CN108157165A - A kind of method using Rice Genomics technology fast accurate selection and breeding three lines paddy sterile line - Google Patents
A kind of method using Rice Genomics technology fast accurate selection and breeding three lines paddy sterile line Download PDFInfo
- Publication number
- CN108157165A CN108157165A CN201711484657.XA CN201711484657A CN108157165A CN 108157165 A CN108157165 A CN 108157165A CN 201711484657 A CN201711484657 A CN 201711484657A CN 108157165 A CN108157165 A CN 108157165A
- Authority
- CN
- China
- Prior art keywords
- rice
- screening
- parent
- sterile line
- breeding
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of methods using Rice Genomics technology fast accurate selection and breeding three lines paddy sterile line, this method is by the way that conventional breeding is combined with molecular labeling assisting sifting, effectively reject restoring gene, genetic background screening is carried out using the genotyping technique based on rice genome sequencing simultaneously, the sterile line and corresponding maintainer for obtaining genetic background closer to target parent can be screened.Compared with prior art, this method substantially reduces the Improvement of different generations of maintainer and the backcross generations of sterile line, just can precisely select the excellent three lines paddy sterile line of Comprehensive Traits within only 45 years.
Description
Technical field
The present invention relates to rice breeding technology field, more particularly to a kind of quick using Rice Genomics technology
The method of accurate selection and breeding three lines paddy sterile line.
Background technology
Breeding of hybridized rice facts have proved that quick, accurate selection and breeding high-combining ability, rice are of fine quality, mostly anti-, outcrossing habit is good at present
Sterile line, be the key that be bred as strong excellent combination.For many years, Chinese series of three-series hybrid rice is because of its stable high yield, production of hybrid seeds production phase
It to safety, is used widely, plays the role of to solution Food Security vital in China and the world.However three systems
Rice sterile line breeding is because of condition limitation of the sterile line for the inhereditary feature of nucleo-cytoplasmic interaction infertility, the maintainer in the new matter source of selection and breeding
More difficult, at present mainly using routine techniques, majority is the hybridization carried out between maintainer, although obtaining remarkable progress,
It is maintainer and infertility still to fail to reach by the new excellent genes such as existing rice restorer and conventional Rice and new material three
It fastens and is used, there is a serious shortage of it is miscellaneous to constrain three for the parent of high-quality more anti-ternary hybrid rices of breakthrough and combination market
Hand over the further fast development of rice, it is impossible to meet development need of the market to high-quality how anti-hybrid paddy rice.Ternary hybrid rice breeding is deposited
Main problem have the following：1st, the sterile line breeding time limit is longer；2nd, nucleo-cytoplasmic interaction type infertility keeps gene main source
In early-paddy brown rice, domestic most new maintainer selection and breeding hybridize for maintainer and maintainer, quality is relatively poor and genetic distance and
Genetic connection is nearer；3rd, rejected with restoring gene during the selection cross such as High quality and diseases resistance restorer and conventional rice it is unclean,
It is difficult to selection and breeding success；4th, the sterile line for being applied to production generally only has 1-2 excellent characters, has comprehensive excellent character
Sterile line is short of；5th, new breeding technique and method are needed.
With the reform of agricultural supply side structure, the importance of prominent rice quality, and the rice quality of hybrid rice with
Its sterile line has substantial connection, therefore is badly in need of strengthening the genetic improvement of high-quality CMS line；On the other hand, in CMS line
Improved, process in, the male sterility character of sterile line to be made to be maintained, the requirement to maintainer is very strict, in breeding
It is relatively more tired to the improvement of maintainer due to the problems such as gene being kept to whether there is in the interference of restoring gene and maintainer in practice
It is difficult.
Three lines paddy sterile line will realize that target overcomes the above problem, it is necessary to carry out traditional breeding method and modern high-new skill
Art is combined.The completion of the rapid development particularly rice genome sequencing of modern biotechnology, makes rice sterile line breeding
It can be operated from gene level.Three lines paddy sterile line and holding for quick, the accurate comprehensive excellent character of selection and breeding polymerization
Solid foundation has been established by system.
