovery kit (OMEGA), and performing the specific method according to kit instructions. The electrophoresis detection result of the target fragment is shown in FIG. 1-2, wherein MARKER is DL 2000.

3.4 cloning and sequencing of fragments of interest

The purified PCR product was ligated with pMD18T, and positive clones were sequenced after transformation, with the following results:

>A409FR0-5-34_M13R(-48)_TSS20160701-027-0144_H02,A409F2R2_A40 9F2_TSS20160630-027-4423_G09

CATTAAATGGATGGAACAATGTTTTTGGTAGTTTCGCTTTTCGTTATT GGCACTGTTAGGGCAAACGTTGTTTACAATGAAGAACAAACAGATAACC AAACCGCCACAGACGTACACCTGGAATACGTTCTTTTAAATGAAGACAA TCCTTGTGCCAGGACTTGCATAGAGGGAGCCTCTCCGATGATTTGTCGGT ACCACTTCAAAATAGAGTGGTACCATACGCTCAGCAAGGCTTGCTATGAT TGTCCATTCAATACTAGCGATTGTTTTCGACAGGACTGCGTGCCAGGGGA TGGTTACAAGAGGGCTGTGGTTACTGTTAACAGACAAATTCCCGGACCA ACTATAGAGGTATGCCAAGGAGACATCATCGTCGCTGATGTCACAAACAT GCTGGGTAGTGAAGGAACAACCATCCACTGGCACGGACAACACCAAAA AAACACTCCTTATATGGACGGCGTGCCTTACGTGACTCAATGCCCTATTC TACCCCATGATACCTTCAGGTACACCTTCAAAGCCATACAGGCTGGAAC GCATTTTTGGCATTCTCATATAGGTATGCAAAGAGCTGATGGGGCCTTTG GAGCTTTTATCGTAAGGGTACCAGAAGAACAGGACCCCCATTTCCAATT CTACGACTACGACCTGGCTGCTCACGTGATTACAGTGCTGGATCGGGAG AAAGAAACGGGATTGGAAAAGTTTTTGGCCCATCACCATAACGATGCTG ATAACAAACCTACGACTTTGCTGGTGAATGGATTAGGAAGATTTGTAGAA TTTGACGATGGGTCGAATAGCACCGTGTATATCCCTACAGCTAGATTTAA GGTGGAGCAGGGTTATCGATACAGATTTAGAGTAATAAACGCTGGATTCT TGAATTGCCCTATAGAAATTTCAGTGGATAATCATACCATAAAGGTTATCA GTACAGATGGTAGTGACGTCGCACCAACCGATGCCACGTCCCTGGTGAC CTATGCCGGCGAACGTTTCGACTTCGTCCTCAACGCCGATCAGGACAAA GCCCTGTACTGGATTCGTTTTAGGGGCCTTATGGATTGTGACGAGAGGTT CAAACGCGCCCATCAAGTGGCTGTGCTAGAATACGACGGACTCAACACG ACGATGGACGACTATCCTGAAGGAGTAACCGATTATGACACCTCCCATC GAGATGGCACGCAAATAAATGCATTGAATCGAGGGGTTGAGAGCAATTC GACATACATCAGTATGCCTCAGCTCGAATCATTGGAAAAATGGGATACTT CCTTAAAATCAACGCCTGATATTCAGTATTATATAGCTTACGACTTTTATAA ACTAAACAATCCTCA(SEQ ID No.10)。

4.5' RACE experiment

4.1 design and sequence of primers

Using the transcriptome sequencing verification results, three specific 5' RACE primers were designed using Primer Premier 5.0 software and synthesized by Biotechnology engineering (Shanghai) GmbH.

Table 4: 5' RACE primer name and sequence

Primer name	Sequence (5 'to 3')
		A409-1(GSP1)	CAAGTCCTGGCACAAG(SEQIDNo.3)
A409-2(GSP2)	GCGGTTTGGTTATCTGTTTG(SEQIDNo.4)
		A409-3(GSP3)	CGTTTGCCCTAACAGTGC(SEQIDNo.5)

4.2 Synthesis of first Strand cDNA of the Gene of interest

Total RNA was subjected to first strand cDNA synthesis of the target gene using SUPERSCRIPT II RT enzyme and primer GSP-1, and the synthesized cDNA was subjected to RNA removal treatment using RNase Mix.

