CN108148031B

CN108148031B - Pyrone compound, preparation method and application

Info

Publication number: CN108148031B
Application number: CN201810115669.3A
Authority: CN
Inventors: 李文利; 侯路宽; 李花月; 黄会明
Original assignee: Ocean University of China
Current assignee: Ocean University of China
Priority date: 2018-02-06
Filing date: 2018-02-06
Publication date: 2020-04-28
Anticipated expiration: 2038-02-06
Also published as: CN108148031A

Abstract

The invention provides α -pyrone compounds with antiviral activity and application thereof in resisting influenza viruses H1N1 and H3N2, and also discloses a preparation method of α -pyrone compounds with antiviral activity, which comprises the steps of (1) obtaining a fermentation product rich in the pyrone compounds through microbial fermentation culture, wherein a recombinant vector adopted in the microbial fermentation culture carries a polyketide synthase gene with a nucleotide sequence of KU534995.1, (2) separating and purifying the fermentation product obtained in the step (1) to obtain the α -pyrone compounds.

Description

Pyrone compound, preparation method and application

Technical Field

The invention belongs to the technical field of genetic engineering and biological pharmacy, and particularly relates to a method for producing pyrone compounds by using recombinant strains; the invention also relates to application of the compounds in resisting influenza viruses.

Background

Influenza (referred to as "influenza") is acute respiratory infection caused by influenza virus, and is also a disease with strong infectivity and high transmission speed. Influenza is transmitted primarily by airborne droplets, human-to-human contact, or contact with contaminated items. Typical clinical symptoms are: acute high fever, general pain, marked weakness and mild respiratory symptoms. Generally, the autumn and winter season is the high-incidence period of the disease, and the complications and death phenomena caused by the disease are very serious. The disease is caused by influenza virus, can be divided into three types of A (A), B (B) and C (C), and the A virus often has antigen variation, is high in infectivity, is rapidly spread and is very easy to have pandemic. Form a H1N1 is also a form a. The pneumonia is self-limiting, but is particularly important in high-risk groups such as infants, old people and the like, and the pneumonia complication rate is high; among them, the elderly accounts for most of the deaths due to influenza.

The currently known anti-influenza drugs include ribavirin, oseltamivir, amantadine, zanamivir, arbidol and the like. However, the existing anti-influenza drugs have certain side effects, for example, ribavirin can cause hemolytic anemia, rash, diarrhea, teratogenesis and the like, and oseltamivir can cause nausea, vomiting and the like. In addition, the increasing number of influenza viruses resistant to existing anti-influenza drugs and the increasing large-scale prevalence of novel influenza viruses have led to an urgent need for the development of anti-influenza drugs with novel mechanisms.

Polyketides are common compounds in nature, and show diversified structures and rich activities. Under the above circumstances, the invention patent ZL201410403411.5 discloses "a process for producing pyrone and pyridone derivatives". The preparation method has high yield and good efficiency, and avoids using toxic/expensive/environmentally harmful reaction reagents and dangerous reactions. The pyrone derivative prepared by the invention can be used for the industrial preparation of anti-influenza drugs, anti-HIV drugs, anti-inflammatory agents, analgesics and antitumor drugs. However, most of the pyrone derivatives obtained by the method are chemical synthesis products, and the toxicity to normal cells can be higher than that of natural products.

In addition, a series of studies were conducted by researchers on α -pyrones, wherein Jiaoyue Zhang et al (Journal of Natural Products,2013,76(11):2126-2130.) isolated 7 new α -pyrones from Streptomyces violascens and reported for the first time the antibacterial activity of the violarone compounds, wherein the compound violarone A-C had a certain bacteriostatic activity against Bacillus and Staphylococcus aureus with MIC values (minimum bacteriostatic value) in the range of 4-32ug/ml Hee Jae Shin et al (Mardrug, 2014,12(6):3283-3291) isolated two new α -pyrones and two known violarone compounds B and C and first reported that the compound had the anti-tumor activity against Huylone compounds with a certain concentration of 50% of Huylone-10. multidrug resistance against Staphylococcus aureus (MR9-20. multidrug resistance) in the range of 10.2016. multidrug resistance against Staphylococcus aureus (MRSA 1. 10. multidrug resistance) in the range of 20-20. multidrug resistance against Staphylococcus aureus (MR9. multidrug resistance).