Invention content
It is an object of the invention to overcome the deficiencies of the prior art and provide a kind of quick using Rice Genomics technology
The method of accurate selection and breeding three lines paddy sterile line, it is intended to innovate breeding method and means, solve existing selection and breeding CMS line
The time limit is longer, genetic distance is relatively near, restoring gene rejects the problems such as unclean, comprehensive merit polymerization is inadequate.
The present invention is achieved by the following technical solutions：
The present invention provides a kind of method using Rice Genomics technology fast accurate selection and breeding three lines paddy sterile line,
Include the following steps：
(1) it using rice maintainer to be improved as female parent 1, using the rice restorer containing objective trait as male parent 1, carries out
After conventional sexual hybridization, it is returned once with male parent 1, in the BC1F1 of acquisition generation, is selfed primary again, obtains BC1F2 for segregating population,
Described in objective trait refer to maternal 1 unexistent merit to be improved；
(2) field Single-plant selection is carried out for segregating population to the BC1F2 of step (1), optimum selecting contains Parent parents
The single plant of merit carries out mixed receipts, and plants BC1F2 generations group of mixed roguing system seed, obtains BC1F3 groups；
(3) using the restoring gene contained by rice restorer as molecular marker screening gene, to step (2)
BC1F3 groups carry out molecular marker screening, and single plant bagging of the selection without the restoring gene is simultaneously selfed, while utilize two
Genome sequencing and genotyping are carried out to selfing single plant and Parent 1 for genome sequencing technology, screening is containing double
Close excellent genes, genetic background closer to male parent 1, Agronomic characteristic is excellent and stigma exposing ratio is high stabilization fine individual plant into
Row sowing；
(4) it using the stabilization fine individual plant BC1F3 of step (3) as male parent 2, is lost with the corresponding open country of rice maintainer to be improved
Type or red lotus type cytoplasmic male sterile series are female parent 2, are hybridized, and obtain F1 single plants, screening Agronomic characteristic is excellent, column
The high F1 single plants of head exposing ratio carry out full genome using two generation genome sequencing technologies to the F1 single plants and its Parent of screening
Group sequencing and genotyping, screening whole genome sequence and its male parent be closer and the single plant of 100% infertility of pollen microscopic examination with
Male parent 2 continues to be returned；
(5) step (4) is repeated, then it is more than generation to be returned 4, you can is bred as stable excellent sterile system and corresponding maintainer.
Further, the step (2) further includes carries out Agronomic characteristic screening to BC1F3 groups, and optimum selecting contains
There is Parent parents merit and the high single plant of stigma exposing ratio enters next step molecular marker screening step.
Further, the objective trait includes that leaf morphology is preferable, high-quality, high yield, disease-resistant, high outcrossing rate and coordinate force
One or more merits in high character, but not limited to this.
The present invention has the following advantages compared with prior art：
1) restoring gene is effectively rejected：In Breeding Process, using molecular marker assisted selection, it will be free of and contain
The maintainer of restoring gene effectively distinguishes, it is ensured that the stability of sterile line sterile degree is bred as, and conventional method is
Difficult to realize.
2) it is maintainer and the genetic background and genetic distance of sterile line effectively to expand three, conducive to novel three systems infertility is formulated
It is new germplasm source.
3) fast accurate：Genetic background selection is carried out using the genotyping technique based on rice genome sequencing, from
And the Improvement of different generations of maintainer and the backcross generations of sterile line are shortened, only 4-5 can just be bred as stable sterile line, more conventional
Breeding reduces the 2-3 years, greatly accelerates breeding speed, reduces the blindness of breeding.
3) it polymerize merit：Agronomic characteristic observation combines genome sequencing, screening polymerization parents' merit
Single plant.
Description of the drawings
Fig. 1：The Technology Roadmap of embodiment 1；
Fig. 2：The Technology Roadmap of embodiment 2.