1.) was added as follows:

volume of the components

GSP1....................................2.5pmoles(～10to 25ng)

.

DEPC-treatedwater.......................15.5μl

2.) incubation of the mixture at 70 ℃ for 10 minutes and cooling on ice for 1 minute. Briefly centrifuged and added as follows:

volume of the Components (μ l)

.

25mM MgCl₂...............................2.5

10mM dNTP mix............................1

0.1M DTT.................................2.5

.

The final volume was 24. mu.l.

3.) gentle mixing and centrifugation, 42 ℃ temperature 1 minutes.

4.) add 1. mu.l of OfSUPERSCRIPT II RT and incubate at 42 ℃ for 50 minutes.

5.) incubation at 70 ℃ for 15 minutes.

6.) briefly centrifuged and reacted at 37 ℃.

7.) add 1. mu.l RNase mix, mix briefly for 30 minutes at 37 ℃, centrifuge briefly and place on ice.

4.3 purification of the RNAase-treated cDNA Using the DNAPROFICATION System, GLASSMAX DNAssolation spin cards.

1.) cool the solution to room temperature.

2.) for each sample, equilibrate to 100 microliters of sterile distilled water, at 65 ℃, for use in step 9.

3.) reaction of the first chain with addition of 120. mu.l of binding solution (6M sodium iodide).

4.) transfer the gene/sodium iodide solution to a GLASSMAX spin bowl. Centrifuge 13,000 Xg 20 seconds.

5.) transfer of the solution to a centrifuge tube. The solution was stored until the cDNA was confirmed.

6.) add 0.4 ml of cold (4 ℃)1 Xwash buffer to the spin bowl. 13000 Xg for 20 seconds. The transudate liquid was discarded. This washing step was repeated three times.

7.) Wash the cartridge twice with 400 μ l cold (4 ℃) 70% ethanol as described in step 6.

8.) remove the last 70% ethanol and centrifuge for 1 min at 13,000 Xg.

9.) the spin basket is inserted into a new sample recovery tube. Add 50. mu.l sterile distilled water (pre-heated to 65 ℃ C.). Centrifugation was performed at 13,000 Xg for 20 seconds to elute the cDNA.

4.4 terminating the purified cDNA with poly-C using TdT enzyme and dCTP

1.) Mild addition of the following system:

volume of the Components (μ l)

DEPC-treatedwater......................................6.5

.

2mM dCTP...............................................2.5

.

.

2.)94 ℃ for 2-3 minutes, ice cooling for 1 minute, placed on ice.

3.) 1. mu.l of TdT was added and incubated at 37 ℃ for 10 minutes.

4.) TdT was inactivated by heating at 65 ℃ for ten minutes and briefly centrifuged on ice.

4.5 first round PCR amplification of dC tailed cDNA was performed using primer GSP-2 and bridging rivet primer AAP in the inner band of the kit.

1.) thermal cycler set-up 94 ℃.

2.) to a 0.2or 0.5-ml thin-wall PCR tube the following system was added and placed on ice:

volume of the Components (μ l)

The

.

25mM MgCl₂.............................................3.0

10mM dNTP mix..........................................1.0

A.9.0.. 9.... 9.0.. 9.. like a solution, a solution of steel, GSP2(10 μ M)

AbridgedAnchorPrimer(10μM).............................2.0

dC-tailed cDNA.........................................5.0

Taq DNApolymerase(5units/μl)...........................0.5

A

The PCR reaction was performed with the following procedure:

TABLE 5 PCR reaction conditions

Pre-denaturation	94℃ 2min
		35 number of cycles	94℃ 30sec 55℃ 30s 72℃ 1min
	72℃ 10min

4.6 nested PCR second round amplification Using primer GSP-3 and bridged Universal amplification primer AUAP in the inner band of the kit

The PCR system was as follows:

volume of the Components (μ l)

.

.

25mM MgCl₂.............................................3.0

10mM dNTP mix..........................................1.0

A.9.9.9.1.0.3.9.9.1.9.1.9.1.9.1.1.2.1.1.2.1.1.2.1.1.2.1.1.2.1.1.2.1.1.2.1.2.1.1.2.1.1.2.1.1.2

AUAP orUAP(10μM).......................................1.0

The

.