The invention patent application 201710453506.1 discloses a α -pyrone compound, a pharmaceutical composition thereof and application thereof in pharmacy, the invention develops a lead compound with a similar mother nucleus, provides application of a α -pyrone compound in using drug tamoxifen resistance for traditional treatment of breast cancer, and can be used as a hypersensitivity factor in the treatment process of drug tamoxifen, so that the drug effect of tamoxifen can be improved.

There is no report on antiviral activity of violapyrane compounds.

Disclosure of Invention

Aiming at the current situation of the current anti-influenza drugs, the invention provides pyrone compounds with anti-influenza virus activity. Compared with the existing common medicines, the pyrone compound not only has better anti-H1N 1 and H3N2 virus activity, but also has low toxicity.

The technical scheme of the invention is as follows:

α -pyrone compounds with antiviral activity, wherein the structural general formula is shown as formula (I):

in the formula (I), the compound is shown in the specification,

R₁the groups are: -CH₃、-CH₂CH₃；

R₂The groups are:

R₃the groups are: -H, -CH₃、

Further, the α -pyrone compounds do not include the following structure:

furthermore, the α -pyrone compounds are α -pyrone compounds 1, 2, 3, 4, 5 and 6, and the structural formulas are respectively as follows:

application of α -pyrone compounds with antiviral activity in preparation of anti-influenza virus drugs, wherein the influenza viruses are H1N1 and H3N 2.

A pharmaceutical composition comprises the α -pyrone compound with antiviral activity and a pharmaceutically acceptable carrier.

The preparation method of α -pyrone compounds with antiviral activity comprises the following steps:

(1) obtaining a fermentation product rich in pyrone compounds through microbial fermentation culture; the recombinant vector adopted in the microbial fermentation culture carries a polyketide synthase gene with a nucleotide sequence of KU 534995.1.

(2) And (2) separating and purifying the fermentation product obtained in the step (1) by adopting methods such as liquid-liquid extraction, reversed-phase silica gel column chromatography, semi-preparative HPLC and the like to obtain the α -pyrone compound.

Specifically, the step (2) of the preparation method of the compounds 1 to 4 is: extracting the corresponding fermentation product with ethyl acetate, performing liquid-liquid extraction with equal volume of n-hexane-95% methanol, performing reverse phase silica gel column chromatography, eluting with methanol and water as solvents, and performing separation and purification by semi-preparative HPLC (high performance liquid chromatography) to obtain compounds 1-4, wherein the methanol-water ratio is 55:45 and the methanol-water ratio is 60: 40; the culture medium contains per liter: soluble starch 10g, KH₂PO₄0.5g，MgSO₄·7H₂0.5g of O, 20g of glucose, 10g of yeast extract, 4g of corn steep liquor, 3g of beef extract and CaCO₃2g, sea salt 30g and the balance of water, and the pH value is 7.2.

The preparation method of the compounds 5-6 comprises the following step (2): extracting the corresponding fermentation product with ethyl acetate, performing liquid-liquid extraction with equal volume of n-hexane-95% methanol, performing reverse phase silica gel column chromatography, eluting with methanol and water as solvent, and separating and purifying the eluted part with methanol-water ratio of 65:35 by semi-preparative HPLC to obtain compound 5-6; the culture medium contains per liter: soluble starch 10g, KH₂PO₄0.5g，MgSO₄·7H₂0.5g of O, 20g of glucose, 10g of yeast extract, 4g of corn steep liquor, 3g of beef extract and CaCO₃2g, sea salt 30g and the balance of water, and the pH value is 7.2.

The recombinant vector carries polyketone synthase gene with a nucleotide sequence of KU534995.1, and a fermentation product rich in pyrone compounds can be obtained after fermentation culture of microorganisms containing the recombinant vector, wherein the pyrone compounds are α -pyrone compounds with antiviral activity.

The invention has the beneficial effects that:

(1) the invention provides α -pyrone compounds with antiviral activity, and the α -pyrone compounds have a prospect of being developed into novel anti-influenza drugs.

(2) Compared with the existing anti-influenza drugs, the α -pyrone compound with antiviral activity can be prepared by optimizing the yield through molecular genetic manipulation means and further performing large-scale fermentation, thereby laying a solid foundation for later market investment.

(3) The α -pyrone compound with the antiviral activity has very low toxicity, basically has no toxicity to normal cells, has natural advantages compared with the existing medicines, not only has good activity, but also reduces the toxic and side effects as much as possible, and has wide application prospect and huge market space.