Specific embodiment
Technical scheme of the present invention is described in detail below by two groups of specific embodiments, the method being directed to is such as
Without the materials such as the conventional method of dawn of being known to those skilled in the art, reagent used are illustrated, unless otherwise instructed,
It is commercially available products, germ plasm resource used, is commercially available conventional variety, it can be directly from Anhui an aromatic plant metioned in ancient books silver high-tech kind industry share
Co., Ltd buys or is obtained from national genebank.
Embodiment 1
A kind of method improved to " middle 9A " is present embodiments provided, it is specially fast using Rice Genomics technology
Fast precisely selection and breeding three lines paddy sterile line, includes the following steps：
(1) hybridize
Using " middle 9B " maintainer of " middle 9A " corresponding high outcrossing rate as female parent 1, with another economical character it is excellent, containing anti-
Rice blast Pi2 genes, restorer best in quality " YR0822 " are male parent 1, after carrying out conventional sexual hybridization, are returned with male parent 1
Once, in the BC1F1 generations of acquisition, are selfed primary again, obtain BC1F2 for segregating population.
(2) Agronomic characteristic screens
Agronomic characteristic screening is carried out for segregating population to BC1F2, selects the preferable fine individual plant 139 of leaf morphology
It is a, continue to screen in this 139 fine individual plants, optimum selecting contains the single plant of 1 parents' merit of Parent, and altogether 118
It is a, the seed of 118 single plants of screening is subjected to mixed receipts, and plant BC1F2 generations group of mixed roguing system seed, obtains BC1F3 groups
Body, 3000 plants altogether.
Continue Agronomic characteristic screening to BC1F3 groups, select leaf morphology preferably and optimum selecting contains father
Maternal 1 parents' merit and the high single plant of stigma exposing ratio, 180 altogether.
(3) molecular marker screening and genome sequencing
The restoring gene of restorer " YR0822 " is inquired as RF3 by national rice data center, using RF3 genes as
Molecular marker gene screens primer RM10338 as specificity amplification primer using RF3 genetic markers, above-mentioned steps (2) screening is obtained
180 single plants obtained carry out molecular marker screening, and step includes：
1) prepared by DNA：Plant number is carried out to above-mentioned 180 F3 single plants, genomic DNA is extracted using CTAB methods；
2) PCR reacts：
PCR reaction systems are 20 μ l, are contained：2mM Mg2+10 × Buffer 2.0ul, 2.5mM dNTPs 2.0ul, 1U/ μ
L Taq enzymes 0.5ul, 2 μM of positive anti-primers each 0.5ul, 100ng or so genomic DNA 2ul, ddH2O 12.5ul；
RM10338 primer sequences are：
It is positive：GTGAAGTTTCCCTCGGAATCACG
Reversely：AGCTAGGGAGAAGAAGCGGAAGC
After reaction condition is 94 DEG C of pre-degeneration 3min, by 94 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C extend 1min cycles
35 times, 72 DEG C of extension 5min；
PCR product after amplification utilizes 8% native polyacrylamide gel electrophoresis detection 60min (250V), electrophoresis
As a result it observes, take pictures on film observation lamp.
3) result counts：PCR product band is recorded, the single plant containing homozygous and heterozygosis restoring gene is rejected, screens
To the single plant without restoring gene.As a result：There are 137 parts of single plants containing restoring gene to be removed, screen 43 parts without fertility
The single plant of restoring gene.
Using two generation genome sequencing technologies, 43 lists obtained to parents " middle 9B ", " YR0822 " and above-mentioned screening
The full-length genome of strain is sequenced, and step includes：
I) 43 single plants obtained to " middle 9B ", " YR0822 " and above-mentioned screening are numbered, and take corresponding plant in seedling stage
Strain blade extracts plant leaf genomic DNA using the N96 plant genes groups DNA extraction kit of Qiaqen companies；
Ii) genomic DNA to be smashed, connector is connected after being repaired with archaeal dna polymerase, multiple sample mixing carry out electrophoresis, and
The segment of 300-400bp is recycled, establishes PE400 sequencing libraries；
Iii) using Illumina Hiseq X10 microarray datasets, full-length genome is carried out with the bis- end sequencing methods of 2 × 150bp
Resurvey sequence, parent be sequenced depth about 50 ×, offspring's single plant sequencing depth about 0.1 ×, can about be completed within one week or so time
Examining order.