.

4.7 recovery and purification of the fragment of interest

And (3) performing electrophoresis on the second round PCR product, and performing gel cutting, recovery and purification on a target band, wherein the steps are performed according to the specification of a recovery kit, and the electrophoresis detection result is shown in figures 1-3, wherein the Marker is DL 2000.

4.8 cloning and sequencing of fragments of interest

The purified PCR product was ligated with pMD18T, and positive clones were sequenced after transformation, with the following results:

>A409-5-11_M13R(-48)_TSS20160714-027-2064_D06

GGCCACGCGTCGACTAGTACGGGGGGGGGGGGGGGGGTTTGCCGG TTACTTTTTAATCGCTTGAGTTTTATATTCTTCAGGCCACCATTTGTCCTG ACTCTTTTTGTCGTCTATTATGATTCTATTAATTATATATTCTTTTTGCAGAT GGAACAATGTTTTTGGTAGTTTCGCTTTTCGTTATTGGCACTGTTAGGGC AAACG(SEQ ID No.11)

5.3' RACE experiment

5.1 design and sequence of primers

Using the results of the transcriptome sequencing verification, two specific 3' RACE primers were designed using PrimerPremier 5.0 software and synthesized by Biotechnology engineering (Shanghai) Inc.

TABLE 63' RACE primer names and sequences

Primer name	Sequence (5 'to 3')
		3’978-1	TGGAGACTATTTGCCTGAACTGACACAC(SEQ ID No.6)
3’978-2	ACAAGTGCAAAGACTGCAATAATGCTCC(SEQ ID No.7)

5.2 Experimental methods and results

1.) use of reverse transcriptase SMARTScribe^TMReverse Transcriptase and primer 3' CDS primer A reverse transcription of total RNA to synthesize cDNA.

2.) first round of PCR amplification was performed using primers 3' 978-1 and UPM, using the cDNA synthesized above as template.

3.) the first round PCR amplification product was diluted 50-fold, and then a second round PCR amplification was performed with primer 3' 978-2 and UPM.

4.) performing electrophoresis on the second round PCR product, and performing gel cutting, recovery and purification on the target band, wherein the electrophoresis result is shown in figures 1-4, and the Marker is DL 2000.

5.) the purified PCR product was ligated to pMD18T, transformed and sent to the Shanghai Producer for direct sequencing, with the following results:

>WH16051600891(3#978-2-11)M13-_J_B10

ACAAGTGCAAAGACTGCAATAATGCTCCAGTAATTAAAACAGTTTC GTTATATATTATTGTTTCATTATTAGCAAGCATTCATTTAAGTTAGTTTAAG TCATGTTAATGTTACTTTTGGAGACATGTGCCTTCATATGAATATATAGAC TGATTTAAACATAGTTTAATTTAGGAAAATCGAAATATATTTGTTATGTAAT ATATTATGTTTAATTAATTGTTATTGTAATAATGAATTCTCTCTAAATATAAT TTTCATAAACTGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA(SEQ ID No.12)。

third, gene full-length splicing and ORF prediction result

According to the transcriptome sequence verification, 5 'RAEC and 3' RACE results, the full-length cDNA sequence of the target gene of the experiment is spliced, and then the positions of the start codon and the stop codon of the gene are predicted through NCBI comparison analysis. Results are shown in SEQ ID No. 2.

Three specific 5 'RACE primers and two specific 3' RACE primers are respectively designed by using a transcriptome sequencing verification result, then a cDNA first chain is used as a template, PCR amplification cloning sequencing is carried out by using the primers, and finally a full-length cDNA sequence of the Ma-lac1 gene with the length of 2390bp is spliced, wherein the length of the coding region is 2062 bp.

1.2.4 bioinformatic analysis of the Ma-lac1 Gene of Monochamus alternatus

The amino acid sequence encoded by the sequenced target gene was predicted by DNAMAN software, and the longest open reading frame of the Meadowra mataire Ma-lac1 gene was predicted using the ORF Finder. Other insect lac1 genes were searched for amino acid sequences using NCBI online Blast, and multiple sequence alignments were performed using clustalx2.1 software, and evolutionary trees were constructed using MEGA6.0 software. Using ProtParam software and ProtScale software to predict physicochemical properties such as molecular weight, isoelectric point, instability coefficient, hydrophobicity and the like of the target gene encoding protein; predicting the transmembrane structure and topological structure of the target gene coding protein by using TMpredServer software and MobyePortal software; the secondary and tertiary structures of the protein encoded by the gene of interest were predicted using SOPMA software and Swiss-model software.