Drawings

FIG. 1 is a verification electrophoretogram constructed by the expression vector constructed by the present invention;

FIG. 2 is an ultraviolet absorption spectrum of pyrone compounds 1-6 according to the present invention; -

FIG. 3 is a Mass Spectrum (MS) of pyrone compound 1 according to the present invention;

FIG. 4 is a Mass Spectrum (MS) of pyrone compound 2 according to the present invention;

FIG. 5 is a Mass Spectrum (MS) of pyrone compound 3 according to the present invention;

FIG. 6 is a Mass Spectrum (MS) of pyrone 4 of the present invention;

FIG. 7 is a Mass Spectrum (MS) of pyrone compound 5 according to the present invention;

FIG. 8 is a Mass Spectrum (MS) of pyrone compound 6 according to the present invention.

Detailed Description

The present invention will be further described with reference to the following examples.

Example 1: cloning of polyketide synthase Gene

1. Extraction of genomic DNA

Inoculating marine streptomycete ZH66 into TSBY liquid culture medium, culturing overnight at 30 ℃, centrifuging to collect thalli, and washing with appropriate amount of STE buffer; adding 3-5 mg/ml lysozyme solution prepared by STE buffer, carefully and fully suspending thalli, and carrying out water bath at 37 ℃ for 30min until the cells become semitransparent; adding 6% SDS, mixing up and down, continuing 37 deg.C water bath until clear; adding appropriate amount of 3M NaAc (pH 4.8), adding appropriate amount of phenol chloroform isoamyl alcohol (25:24: 1; v/v/v), mixing, and centrifuging at 12000 rpm; transferring supernatant, repeatedly extracting with phenol, chloroform and isoamylol until the middle layer has no protein impurity, transferring supernatant, adding isopropanol of the same volume, and mixing until white flocculent DNA precipitates; picking out flocculent precipitate, and washing for 1-2 times by using 70% ethanol; after drying at room temperature, genomic DNA was dissolved in an appropriate amount of TE for further use.

2. Construction of recombinant vectors

Designing a primer pair: p1: 5' -CCGGAATTCcgcaccccctggtcaacgcg-3’/P2：5’–gagccgatctcctcgttggt -3’，P1’：5’-atggccatccacatcgccca-3’/P2’：5’–CGCGGATCCtcacgccgcccagaccccac-3', and performing PCR by using the T-DNA of the Streptomyces marinus ZH66 prepared as above as a template diluted by 5 times. Wherein the primer pair P1/P2 is used to amplify the glyceraldehyde triphosphate promoter P_gapDHThe primer pair P1 '/P2' was used to amplify a functional gene encoding polyketide synthase, with EcoRI and BamHI sites underlined, respectively.

And (3) PCR reaction system:

primer pairs P1 and P2(P1 'and P2') were each 5. mu.l (50pmol), template 5. mu.l, 10 × Reaction Buffer 10. mu.l, 2.5mM dNTP 10. mu.l, 25mM MgCl₂6 μ l, 1 μ l (5U/. mu.l) of Taq DNA Polymerase, plus ddH₂O to 100. mu.l.

PCR conditions were as follows:

the method comprises the following steps of carrying out promoter amplification conditions, carrying out denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, denaturation at 57.4 ℃ for 30s, and denaturation at 72 ℃ for 30s, and 25 cycles, carrying out denaturation at 72 ℃ for 5min, functional gene amplification conditions, denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, and denaturation at 67.3 ℃ for 30s, and denaturation at 72 ℃ for 1min for 30s, and circulation at 72 ℃ for 5min, connecting the promoter, the functional gene and an integration vector pMT3 by using T4 ligase, transforming escherichia coli DH5 α competent cells, selecting positive clones, carrying out sequence determination, wherein the result is shown as a sequence 1, the translated protease sequence is shown as a sequence 2, and carrying out PCR amplification verification by using a primer P1/P2', and shown as an electrophoresis chart in FIG. 1, so as to.

3. Construction of recombinant strains

And (3) introducing the constructed recombinant vector into two different heterologous expression hosts to obtain a recombinant strain I and a recombinant strain II.

EXAMPLE 2 preparation of α -pyrones 1-4

1. Fermentation production

(1) Culturing spores: according to the conventional method for culturing microorganisms, a proper amount of recombinant strain I is inoculated on an MS solid slant culture medium and is placed in a constant temperature incubator at 30 ℃ for 3-4 days.