It is compared and Genetic Variation Analysis identification, acquisition filial generation list by the way that filial generation single plant and parents are carried out whole genome sequence
The fine haplotype map of strain passes through the fine haplotype map of filial generation single plant, the genotype in analysis favorable genes site, selection
Favorable genes Heterozygosity is low, favorable genes containing parents (including blast resisting Pi2 genes) and genetic background are closer
The single plant of " YR0822 " 4, this 4 single plants for field leaf morphology is preferable, stigma exposing ratio is high, without restoring gene,
Contain blast resisting Pi2 genes and the preferable good stable single plant of quality.
(4) sterile line is cultivated
It is female parent 2 with " middle 9A ", the 4 good stable single plants (male parent 2) obtained respectively with step (3) screening carry out miscellaneous
It hands over, obtains F1 single plants, the F1 single plants that screening variable rate technology outcrossing rate is high, stigma exposing ratio is high utilize two generation genome sequencings
Technology carries out the F1 single plants and its Parent (Parent 2) of screening genome sequencing and genotyping, specific sequencing and
The same step of analysis method (3), the single plant and father that screening whole genome sequence is closer with male parent 2 and pollen microscopic examination 100% is sterile
Originally 2 continue to be returned；
(5) continuous backcross
Step (4) is repeated, continues backcrossing 5 times, finally carries out pollen microscopic examination and bagging detection, 4 single plant (male parent 2) transformations
The sterile degree of sterile line all reach 100%, obtain stable excellent sterile system (being named as an aromatic plant metioned in ancient books 908A) and corresponding maintainer
(being named as an aromatic plant metioned in ancient books 908B).
Embodiment 2
A kind of method improved to red lotus type sterile line " Guangdong Thailand A " is present embodiments provided, specially utilizes rice
Genomics technologies fast accurate selection and breeding three lines paddy sterile line, includes the following steps：
(1) hybridize
Using " Guangdong Thailand A " corresponding " Guangdong Thailand B " maintainer as female parent 1, with another economical character it is excellent, containing blast resisting
The excellent restorer of Pi2 genes, quality " five mountains silk seedling " is male parent 1, is returned once, obtains with male parent 1 after maternal 1 male parent 1 hybridization
F2 is for segregating population, 1297 plants altogether；
(2) Agronomic characteristic screens
Agronomic characteristic screening is carried out for segregating population to F2, selects the preferable fine individual plant 131 of leaf morphology,
Continue to screen in this 131 fine individual plants, leaf morphology is selected to meet the fine individual plant of male parent 1,124 altogether, by screening
The seed of 124 single plants carries out mixed receipts, and plants F2 generations group of mixed roguing system seed, obtains F3 groups.F3 groups are continued into
Row Agronomic characteristic screens, and screening leaf morphology meets 1 character of male parent and the high single plant of stigma exposing ratio, 173 altogether；
(3) molecular marker screening and genome sequencing
The restoring gene that restorer " five mountains silk seedling " is inquired by national rice data center is RF3, with RF3 genes
For molecular marker gene, primer RM10338 is screened as specificity amplification primer using RF3 genetic markers, above-mentioned steps (2) are screened
173 single plants obtained carry out molecular marker screening, and step includes：
1) prepared by DNA：Plant number is carried out to above-mentioned 173 F3 single plants, genomic DNA is extracted using CTAB methods；
2) PCR reacts：
PCR reaction systems are 20 μ l, are contained：2mM Mg2+10 × Buffer 2.0ul, 2.5mM dNTPs 2.0ul, 1U/ μ
L Taq enzymes 0.5ul, 2 μM of positive anti-primers each 0.5ul, 100ng or so genomic DNA 2ul, ddH2O 12.5ul；
RM10338 primer sequences are：
It is positive：GTGAAGTTTCCCTCGGAATCACG
Reversely：AGCTAGGGAGAAGAAGCGGAAGC
After reaction condition is 94 DEG C of pre-degeneration 3min, by 94 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C extend 1min cycles
35 times, 72 DEG C of extension 5min；
PCR product after amplification utilizes 8% native polyacrylamide gel electrophoresis detection 60min (250V), electrophoresis
As a result it observes, take pictures on film observation lamp.