The Malac-1 gene encodes 1 protein containing 687 amino acids, the molecular weight of the encoded protein is 78.26kDa, and the isoelectric point is 5.30. The atomic composition of the polypeptide encoded by the Malac-1 gene is C3497H5302N940O1039S35, and the instability coefficient is 31.69, which indicates that the polypeptide is a stable protein molecule. The fat coefficient of the Malac-1 gene is 80.26, the total average hydrophilicity is-0.313, and the analysis of ProtParam software shows that the Malac-1 gene coded protein contains more hydrophilic regions, which indicates that the Malac-1 coded protein is hydrophilic protein (figure 2).

The transmembrane region analysis of the Malac-1 gene coding protein by using online TMpred software shows that the Malac-1 gene coding protein has 2 transmembrane domains and 1 suspected transmembrane domain (figure 3). Each transmembrane domain has 17-18 amino acid residues. The structure of the protein coded by the Malac-1 gene is analyzed by using SOPMA software and Swiss-model software, and the result shows that 3.1 percent of the secondary structure of the protein is alpha-helix related to the function of the protein, 27.8 percent of the secondary structure of the protein is beta-sheet related to the function of the protein, and 69.1 percent of the secondary structure of the protein is irregular curve related to the function of the protein; the major backbone constituting the protein in the tertiary structure is random coil. (FIG. 4).

1.2.5 alignment of Monochamus alternatus laccase protein Ma-lac1 protein with other known insect laccase gene sequences and phylogenetic analysis

(1) Gene similarity analysis

The Malac-1 gene and other insect Malac gene-encoding amino acid sequences obtained by Blast were subjected to multiple alignments using ClustalX2.1 software, and phylogenetic analyses of Malac genes derived from 10 insect species, including Malac-1 gene, were performed using MEGA4.0 software (FIGS. 5 and 6). The results show that the Malac-1 gene encoding product has 90% homology with Malac gene of anoplophora glabripennis (Anoplophorus glabripennis), and has more than 60% homology with amino acids encoded by Malac gene of other insects. Wherein in FIG. 5, FIGS. 5-2 and FIGS. 5-10 show 2 transmembrane regions.

Other insect species selected when constructing phylogenetic trees include Apis mellifera italica; apis cerana; apis dorsa Apis mellifera; eufriesea mexicana bees; bombus terrestris Bombus; pseudogyrmex gracilis ants; cephus cinctus bees; macrotermes barneyi termites; nicophorus vespilloides tibetaceae; photinus pyralis; aethina tubida apis cerana; tribolium castaneum Tribolium; dendroctonus ussuriensis beetle in Dendroctonus aspenderosa; anophophora glabrapennis anomala; papilioxithus citrus Papilio; papiliopolytes Papiliopolicus Papilio; helicoverpa armigera cotton bollworm; manduca sexta tobacco hornworm; parge aegeria spotted butterfly.

1.2.6 Monochamus alternatus Ma-lac1 gene real-time fluorescent quantitative PCR

And detecting the expression difference of the laccase gene in intestinal tracts of the young, the old, the pupa, the female imago and the male imago of the Monochamus alternatus by adopting real-time fluorescent quantitative PCR. Real-time fluorescent quantitative PCR was performed on an Agilent Stratagene fluorescent quantitative PCR instrument Mx3000P, and the fluorescent dye was SYBR Green PCR Master Mix from Takara, with the upstream primer being 5'-TCCTAATCCATTCACCAGCAA-3' (SEQ ID No.13) and the downstream primer being 5'-GGTACACCTTCAAAGCCATACA-3' (SEQ ID No. 14). The gapdh gene was used as the reference gene with its upstream primer 5'-AGAAAGTTATTATCTCCGCTCCA-3' (SEQ ID No.15) and downstream primer 5'-CCATACCAGTTAGTTTGCCATT-3' (SEQ ID No. 16). The PCR reaction program is pre-denaturation at 95 ℃ for 2 min; denaturation at 94 ℃ for 20s, annealing at 58 ℃ for 20s, and extension at 72 ℃ for 30s, for 40 cycles. Analysis of melting curve: the temperature is 65-95 ℃. All the above experiments were set up for 3 biological replicates.