MS culture medium: 20g of bean powder, 20g of mannitol and 20g of agar powder, dissolving in water, setting the volume to 1L, and sterilizing at 121 ℃ for 30 minutes. After sterilization, the medium was poured into a petri dish with a diameter of 90mm and dispensed at 30 ml/plate.

(2) Fermentation culture

Taking a proper amount of recombinant strain spores for 3-4 days of slant culture, inoculating the recombinant strain spores into a 250ml conical flask filled with 50ml of culture solution, placing the conical flask in a constant temperature shaking table at 30 ℃, and culturing for 7 days at the rotating speed of 220rpm to obtain mycelium and fermentation liquor. Wherein, the culture medium comprises the following components: soluble starch 10g, KH₂PO₄0.5g，MgSO₄·7H₂0.5g of O, 20g of glucose, 10g of yeast extract, 4g of corn steep liquor, 3g of beef extract and CaCO₃2g of sea salt and 30g of tap water, and adjusting the pH value to 7.2.

2. Obtaining extract

The fermentation broth and mycelia were centrifuged at 7500 rpm. The mycelium was discarded, the broth was extracted directly three times with equal amount of ethyl acetate, the ethyl acetate phases were combined and concentrated under reduced pressure to give a crude extract, total 3.95 g.

3. Separation and purification of Compound

3.95g of extract is firstly extracted twice by using equal volume of liquid-liquid of n-hexane-95% methanol, and the solvent is removed under reduced pressure. Then, the 95% methanol phase is subjected to reverse phase silica gel column chromatography, and gradient elution is carried out by taking methanol-water as a solvent, and the methanol-water is divided into 17 fractions. Fr-8 (methanol-water 55:45 eluate, 152.11mg) and Fr-9 (methanol-water 60:40 eluate, 36.20mg) were subjected to semipreparative reverse phase high performance liquid chromatography (methanol: water 80: 20, 60min) to give compound 1(3.88mg), compound 2(2mg), compound 3(2.58mg) and compound 4(2.30 mg).

Example 3: characterization of Compounds 1 to 4

Compound 2 as a pale yellow amorphous solid, UV (MeOH) (log. epsilon.) λ_max290.0(3.72), formula C₁₄H₂₂O₃，HR-ESIMS m/z 239.1640[M+H]⁺. Wherein the content of the first and second substances,¹h and¹³the C-NMR data are shown in Table 1.

TABLE 1 preparation of Compound 2¹H and¹³c NMR data (500 and 150MHz, in d)₆-DMSO)a

The signal assignments in table 1 are based on H-H COSY, HMQC and HMBC mapping results. The multiplicity of the carbon signal is represented by s (singlet), d (doublet), t (triplet), q (quartet) and m (multiplet), respectively.

Compound 1 is a pale yellow amorphous solid, formula C₁₃H₂₀O₃，HR-ESIMS m/z 225.1483[M+H]⁺。

Compound 3 is a pale yellow amorphous solid, formula C₁₄H₂₂O₃，HR-ESIMS m/z 239.1640[M+H]⁺。

Compound 4 is a pale yellow amorphous solid with the molecular formula C₁₄H₂₂O₃，HR-ESIMS m/z 239.1638[M+H]⁺。

EXAMPLE 4 preparation of α -pyrones and 6

Production preparation of Compounds 5 and 6

1. Fermentation production

(1) Culturing spores:

according to the conventional method for culturing microorganisms, a proper amount of recombinant strain II is inoculated on an MS solid slant culture medium and is placed in a constant temperature incubator at 30 ℃ for 3-4 days.

(2) Fermentation culture

Appropriate amount of recombinant strain spores cultured on slant for 3-4 days were inoculated into a medium containing 50ml of culture solution [ medium composition: soluble starch 10g, KH₂PO₄0.5g，MgSO₄·7H₂0.5g of O, 20g of glucose, 10g of yeast extract, 4g of corn steep liquor, 3g of beef extract and CaCO₃2g of sea salt, 30g of sea salt and tap water, adjusting the pH value to 7.2, placing the conical flask into a 250ml conical flask, placing the conical flask into a constant temperature shaking table at the temperature of 30 ℃, and culturing for 7 days at the rotating speed of 220rpm to obtain mycelium and fermentation liquor.