3) result counts：PCR product band is recorded, the single plant containing homozygous and heterozygosis restoring gene is rejected, screens
To the single plant without restoring gene.As a result：There are 134 parts of single plants containing restoring gene to be removed, screen 39 parts without fertility
The single plant of restoring gene.
Using two generation genome sequencing technologies, 39 obtained to parents " Guangdong Thailand B ", " five mountains silk seedling " and above-mentioned screening
The full-length genome of single plant is sequenced, and step is not done repetition and retouched herein with two generation genome sequencing technical steps of embodiment 1
It states.By the way that filial generation single plant and parents are carried out whole genome sequence comparison and Genetic Variation Analysis identification, filial generation single plant is obtained
Fine haplotype map analyzes the genotype in excellent genes site in the fine haplotype map of filial generation single plant, selects excellent base
Because Heterozygosity is low, favorable genes containing parents (including blast resisting Pi2 genes) and genetic background are closer to " five mountains silk seedling "
Single plant 3, this 3 single plants are high, excellent steady without restoring gene, containing blast resisting Pi2 genes for stigma exposing ratio
Order strain.
(4) sterile line is cultivated
It is female parent 2 with " Guangdong Thailand A ", the 3 good stable single plants (male parent 2) obtained respectively with step (3) screening carry out miscellaneous
It hands over, obtains F1 ' single plants, the F1 ' single plants that screening variable rate technology outcrossing rate is high, stigma exposing ratio is high are surveyed using two generation full-length genomes
Sequence technology carries out the F1 ' single plants of screening and its parent's (Parent 2) genome sequencing and genotyping, specific sequencing and
The same step of analysis method (3), the single plant and father that screening whole genome sequence is closer with male parent 2 and pollen microscopic examination 100% is sterile
Originally 2 continue to be returned；
(5) continuous backcross
Step (4) is repeated, is returned 4 times, finally carries out pollen microscopic examination and bagging detection, 3 single plant (male parent 2) transformations are not
It educates the sterile degree for being and all reaches 100%, obtain stable excellent sterile system (being named as an aromatic plant metioned in ancient books Thailand 1A) and (name of corresponding maintainer
For an aromatic plant metioned in ancient books Thailand 1B).
Be above a kind of detailed embodiment and specific operating process of the present invention, be using technical solution of the present invention before
It puts and is implemented, but protection scope of the present invention is not limited to the above embodiments.