The results of the differential expression of the Ma-lac1 gene of Monochamus alternatus follows

The method performs data processing. Wherein Δ Ct is the mean value of (target gene Ct-internal reference Ct) ± standard deviation; delta Ct (mean value of target gene delta Ct in the sample to be tested-target gene delta Ct in the reference sample) ± standard deviation (if no reference sample is available, the sample with the largest Ct is selected as the reference for calculation);

mean ± standard deviation of (d).

The results are shown in FIG. 7. 1-1 low-age larva, 1-2 low-age larva, 1-3 low-age larva, 2-1 high-age larva, 2-2 high-age larva, 2-3 high-age larva, 3-1 pupa, 3-2 pupa, 3-3 pupa, 4-1,4-2,4-3 are all female imagoes; 5-1,5-2,5-3 are all male adults.

And (4) conclusion: the expression level of the Ma-Lac1 gene is higher in the pupal stage and the adult stage, which indicates that the laccase gene is possibly related to blackening reaction and insect epidermis ossification when the longicorn enters the adult stage from the pupal stage.

Example 2

Enzyme activity reaction system of laccase Lac

120u L sodium acetate buffer (pH 5) +30 μ LABTS (final concentration 100mmol/L) +50 μ L enzyme solution (recombinant expression by prokaryotic expression system), adding into enzyme labeling instrument, measuring light absorption value every 5min at 420nm, and reacting for 1 h. The change in OD per hour of the catalytic reaction system per 50. mu.l of the enzyme solution was defined as 1 unit of enzyme activity (U), and the enzyme activity was calculated as (treatment OD-control OD).

The laccase activity was determined to be 112.35U/mg.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Fujian agriculture and forestry university

<120> Monochamus alternatus endogenous laccase protein Ma-Lac1, coding gene and application thereof

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 687

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Phe Leu Val Val Ser Leu Phe Val Ile Gly Thr Val Arg Ala Asn

1 5 10 15

Val Val Tyr Asn Glu Glu Gln Thr Asp Asn Gln Thr Ala Thr Asp Val

20 25 30

His Leu Glu Tyr Val Leu Leu Asn Glu Asp Asn Pro Cys Ala Arg Thr

35 40 45

Cys Ile Glu Gly Ala Ser Pro Met Ile Cys Arg Tyr His Phe Lys Ile

50 55 60

Glu Trp Tyr His Thr Leu Ser Lys Ala Cys Tyr Asp Cys Pro Phe Asn

65 70 75 80

Thr Ser Asp Cys Phe Arg Gln Asp Cys Val Pro Gly Asp Gly Tyr Lys

85 90 95

Arg Ala Val Val Thr Val Asn Arg Gln Ile Pro Gly Pro Thr Ile Glu

100 105 110

Val Cys Gln Gly Asp Ile Ile Val Ala Asp Val Thr Asn Met Leu Gly

115 120 125

Ser Glu Gly Thr Thr Ile His Trp His Gly Gln His Gln Lys Asn Thr

130 135 140

Pro Tyr Met Asp Gly Val Pro Tyr Val Thr Gln Cys Pro Ile Leu Pro

145 150 155 160

His Asp Thr Phe Arg Tyr Thr Phe Lys Ala Ile Gln Ala Gly Thr His

165 170 175

Phe Trp His Ser His Ile Gly Met Gln Arg Ala Asp Gly Ala Phe Gly

180 185 190

Ala Phe Ile Val Arg Val Pro Glu Glu Gln Asp Pro His Phe Gln Phe

195 200 205

Tyr Asp Tyr Asp Leu Ala Ala His Val Ile Thr Val Leu Asp Trp Glu

210 215 220

Lys Glu Thr Gly Leu Glu Lys Phe Leu Ala His His His Asn Asp Ala

225 230 235 240

Asp Asn Lys Pro Thr Thr Leu Leu Val Asn Gly Leu Gly Arg Phe Val

245 250 255

Glu Phe Asp Asp Gly Ser Asn Ser Thr Val Tyr Ile Pro Thr Ala Arg

260 265 270

Phe Lys Val Glu Gln Gly Tyr Arg Tyr Arg Phe Arg Val Ile Asn Ala

275 280 285

Gly Phe Leu Asn Cys Pro Ile Glu Ile Ser Val Asp Asn His Thr Ile

290 295 300

Lys Val Ile Ser Thr Asp Gly Ser Asp Val Ala Pro Thr Asp Ala Thr

305 310 315 320

Ser Leu Val Thr Tyr Ala Gly Glu Arg Phe Asp Phe Val Leu Asn Ala

325 330 335

Asp Gln Asp Lys Ala Leu Tyr Trp Ile Arg Phe Arg Gly Leu Met Asp

340 345 350

Cys Asp Glu Arg Phe Lys Arg Ala His Gln Val Ala Val Leu Glu Tyr

355 360 365

Gly Gly Leu Asn Thr Thr Met Asp Asp Tyr Pro Glu Gly Val Thr Asp

370 375 380

Tyr Asp Thr Ser His Arg Asp Gly Thr Gln Ile Asn Ala Leu Asn Arg

385 390 395 400

Gly Val Glu Ser Asn Ser Thr Tyr Ile Ser Met Pro Gln Leu Glu Ser

405 410 415

Leu Glu Lys Trp Asp Thr Ser Leu Lys Ser Thr Pro Asp Ile Gln Tyr

420 425 430

Tyr Ile Ala Tyr Asp Phe Tyr Lys Leu Asn Asn Pro His Phe His Lys

435 440 445

Ala Pro Tyr Tyr Gly Phe Asn Asn Ile Ser Asp Val Asn Leu Arg Leu

450 455 460

Leu Thr Pro Gln Phe Asn His Ile Ser Met Lys Thr Pro Pro Phe Pro

465 470 475 480

Leu Leu Pro Gln Arg Asn Glu Ile Thr Lys Asp Met Phe Cys Asn Lys

485 490 495

Asp Thr Met Lys Asp Ile Asp Cys Val Glu Asn Tyr Cys Glu Cys Pro

500 505 510

His Gly Leu Asn Val Pro Leu Asp Ala Val Val Glu Leu Ile Phe Val

515 520 525

Asp Glu Gly Phe Ala Tyr Asp Ala Asn His Pro Leu His Ile His Gly

530 535 540

Tyr Asn Phe Arg Ile Val Ala Met Glu Arg Leu Gly Lys Asn Val Thr

545 550 555 560

Val Glu Glu Val Gln Arg Arg Asp Arg Gln Gly Leu Ile Lys Arg Asn

565 570 575

Leu Leu Asp Ala Pro Leu Lys Asp Thr Val Thr Val Pro Asp Gly Gly

580 585 590

Tyr Thr Ile Val Arg Phe Val Ala Ser Asn Pro Gly Tyr Trp Ile Phe

595 600 605

His Cys His Ile Glu Phe His Thr Glu Ile Gly Met Ala Leu Val Leu

610 615 620

Lys Val Gly Glu Asp His Asp Met Leu Pro Val Pro Gln Asn Phe Pro

625 630 635 640

Arg Cys Gly Asp Tyr Leu Pro Glu Leu Thr His Cys Glu Gly Asp Asn

645 650 655

Cys Asp Asn Lys Cys Lys Asp Cys Asn Asn Ala Pro Val Ile Lys Thr

660 665 670

Val Ser Leu Tyr Ile Ile Val Ser Leu Leu Ala Ser Ile His Leu

675 680 685

<210> 2

<211> 2390

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tttgccggtt actttttaat cgcttgagtt ttatattctt caggccacca tttgtcctga 60

ctctttttgt cgtctattat gattctatta attatatatt ctttttgcag atggaacaat 120

gtttttggta gtttcgcttt tcgttattgg cactgttagg gcaaacgttg tttacaatga 180

agaacaaaca gataaccaaa ccgccacaga cgtacacctg gaatacgttc ttttaaatga 240

agacaatcct tgtgccagga cttgcataga gggagcctct ccgatgattt gtcggtacca 300

cttcaaaata gagtggtacc atacgctcag caaggcttgc tatgattgtc cattcaatac 360

tagcgattgt tttcgacagg actgcgtgcc aggggatggt tacaagaggg ctgtggttac 420

ggttaacagg caaattcccg gaccaactat agaggtatgc caaggagaca tcatcgtcgc 480

tgatgtcaca aacatgctgg gtagtgaagg aacaaccatc cactggcacg gacaacacca 540

aaaaaacact ccttatatgg acggcgtgcc ttacgtgact caatgcccta ttctacccca 600

tgataccttc aggtacacct tcaaagccat acaggctgga acgcattttt ggcattctca 660

tataggtatg caaagagctg atggggcctt tggagctttt atcgtaaggg taccagaaga 720

acaggacccc catttccaat tctacgacta cgacctggct gctcacgtga ttacagtgct 780

ggattgggag aaagaaacgg gattggaaaa gtttttggcc catcaccata acgatgctga 840

taacaaacct acgactttgc tggtgaatgg attaggaaga tttgtagaat ttgacgatgg 900

gtcgaatagc accgtgtata tccctacagc tagatttaag gtggagcagg gttatcgata 960

cagatttaga gtaataaacg ctggattctt gaattgccct atagaaattt cagtggataa 1020

tcataccata aaggttatca gtacagatgg tagtgacgtc gcaccaaccg atgccacgtc 1080

tctggtgacc tatgccggcg aacgtttcga cttcgtcctc aacgccgatc aggacaaagc 1140

cctgtactgg attcgtttta ggggccttat ggattgtgac gagaggttca aacgcgccca 1200

tcaagtggct gtgctagaat acggtggact caacacgacg atggacgact atcctgaagg 1260

agtaaccgat tatgacacct cccatcgaga tggcacgcaa ataaatgcat tgaatcgagg 1320

ggttgagagc aattcgacat acatcagtat gcctcagctc gaatcattgg aaaaatggga 1380

tacttcctta aaatcaacgc ctgatattca gtattatata gcttacgact tttataaact 1440

aaacaatcct cacttccata aagcgccata ttacggattt aataatataa gtgatgtaaa 1500

tctaagactg ctcacacctc aattcaacca catttccatg aagacgccac cgtttcccct 1560

tcttcctcaa agaaatgaaa taaccaaaga catgttttgc aacaaggaca ctatgaaaga 1620

catagattgt gtcgaaaatt attgtgaatg tccacatggc ttgaatgtgc ccctggacgc 1680

cgtcgtcgaa ctgatctttg tcgacgaggg cttcgcctac gacgccaacc acccccttca 1740

catccacggc tataacttca ggatagttgc catggaaaga ttgggcaaaa acgtcaccgt 1800

ggaggaggtg cagcgcaggg acaggcaggg cctcatcaag aggaacctgc tggacgcccc 1860

tctcaaggac accgtcaccg tgcccgacgg ggggtacact attgtgagat tcgtggcgtc 1920

aaatccaggc tactggattt tccattgcca catagaattc cacacagaaa tcggcatggc 1980

cttggtatta aaagtagggg aagaccacga catgttgcca gttccccaga actttcctag 2040

atgtggagac tatttgcctg aactgacaca ctgtgaaggc gacaactgtg ataacaagtg 2100

caaagactgc aataatgctc cagtaattaa aacagtttcg ttatatatta ttgtttcatt 2160

attagcaagc attcatttaa gttagtttaa gtcatgttaa tgttactttt ggagacatgt 2220

gccttcatat gaatatatag actgatttaa acatagttta atttaggaaa atcgaaatat 2280

atttgttatg taatatatta tgtttaatta attgttattg taataatgaa ttctctctaa 2340

atataatttt cataaactga gaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2390

<210> 3

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

caagtcctgg cacaag 16

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcggtttggt tatctgtttg 20

<210> 5

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cgtttgccct aacagtgc 18

<210> 6

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tggagactat ttgcctgaac tgacacac 28