2. Obtaining extract

The fermentation broth and mycelia were centrifuged at 7500 rpm. The mycelium is discarded, the fermentation liquor is directly extracted for three times by using ethyl acetate with the same quantity, the ethyl acetate phase is combined, and the pressure reduction concentration is carried out to obtain crude extract, wherein the total weight is 4.59 g.

3. Separation and purification of Compound

4.59g of extract is firstly extracted twice by liquid-liquid extraction with equal volume of n-hexane-95% methanol, and the solvent is removed under reduced pressure. Then, the 95% methanol phase is subjected to reverse phase silica gel column chromatography, and gradient elution is carried out by taking methanol-water as a solvent, and the methanol-water is divided into 17 fractions. Fr-9 (methanol-water 60:40 eluate, 35.93mg) was subjected to semipreparative reverse phase high performance liquid chromatography (methanol: water 85: 15, 60min) to give compound 5(3.75mg) and compound 6(2.36 mg).

Example 5: characterization of Compounds 5 and 6

Compound 5 is a pale yellow amorphous solid, UV (MeOH) (log. epsilon.))λ_max290.0(2.99), formula C₁₃H₂₀O₃，HR-ESIMS m/z 225.1491[M+H]⁺. Wherein the content of the first and second substances,¹h and¹³the C-NMR data are shown in Table 2.

TABLE 2 preparation of Compound 5¹H and¹³c NMR data (500 and 150MHz, in d)₆-DMSO)^a

Compound 6 as a pale yellow amorphous solid, UV (MeOH) (log. epsilon.) λ_max290.0(2.97), formula C₁₄H₂₂O₃，HR-ESIMS m/z 239.1645[M+H]⁺. Wherein the content of the first and second substances,¹h and¹³the C-NMR data are shown in Table 3.

TABLE 3 preparation of Compound 6¹H and¹³c NMR data (500 and 150MHz, in d)₆-DMSO)^a

The signal attribution of the table is based on H-H COSY, HMQC and HMBC atlas analysis results. The multiplicity of carbon signals is represented by s (singlet), d (doublet), t (triplet), q (quartet) and m (multiplet), respectively.

Example 6: test of Compounds 1-6 against influenza Virus

(1) Experimental sample and experimental method

Preparation of test sample solution the test samples were pure compounds 1 to 6 isolated and purified in the above-mentioned examples 2 and 4. Accurately weighing a proper amount of sample, and preparing a solution with required concentration by using DMSO (dimethyl sulfoxide) for measuring the activity.

The cell line and subculture of the cells adopt dog kidney epithelial MDCK cells, the cells adopt RPMI-1640 medium containing 10% FBS, and the temperature is 37 DEG CIntroducing 5% CO₂Subculturing in the incubator. The viruses used were H1N1(A/Puerto Rico/8/1934), H1N1(A/Virginia/ATCC1/2009) and H3N2(A/Aichi/2/1968) strains.

Cytopathic effect (CPE) inhibition assay, determining the rate of inhibition of influenza a virus by a sample: the MDCK cell suspension digested into a monolayer was plated in a 96-well plate, the number of cells was 2.5 ten thousand per well, and the volume of the cell culture solution was 200 μ L. After 24h of cell culture, the cells are full of monolayer, inoculated with influenza virus solution (MOI is 0.1), incubated at 37 ℃ for 1h, then supernatant virus solution is discarded, and 200 mu L of medicine-containing maintenance solution (ribavirin is a positive medicine) is added; followed by 5% CO at 37 ℃₂And (5) incubating for 30 h. Fixing with 4% paraformaldehyde for 15min, dyeing with crystal violet dye solution for 25min, measuring OD value of each well at wavelength of 570nm, and calculating IAV virus inhibition rate of the medicine according to formula:

the percent virus inhibition is (drug treatment group OD value-virus control group OD value)/(normal cell control group OD value-virus control group OD value) × 100%

(2) Results of the experiment

TABLE 4 inhibitory Activity of Compounds 1-6 against influenza Virus

"-" indicates no detection

(3) Conclusion

The compounds 2,4 and 5 have obvious inhibition effect on H1N1(A/Puerto Rico/8/1934) virus, and the compounds 1 and 3 have better inhibition effect on H1N1(A/Puerto Rico/8/1934) virus. Compound 6 has obvious inhibitory effect on H1N1(A/Virginia/ATCC1/2009) and H3N2(A/Aichi/2/1968) viruses. The compound 5 has a good inhibitory effect on (A/Virginia/ATCC1/2009) viruses, and can be used as an influenza virus inhibitor for research on anti-influenza viruses.

In conclusion, the α -pyrone compound has obvious inhibiting effect on H1N1 and H3N2 viruses, so that the α -pyrone compound has a prospect of being developed into a novel anti-influenza drug.

Sequence listing

1053

DNA

gene sequence

atggccatccacatcgcccagcccaccaccatcctcggcgcccacaaagtcaccaccgctgagatagccgacgacatccggcaccaccacg ccgaccacccgcggctccgctccatcctccgcatcgtcggcaacaccggcgtcgccacccggcacttcacgcggcccctcaccgccgacac catcaccggcaccgcgccggtcggagaccgcgccaccgcggcgttcaacgatgccctcgacatagccgagcaagctgcccgcgaagctct cgccctccacggcctcgacccgaccgacatcaccggcatcgtcaccacccactccaccggctgggccgtccccggcctcgacatccacctcg tccagcgcctcggcctgcccgccaccgtgcagcggatcgggctgaccaccctcgcctgcgccggcggcacacaggccctgatccgcgcca ccgacatggtggccgcccggcctgggtctcgtgtgctggtggtggctgcggaggtcatctccgcgatctacaaccacgccgatgacgctgtgg agcacatgatctacaaggcgctgttcggggacagtgcggccgcggccatcgtcagcgaccagccccacggccccggcttcaccctcatcgg gccggccgatacgtacgagcacgtcctcccggacagcctcacccggtacgtcggccgcatcgacagcacgggcctccacttcgactccacg aaggaagccctgtccgccgcggacgacgtactgcctggcgtcaccgggtggctcggccagcagcacatcgtggactgggctgtcatccaccccggcagtcagcggatcatctcggacacggcgcgggctctcggcctggacgcgcacgacacgcgccactcgacggcgacgctcgcggac gaggggaacttgggcgggccgtcggtgctgcggattttggagcggacgcacgcggagccgcccgcagctggggcgcacggcgtgatggtc gcctacgggccgggcttcaacacggcagcgatccgtggggtctgggcggcgtga 。

Claims

1. The α -pyrone compound with antiviral activity is characterized in that the α -pyrone compound is α -pyrone compound 5 and 6, and the structural formulas are respectively as follows:

2. the application of α -pyrone compounds with antiviral activity in preparing anti-influenza virus H1N1 medicines is characterized in that the α -pyrone compounds with antiviral activity are specifically compound 1, compound 2, compound 3, compound 4, compound 5 and compound 6, and the structural formulas are respectively as follows:

3. the application of α -pyrone compounds with antiviral activity in preparing anti-influenza virus H3N2 medicines is characterized in that the α -pyrone compounds with antiviral activity are specifically compound 6, and the structural formula of the compound is as follows:

4. the pharmaceutical composition is characterized by comprising α -pyrone compounds with antiviral activity and pharmaceutically acceptable carriers, wherein α -pyrone compounds with antiviral activity are compound 2, compound 5 and compound 6, and the structural formulas are respectively as follows:

5. the method for preparing α -pyrone compounds with antiviral activity according to claim 1, comprising the steps of (1) obtaining a fermentation product rich in pyrone compounds by microbial fermentation culture, and (2) separating and purifying the fermentation product obtained in step (1) to obtain the α -pyrone compounds.

6. The method for preparing α -pyrones with antiviral activity according to claim 5, wherein the recombinant vector used in the fermentation culture of the microorganism of step (1) carries polyketide synthase gene with KU534995.1 as a nucleotide sequence.

7. The method of claim 5 or 6, wherein the microorganism of step (1) is cultured in a medium containing 10g of soluble starch and KH per liter₂PO₄0.5g，MgSO₄·7H₂0.5g of O, 20g of glucose, 10g of yeast extract, 4g of corn steep liquor, 3g of beef extract and CaCO₃2g, 30g of sea salt and the balance of water, wherein the pH value is 7.2; the step (2) of the preparation method of the compounds 5 and 6 is: extracting the corresponding fermentation product with ethyl acetate, performing liquid-liquid extraction with equal volume of n-hexane-95% methanol, performing reverse phase silica gel column chromatography, eluting with methanol and water as solvents, eluting the part with methanol-water ratio of 65:35, and separating and purifying by semi-preparative HPLC to obtain compounds 5 and 6.