Claims (3)
- A kind of 1. method using Rice Genomics technology fast accurate selection and breeding three lines paddy sterile line, which is characterized in that packet Include following steps：(1) it using rice maintainer to be improved as female parent 1, using the rice restorer containing objective trait as male parent 1, carries out conventional It after sexual hybridization, is returned once with male parent 1, the BC1F1 generations of acquisition are selfed once again, obtain BC1F2 for segregating population；(2) field Single-plant selection is carried out for segregating population to the BC1F2 of step (1), it is excellent that optimum selecting contains Parent parents The single plant of character carries out mixed receipts, and plants BC1F2 generations group of mixed roguing system seed, obtains BC1F3 groups；(3) using the restoring gene contained by rice restorer as molecular marker screening gene, to the BC1F3 groups of step (2) Body carries out molecular marker screening, and single plant bagging of the selection without the restoring gene is simultaneously selfed, while utilize two generations full base Because group sequencing technologies carry out genome sequencing and genotyping to selfing single plant and Parent 1, screening is excellent containing parents Gene, genetic background are received closer to male parent 1, the stabilization fine individual plant that Agronomic characteristic is excellent and stigma exposing ratio is high Kind；(4) using the stabilization fine individual plant BC1F3 of step (3) as male parent 2, with the corresponding Yebai of rice maintainer to be improved or Red lotus type cytoplasmic male sterile series are female parent 2, are hybridized, and obtain F1 single plants, and screening Agronomic characteristic is excellent, outside column cap The high F1 single plants of dew rate carry out full-length genome survey using two generation genome sequencing technologies to the F1 single plants and its Parent of screening Sequence and genotyping, the single plant and male parent that screening whole genome sequence is closer with its male parent and pollen microscopic examination 100% is sterile 2 continue to be returned；(5) step (4) is repeated, then it is more than generation to be returned 4, you can is bred as stable excellent sterile system and corresponding maintainer.
- It is 2. according to claim 1 a kind of using Rice Genomics technology fast accurate selection and breeding three lines paddy sterile line Method, which is characterized in that the step (2) further includes carries out Agronomic characteristic screening to BC1F3 groups, and optimum selecting contains The Parent parents merit and high single plant of stigma exposing ratio enters next step molecular marker screening step.
- It is 3. according to claim 1 a kind of using Rice Genomics technology fast accurate selection and breeding three lines paddy sterile line Method, which is characterized in that the objective trait includes that leaf morphology is preferable, high-quality, high yield, disease-resistant, high outcrossing rate and coordinate force One or more merits in high character.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711484657.XA CN108157165B (en) | 2017-12-29 | 2017-12-29 | Method for rapidly and accurately breeding sterile line of three-line rice by utilizing rice genomics technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711484657.XA CN108157165B (en) | 2017-12-29 | 2017-12-29 | Method for rapidly and accurately breeding sterile line of three-line rice by utilizing rice genomics technology |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108157165A true CN108157165A (en) | 2018-06-15 |
| CN108157165B CN108157165B (en) | 2021-08-10 |
Family
ID=62516316
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711484657.XA Active CN108157165B (en) | 2017-12-29 | 2017-12-29 | Method for rapidly and accurately breeding sterile line of three-line rice by utilizing rice genomics technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108157165B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113951131A (en) * | 2021-11-05 | 2022-01-21 | 广东省农业科学院水稻研究所 | Method for rapidly breeding three-line rice maintainer line and sterile line by using rice genome analysis technology |
| CN114651686A (en) * | 2022-04-11 | 2022-06-24 | 海南省农业科学院粮食作物研究所 | Method for breeding new red rice variety by utilizing medicinal wild rice |
| CN115644051A (en) * | 2022-11-04 | 2023-01-31 | 上海中科荃银分子育种技术有限公司 | Method for breeding sterile line of three-line hybrid rice |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103262790A (en) * | 2013-06-14 | 2013-08-28 | 武汉大学 | Method for selectively breeding Honglian type rice blast-resistant sterile lines |
-
2017