<210> 7

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

acaagtgcaa agactgcaat aatgctcc 28

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cattaaatgg atggaacaat g 21

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gctttatgga agtgaggatt gt 22

<210> 10

<211> 1352

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cattaaatgg atggaacaat gtttttggta gtttcgcttt tcgttattgg cactgttagg 60

gcaaacgttg tttacaatga agaacaaaca gataaccaaa ccgccacaga cgtacacctg 120

gaatacgttc ttttaaatga agacaatcct tgtgccagga cttgcataga gggagcctct 180

ccgatgattt gtcggtacca cttcaaaata gagtggtacc atacgctcag caaggcttgc 240

tatgattgtc cattcaatac tagcgattgt tttcgacagg actgcgtgcc aggggatggt 300

tacaagaggg ctgtggttac tgttaacaga caaattcccg gaccaactat agaggtatgc 360

caaggagaca tcatcgtcgc tgatgtcaca aacatgctgg gtagtgaagg aacaaccatc 420

cactggcacg gacaacacca aaaaaacact ccttatatgg acggcgtgcc ttacgtgact 480

caatgcccta ttctacccca tgataccttc aggtacacct tcaaagccat acaggctgga 540

acgcattttt ggcattctca tataggtatg caaagagctg atggggcctt tggagctttt 600

atcgtaaggg taccagaaga acaggacccc catttccaat tctacgacta cgacctggct 660

gctcacgtga ttacagtgct ggatcgggag aaagaaacgg gattggaaaa gtttttggcc 720

catcaccata acgatgctga taacaaacct acgactttgc tggtgaatgg attaggaaga 780

tttgtagaat ttgacgatgg gtcgaatagc accgtgtata tccctacagc tagatttaag 840

gtggagcagg gttatcgata cagatttaga gtaataaacg ctggattctt gaattgccct 900

atagaaattt cagtggataa tcataccata aaggttatca gtacagatgg tagtgacgtc 960

gcaccaaccg atgccacgtc cctggtgacc tatgccggcg aacgtttcga cttcgtcctc 1020

aacgccgatc aggacaaagc cctgtactgg attcgtttta ggggccttat ggattgtgac 1080

gagaggttca aacgcgccca tcaagtggct gtgctagaat acgacggact caacacgacg 1140

atggacgact atcctgaagg agtaaccgat tatgacacct cccatcgaga tggcacgcaa 1200

ataaatgcat tgaatcgagg ggttgagagc aattcgacat acatcagtat gcctcagctc 1260

gaatcattgg aaaaatggga tacttcctta aaatcaacgc ctgatattca gtattatata 1320

gcttacgact tttataaact aaacaatcct ca 1352

<210> 11

<211> 204

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ggccacgcgt cgactagtac gggggggggg gggggggttt gccggttact ttttaatcgc 60

ttgagtttta tattcttcag gccaccattt gtcctgactc tttttgtcgt ctattatgat 120

tctattaatt atatattctt tttgcagatg gaacaatgtt tttggtagtt tcgcttttcg 180

ttattggcac tgttagggca aacg 204

<210> 12

<211> 297

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

acaagtgcaa agactgcaat aatgctccag taattaaaac agtttcgtta tatattattg 60

tttcattatt agcaagcatt catttaagtt agtttaagtc atgttaatgt tacttttgga 120

gacatgtgcc ttcatatgaa tatatagact gatttaaaca tagtttaatt taggaaaatc 180

gaaatatatt tgttatgtaa tatattatgt ttaattaatt gttattgtaa taatgaattc 240

tctctaaata taattttcat aaactgagaa aaaaaaaaaa aaaaaaaaaa aaaaaaa 297

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tcctaatcca ttcaccagca a 21

<210> 14

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ggtacacctt caaagccata ca 22

<210> 15

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

agaaagttat tatctccgct cca 23

<210> 16

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ccataccagt tagtttgcca tt 22

Claims (4)

1. The application of monochamus alternatus endogenous laccase protein Ma-Lac1 or recombinant strains in degradation of lignocellulose is disclosed, wherein the amino acid sequence of the monochamus alternatus endogenous laccase protein Ma-Lac1 is shown as SEQ ID No.1 in a sequence table, the recombinant strains comprise recombinant plasmids, and the recombinant plasmids comprise nucleotide sequences shown as SEQ ID No.2 in the sequence table.

2. Use according to claim 1, wherein the temperature of degradation is 25 to 55 ℃.

3. The use according to claim 1, wherein the degradation process has a pH of 2.8 to 6.8.

4. The use according to claim 1, wherein the concentration of the degradation process lignocellulose is 100-120 mmol/L.

Images