- 2017-12-29 CN CN201711484657.XA patent/CN108157165B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103262790A (en) * | 2013-06-14 | 2013-08-28 | 武汉大学 | Method for selectively breeding Honglian type rice blast-resistant sterile lines |
Non-Patent Citations (2)
| Title |
|---|
| 曹溢滔: "《遗传病分子基础与基因诊断》", 31 December 2017, 上海科学技术出版社 * |
| 穆平: "《作物育种学》", 31 July 2017, 中国农业大学出版社 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113951131A (en) * | 2021-11-05 | 2022-01-21 | 广东省农业科学院水稻研究所 | Method for rapidly breeding three-line rice maintainer line and sterile line by using rice genome analysis technology |
| CN114651686A (en) * | 2022-04-11 | 2022-06-24 | 海南省农业科学院粮食作物研究所 | Method for breeding new red rice variety by utilizing medicinal wild rice |
| CN115644051A (en) * | 2022-11-04 | 2023-01-31 | 上海中科荃银分子育种技术有限公司 | Method for breeding sterile line of three-line hybrid rice |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108157165B (en) | 2021-08-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108192990B (en) | SNP molecular marker related to watermelon peel background color and application thereof | |
| CN107988420B (en) | Molecular marker of maize male nuclear sterility gene ms39 and application thereof | |
| CN107828908A (en) | The molecule labelling method of cabbage type rape seed high oleic acid content and application | |
| CN108157165A (en) | A kind of method using Rice Genomics technology fast accurate selection and breeding three lines paddy sterile line | |
| CN107937397B (en) | SNP molecular marker closely linked with tomato male sterility gene and obtaining method and application thereof | |
| CN107881251A (en) | The molecular labeling related to tomato male-sterile mutation site ms 15, ms 26, ms 47 and application | |
| CN112011640B (en) | KASP molecular marker, primer and application for identifying pH of watermelon fruit | |
| WO2019067897A1 (en) | Maize plants with improved disease resistance | |
| CN110184378B (en) | Molecular identification method of cytoplasmic male sterility restoring gene of triple-split cotton | |
| CN104762298B (en) | A kind of rice seedling resistant gene of salt qST11 and its molecule labelling method | |
| CN108531644B (en) | Molecular marker closely linked with upland cotton AS98 dwarfing character and application thereof | |
| CN116732226A (en) | Method for rapidly transferring and breeding Ruifeng 125 transgenic maize inbred line and application | |
| CN107267504B (en) | SNP (Single nucleotide polymorphism) marker for identifying pear pulp high stone cell content based on high resolution dissolution curve and application of SNP marker | |
| CN107287210B (en) | Rice appearance quality gene qAQ7 and molecular marking method and application thereof | |
| CN112921112B (en) | CAPS molecular marker, detection primer and detection kit for identifying marigold petal type | |
| CN108124764A (en) | A kind of method using Rice Genomics technology fast accurate selection and breeding three lines paddy restorer | |
| CN111254216B (en) | CAPS marker and method for identifying soybean RN type CMS restoring gene | |
| CN114703316A (en) | Development and application of KASP marker of tomato ps-2 gene | |
| CN115491429A (en) | Detection primer and detection kit for rice wx gene and application of detection kit | |
| CN110184377B (en) | Molecular marker co-separated from tomato male sterility mutation site ms-32, specific primer and application thereof | |
| CN109197569B (en) | Molecular breeding method for improving stigma exposure rate of three-line sterile line of rice | |
| CN113528702A (en) | KASP marker closely linked with main effect QTL of lycopene in carrot and primer and application thereof | |
| CN111518940A (en) | Method for detecting Wx1 molecular marker and applying Wx1 molecular marker to sweet waxy corn breeding | |
| CN107058601B (en) | SNP (Single nucleotide polymorphism) marker for identifying low stone cell content of pear pulp based on high-resolution dissolution curve and application of SNP marker | |
| CN107926699A (en) | A kind of method using corn full genome omics technology fast accurate selecting and breeding corn self-mating system |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20210623 Address after: 200000 building 4, 300 Fenglin Road, Xuhui District, Shanghai Applicant after: Center for excellence and innovation in molecular plant science, Chinese Academy of Sciences Applicant after: ANHUI WIN-ALL HI-TECH SEED Co.,Ltd. Applicant after: SHANGHAI NORMAL University Applicant after: ANHUI KAITAI AGRICULTURE AND ANIMAL HUSBANDRY TECHNOLOGY Co.,Ltd. Address before: No.319 Yueyang Road, Xuhui District, Shanghai 200030 Applicant before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES Applicant before: ANHUI WIN-ALL HI-TECH SEED Co.,Ltd. Applicant before: SHANGHAI NORMAL University Applicant before: ANHUI KAITAI AGRICULTURE AND ANIMAL HUSBANDRY TECHNOLOGY Co.,Ltd. |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |