CN108126197A - Chemical coupling product of TNF-α mutain and KLH, CTB, OVA, BSA and preparation method thereof - Google Patents

Abstract

" chemical coupling product of TNF alpha muteins and KLH, CTB, OVA, BSA and preparation method thereof " of the invention provides target tumor necrosin ＆（TNF‑α）Proteantigen of vaccine preparation and its preparation method and application.Specifically, the proteantigen of " chemical coupling product of TNF alpha muteins and KLH, CTB, OVA, BSA and preparation method thereof " of the invention includes the hTNF alpha-mutants albumen of recombinant expression and different carrier proteins（KLH, CTB, OVA and BSA）The two is coupled with glutaraldehyde, and uses formalin-inactivated.After the proteantigen is shared with aluminum hydroxide adjuvant, there is strong immunogenicity, mouse can be excited to generate the immune response for being significantly directed to people TNF α.

Description

The chemical coupling product and its preparation of TNF-α mutain and KLH, CTB, OVA, BSA Method

Technical field

The invention belongs to biology and field of medicaments, more particularly to low bioactivity but with strongly immunogenic tumour Necrosin ＆（TNF-α）The preparation method and purposes of vaccine.The antigen that the present invention is prepared into hardly have TNF-α toxicity, but But there is strong immunogenicity in Mice Body.

Background technology

Tumor necrosis factor-alpha (TNF-α) as a kind of important immunoregulatory molecules, growth, differentiation in cell with And it plays an important role in the physiology such as death and pathologic process.TNF-α is a kind of mainly by monocyte or macrophage production Raw cell factor can not only selectively kill certain tumour cells, and there are many immunoloregulation functions.Recent study It was found that a variety of human diseases are related with the expression height of internal TNF-α, such as the autoimmune disease such as rheumatoid arthritis Disease and malignant tumour etc..The function of TNF-α is inhibited to have been found effectively treat above-mentioned disease.In fact, past 10 years -15 Nian Zhong, 5 kinds of TNF-α inhibitor of U.S. FDA approved include rheumatoid arthritis, psoriasis, rigid spine for treating The autoimmune diseases such as inflammation, Crohn disease.The all monoclonal antibodies of these inhibitor, including Remicade, Humira, Simponi, Cimzia and Enbrel.These drugs are current biological agents best-selling in the world.2014, Humira, The sales volume of Remicade and Enbrel respectively reaches 125.4 hundred million dollars, 92.4 hundred million dollars and 85.38 hundred million dollars.

Monoclonal antibody drug has the shortcomings that, big including dosage（100 mg）, using frequent（2-4 times/moon）, Somewhat expensive and the antibody that can develop immunity to drugs, therefore can be used for a long time only less than 10% patient in China.Prevention type Vaccine is greatest invention in human medical's history, and life up to a million has been saved in eighties of last century.It is directed in recent years certainly The therapeutic type vaccine of body protein also rapidly develops, and hyperlipidemia, hypertension, obesity, autoimmunity are directed to having more than 20 at present The vaccine of the property chronic diseases such as disease and tumour enters clinical test.Compared with monoclonal antibody, vaccine dosage is few（100 ug）, using infrequently（2-3 times/year）, expense is relatively low and the antibody that do not develop immunity to drugs.Therefore research and development target TNF-α Vaccine is considered while the effect for keeping antibody drug treatment disease, can effectively solving the various of monoclonal antibody drug and lacking Point.

Current a variety of vaccines using TNF-α as target spot have proceeded to different phase treatments.Due to Mechanism of immunotolerance Presence, the independent injecting immune of autologous protein can not inducing antibodies.External source Th epitopes are provided for autologous protein to have been demonstrate,proved Effectively break immune can be helped to be resistant in fact, assign autologous protein immunogenicity.It is non-natural by being inserted into mTNF- alpha molecules Nitrotyrosine is so as to introduce the Th epitopes of external source.As a result confirm that the antigen can successfully break the immune tolerance of mouse, induction production The raw neutralizing antibody for mTNF- α.But the antigen built with this method, TNF-α retain bioactivity, therefore it is immune when meeting Cause side effect.HTNF- α are passed through glutaraldehyde chemical coupling to carrier protein keyhole limpet hemocyanin by Le Buanec in 2006 etc. On (keyhole limpet emocyanin, KLH), the activity of TNF-α can be effectively inactivated by formaldehyde.But regrettably, The antigen not can induce the neutralizing antibody for hTNF- α of generation in II clinical trial phases.Therefore new be directed to is developed The vaccine of TNF-α is of great significance, and the preparation of these vaccines needs solve two problems：（1）The biology for removing TNF-α is living Property reduces the toxic side effect of antigen；（2）Retain the immunogenicity of antigen, can effectively induce generate the anti-of neutralization TNF-α in vivo Body.

Individual amino acid residue on hTNF- α albumen influences its life activity.This research department's early-stage study is found, in ammonia 87 and 145 progress amino acid substitutions of base acid sequence（Y87H/A145R）Afterwards, the bioactivity of mutain is relative to wild The 0.000897% of type hTNF- α, i.e., activity is almost lost, but its immunogenicity is with the phase of wild type hTNF- α in Mice Body When.Therefore the mutain is an extraordinary antigen, available for TNF-α vaccine design.

KLH（Keyhole Limpet Hemocyanin）, i.e. hemocyanin is in certain mollusks, arthropod （Spider and beetle）Hemolymph in a kind of free blue respiratory pigment for finding.Hemocyanin is directly connected to more containing two The copper ion of peptide chain, similar with iron-containing hemoglobin, it is easy to oxygen combination, is also easily dissociated with oxygen, be it is known it is only can be with The cuprein of oxygen Reversible binding, in dark green during oxidation, when reduction, is white.Its molecular weight 450000~130000.Due to KLH There is higher immunogenicity, thus be the carrier protein being most often selected.In terms of TNF-α vaccine design, Le in 2006 HTNF- α are passed through glutaraldehyde chemical coupling to carrier protein keyhole limpet hemocyanin (keyhole limpet by Buanec etc. Emocyanin, KLH) on, the activity of TNF-α can be effectively inactivated by formaldehyde.But regrettably, the antigen is in II phases clinic The neutralizing antibody for hTNF- α of generation is not can induce in experiment.HTNF- alpha muteins are coupled to completely by this research Antigen is built on KLH, and detects immunogenicity of the antigen in Mice Body.

BSA（Bovine Serum Albumin）, i.e. bovine serum albumin(BSA) belongs to most stable of and soluble albumin. Its molecular weight is 67 kDa（Contain 59 Lys）.About 30-35 main amino can be used for occurring to be conjugated with linking agent anti- It should so that BSA becomes a kind of popular poor antigen compound carrier albumen.BSA is disadvantageous in that in many experiments, It is taken as sealer to use, if the antiserum of polypeptide-BSA conjugate is in such detection and analysis, it will usually occur False positive, because these serum contain the antibody of anti-BSA.The correlative study of BSA coupling TNF-α has not been reported.This research will HTNF- alpha muteins, which are coupled on complete BSA, is built into antigen, and detects immunogenicity of the antigen in Mice Body.

B subunit of cholera toxin（CTB）It can be with the GM1 nerve glucosides of the nuclear of epidermal cells leukocyte surface in mucous layer Receptor combines.B subunits have very strong immunoregulation effect, it by capture lymphocyte in mucous membrane and macrophage from And the antigen minimum essential requirement amount of activation immune response is reduced, so as to which antigen be promoted to cause mucosal immune response.Therefore, CTB is One good vaccine carrier.The correlative study of CTB coupling TNF-α has not been reported.HTNF- alpha muteins are coupled by this research Antigen is built on to complete CTB, and detects immunogenicity of the antigen in Mice Body.

Chicken ovalbumin（ovalbumin, OVA）Also referred to as chicken ovalbumin is made of 386 aa, molecular weight about 43Kd. In prepared by the production of various vaccines and biological medicament, OVA is used to improve the steady of biological medicament or vaccine etc. frequently as protein additive Coupling that is qualitative or being used for haptens as carrier protein in antibody preparation process, is also used frequently as Protein Marker In electrophoresis or chromatography.The correlative study of OVA coupling TNF-α has not been reported.HTNF- alpha muteins are coupled to by this research Antigen is built into, and detect immunogenicity of the antigen in Mice Body on complete OVA.

Invention content

It is an object of the present invention to provide a kind of protein vaccine of the anti-tnf-alpha containing adjuvant, including TNF-α antigen, KLH, CTB, OVA, BSA and liquid adjuvant.

Specifically, the albumen that humanTNF-α is mutated in Y87H/A145R（hTNF-YA）It is the recombination egg that recombinant expression obtains In vain, as carrier protein, liquid adjuvant is aluminum hydroxide adjuvant by KLH, CTB, OVA and BSA.

It is a further object to provide the preparation method of the protein vaccine of anti-tnf-alpha of the production containing adjuvant, steps Suddenly include genetic recombination and obtain anti-human TNF-α, with chemical coupling agent by humanTNF-α and carrier protein（KLH, CTB, OVA and BSA） Chemical coupling, to antigens inactive, last adding liquid adjuvant.

Specifically, chemical coupling agent is glutaraldehyde of the band there are two active aldehyde radical, and the bacteriotoxin of coupling is for making The tetanus toxin of tetanus vaccine, safety are reliable.

It is a still further object of the present invention to provide a kind of method for the immunogenicity for enhancing anti-tnf-alpha vaccine, including step： （1）Using TNF-α holoprotein, rich in linear and nonlinear B cell epitope；（2）KLH, CTB, OVA and BSA are introduced, as carrier Albumen, can effectively delivery of antigens to MHC classes molecule still；（3）Adjuvant aluminum hydroxide is introduced, is ripe human body adjuvant, pacifies Full property is reliable.

The present invention also provides the purposes of this anti-tnf-alpha vaccine containing adjuvant.

Compare and the prior art, humanTNF-α and complete KLH, CTB, OVA and BSA are coupled by the present invention, and to antigen into Row inactivation, finally adds safe adjuvant aluminum hydroxide.On the basis of toxic side effect is not caused, vaccine can induce body generation Effective immune response, so as to for TNF-α relevant disease, including rheumatoid arthritis, Crohn disease, psoriasis and tatanic The offers such as rachitis treatment basis.Above-mentioned vaccine may significantly improve the immunogenicity of vaccine, excite strong immune response, from And extend the life cycle of patient, quality of making the life better.

It should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the invention and below（Such as embodiment）In specifically retouch It can be combined with each other between each technical characteristic stated, so as to form new or preferred technical solution.As space is limited, herein not Tire out one by one again and state.

Description of the drawings

Fig. 1 shows that hTNF-KLH vaccines can generate the significant antibody response for being directed to hTNF- α in Mice Body.The knot Fruit illustrates that prepared vaccine has preferable immunogenicity.

Fig. 2 shows that hTNF-CTB vaccines can generate the significant antibody response for being directed to hTNF- α in Mice Body.The knot Fruit illustrates that prepared vaccine has preferable immunogenicity.

Fig. 3 shows that hTNF-OVA vaccines can generate the significant antibody response for being directed to hTNF- α in Mice Body.The knot Fruit illustrates that prepared vaccine has preferable immunogenicity.

Fig. 4 shows that hTNF-BSA vaccines can generate the significant antibody response for being directed to hTNF- α in Mice Body.The knot Fruit illustrates that prepared vaccine has preferable immunogenicity.

Specific embodiment

The present invention after extensive and in-depth study, has found humanTNF-α's albumen and KLH, CTB, OVA and BSA chemistry is even Connection, after formalin-inactivated, antigen remains with immunogenicity, and mouse can effectively be excited to generate the antibody for humanTNF-α.Herein On the basis of complete the present invention.

Representative albumen

Tumor necrosis factor α (TNF-α)

Tumor necrosis factor α (tumor necrosis factor alpha) is mainly thin by the monocyte or macrophage that are activated Intracrine is also one of cell factor for causing acute phase response while Systemic inflammation is participated in.

Single TNF-α molecule is made of two β-pleated sheet lamellas, and wherein each is that outside hydrophilic amino acid enriches and interior Side hydrophobic amino acid enriches.Three monomer TNF-α form tripolymer, form hydrophobic amino acid duct, significant difference among it In both ends polar amino acid.The N-terminal of monomer molecule and C-terminal occur in monomer molecule at the top of tripolymer in tripolymer bottom Portion's disulfide bond.Trimeric form is the basis of its bioactivity.

HumanTNF-α's amino acid sequence（CAD20719）It is as follows：

1 MVRSSSRTPS DKPVAHVVAN PQAEGQLQWL NRRANALLAN

41 GVELRDNQLV VPSEGLYLIY SQVLFNNFTV SFWLRVPKVS

81 ASHLEVSYQT KVNLLSAIKS PCQRETPEGA EAKPWYEPIY

121 LGGVFQLEKG DRLSAEINRP DYLDFAESGQ VYFGIIAL

Composition and method of administration

The present invention also provides a kind of compositions, it contains：(i) humanTNF-α's albumen of the invention and complete tetanus toxin Coupled product hTNF-KLH, hTNF-CTB, hTNF-BSA, hTNF-OVA and (ii) is learned pharmaceutically or in immunology to be subjected to Excipient or adjuvant.

In the present invention, term " containing " represents that various composition can be applied to or be present in together in the composition of the present invention. Therefore, term " mainly by ... form " and " consist of " are included in term " containing ".

The composition of the present invention includes pharmaceutical composition and vaccine composition.

The composition of the present invention can be monovalent (mutational site or polynucleotides there are one containing only) or multivalence (containing multiple mutational sites or a variety of single mutation sites protein combination or polynucleotides).

The pharmaceutical composition or vaccine composition of the present invention can be prepared into various regular dosage forms, including (but it is and unlimited In)：Injection, granula, tablet, pill, suppository, capsule, suspension, spray etc..

(1) pharmaceutical composition

The pharmaceutical composition of the present invention includes hTNF-KLH, hTNF-CTB, hTNF- of the present invention of (or containing) therapeutically effective amount BSA、hTNF-OVA。

The term as used herein " therapeutically effective amount " refers to therapeutic agent treatment, the amount for alleviating or preventing target disease or situation, Or show the detectable amount for treating or preventing effect.The effect can be detected for example, by antigen levels.Therapeutic effect Also include the reduction of physical symptoms.For certain an object accurate effective quantity depend on the object build and health status, The combination of therapeutic agent and/or therapeutic agent that the property and degree of illness and selection are given.Therefore, preassigning accurately has Effect amount is useless.However, for the situation that Mr. Yu gives, the effective quantity can be determined with routine experiment.

For the purposes of the present invention, effective dosage for give individual about 0.001 mg/kg to 1000 milligrams/ Kilogram, 0.01 mg/kg is preferably about to the mutain of 100 mg/kg weight.

Pharmaceutical composition can also contain pharmaceutically acceptable carrier.Term " pharmaceutically acceptable carrier " refers to control Treat the carrier that agent (hTNF-TT of the invention) is administered.The term refers to some such medicament carriers：Themselves does not induce production The raw antibody being harmful to the individual for receiving the composition, and there is no excessive toxicity after being administered.Suitable carrier can be it is big, It is metabolized slow macromolecular, such as protein, polysaccharide, polylactic acid (polylactic acid), polyglycolic acid.These carriers are Well known to those of ordinary skill in the art.In Remington ' s Pharmaceutical Sciences (Mack Pub. Co., N.J. 1991) in can find discussing fully about pharmaceutically acceptable carrier or excipient.

The upper acceptable carrier of combination of traditional Chinese medicine may include liquid, such as water, brine, glycerine and ethyl alcohol.In addition, these are carried There is likely to be complementary substances, such as wetting agent or emulsifier, pH buffer substances in body.In general, composition can be made Injectable agent, such as liquid solution or suspension；It may also be fabricated which and be suitble to supplying solution or suspension, liquid excipient before the injection Solid form.Liposome is also included in the definition of pharmaceutically acceptable carrier.

(ii) vaccine composition

The vaccine (composition) of the present invention can be preventative (preventing disease) or therapeutic (disease be treated after illness Disease).

These vaccines include immunising antigen (including hTNF-KLH, hTNF-CTB, hTNF-BSA, hTNF- of the present invention OVA it), and is usually combined with " pharmaceutically acceptable carrier ", these carriers are generated including itself not inducing to receiving the group Close any carrier of antibody that the individual of object is harmful to.Suitable carrier is typically big, is metabolized slow macromolecular, such as albumen Matter, polysaccharide, polylactic acid, polyglycolic acid, amino acid polymer, amino acid copolymer, lipid aggregates (such as oil droplet or liposome) Deng.These carriers are well known to those of ordinary skill in the art.In addition, these carriers can play immunostimulant (" adjuvant ") work With.

The preferred adjuvant of enhancing immune composition effect includes but not limited to：(1) aluminium salt (alum), such as aluminium hydroxide, phosphorus Sour aluminium, aluminum sulfate etc.；(2) oil-in-water emulsion formula, such as：(a) MF59 (referring to WO 90/14837), (b) SAF,

(c) RibiTM adjuvant systems (RAS) (Ribi Immunochem, Hamilton, MT) (3) saponin adjuvant； (4) Freund Freund's complete adjuvants (CFA) and Freund Freund's incomplete adjuvants (IFA)；(5) cell factor, as interleukin (such as IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 etc.), interferon (such as interferon), macrophage colony stimulating factor (M- CFS) etc.；(6) the detoxification variant of bacterial ADPribosylating toxin (such as E.coli LT LT)；And (7) Enhance the other materials of composition effect as immunostimulant.

Including immunogenic composition vaccine composition (such as, it may include antigen, pharmaceutically acceptable carrier And adjuvant), usually contain diluent, such as water, brine, glycerine, ethyl alcohol etc..In addition, auxiliary substances, such as wetting agent or emulsification Agent, pH buffer substances etc. may be present in this kind of carrier.More specifically, the vaccine including immunogenic composition, packet Immunogenic polypeptide and above-mentioned other required components containing immunological effective amount." immunological effective amount " refer to single dose or The amount that a continuous agent part gives individual is effective to treating or preventing.The dosage can be according to the health status for treating individual With physiological status, treat individual classification (such as people), the ability of individual immunity system synthesis antibody, required degree of protection, Depending on the preparation of vaccine, treating physician are to the assessment of medical conditions and other correlative factors.It is expected that the dosage will be relatively In wide range, it can be determined by routine experiment.

In general, injectable agent, such as liquid solution or suspension can be made in vaccine composition or immunogenic composition；Also It can be made into and be suitble to supplying solution or suspension, the solid form of liquid excipient before the injection.Said preparation is also emulsifiable or is encapsulated in In liposome, to enhance adjuvant effect.

In addition, the vaccine composition of the present invention can be unit price or polyvaccine.

(iii) administration route and dosage

Once being configured to the composition of the present invention, it can be directly given to object.Object to be treated can be mammal, especially It is people.

When as vaccine, can the mutain of the present invention be directly applied to individual by known method.Generally use The administration method and/or simulation pathogenic infection path identical with conventional vaccine applies these vaccines.

The approach for giving pharmaceutical composition or vaccine composition of the present invention includes (but being not limited to)：Intramuscular, subcutaneous, skin Interior, intrapulmonary, intravenous, intranasal, by oral administration or other parenteral route of administration.It if desired, can be with combination medicine-feeding approach or root It is adjusted according to disease event.Vaccine composition can be given with single dose or multi-dose, and can include give booster with Cause and/or maintain immunity.Mutain vaccine should be given with " effective quantity ", i.e., the amount of mutain is in selected administration Immune response is adequate to bring about in path, can effectively promote that host is protected to resist relevant disease.

Representative disease includes (but being not limited to)：Rheumatoid arthritis, psoriasis, inflammatory enteritis etc..

The amount of selected antigen protein in each vaccine dose part, be by can cause protective immune response and without apparent Depending on the amount of side effect.In general, after host cell is infected, each dose of vaccine is enough containing about 1 μ g-1000mg, preferably 1 μ g-100mg, more preferably 10 μ g-50mg protein.It can use and include observing IgG titers and other reactions in object Standard research techniques determine the optimum amount of specific vaccine.It can be determined whether by monitoring the immunity level of vaccine offer It needs to enhance dosage.After the IgG titers in having evaluated serum, it may be necessary to select enhancing dose immunizations.Using assistant Agent and/or immunostimulant can improve the immune response of the protein to the present invention.

Preferred method is to give immunogenic composition from parenteral (subcutaneously or intramuscularly) approach by injection.

In addition, the vaccine of the present invention can together be given or with reference to other immunomodulators together with other therapeutic agents It gives.

The first aspect of the present invention provides a kind of method of the immunogenicity for the protein vaccine for strengthening anti-tnf-alpha.It should The principle of method is：（1）Using complete humanTNF-α's albumen as antigen component, there are more B cell epitopes；（2）It introduces KLH, CTB, BSA, OVA, can be effectively on present antigens to MHC class molecules as carrier protein, and immunity of organism tolerance is broken in help, The immunogenicity of enhancement antigen；（3）Aluminium hydroxide is widely used immunologic adjuvant in human body, can enhance Th2 immune responses, lure Antibody is given birth in artificial delivery, and safety is reliable.

The second aspect of the present invention provides a kind of protein vaccine of anti-tnf-alpha.The vaccine using the present invention first Method described in aspect is designed.In Vaccine molecules, humanTNF-α contains multiple B cell epitopes, and humanTNF-α is in Y87H/ The albumen of A145R mutation can effectively remove toxicity, and in order to describe conveniently, in embodiment, the present invention uses the mutain “hTNF-YA”

The third aspect of the present invention, provides a kind of method for the protein vaccine for producing anti-tnf-alpha, and manufacturing method is as follows：

1 hTNF-YA is gene constructed, Protein expression and purification

Using pET28a-SUMO-hTNF- α plasmids as template, PCR amplification is carried out with primer Y87H-R and T7-F, is obtained The upper genetic fragments of hTNFY87H-；PCR amplification is carried out with primer Y87H-F and T7-R, obtains genetic fragment under hTNFY87H-.PCR Product carries out electrophoresis detection and gel recycling.Genetic fragment under genetic fragment on the hTNFY87H- of recycling and hTNFY87H- is made For template, add in T7-F primers and T7-R primers carry out PCR reactions.PCR product carries out electrophoresis detection, obtained electrophoretic band position It puts between 1000 bp to 1200 bp, meets 1100 bp of theoretical value of the Y87H genes with SUMO labels；Specific band It is recycled from gel, obtains hTNFY87H genetic fragments.

Using hTNFY87H genetic fragments as template, PCR amplification is carried out with primer A145R-R and T7-F, obtains hTNFY87H/ The upper genetic fragments of A145R-；PCR amplification is carried out with primer A145R-F and T7-R, obtains gene piece under hTNFY87H/A145R- Section.PCR product is recycled by electrophoresis detection and gel.By genetic fragment and hTNFY87H/ on the hTNFY87H/A145R- of recycling Genetic fragment adds in T7-F primers and T7-R primers carries out PCR reactions as template under A145R-.PCR product carries out electrophoresis inspection It surveys, obtained electrophoretic band position meets the Y87H/A145R genes with SUMO labels between 1000 bp to 1200 bp 1100 bp of theoretical value；Specific band is recycled from gel, obtains hTNFY87H/A145R genetic fragments.

Linearization process is carried out to pET28a empty plasmids with restriction endonuclease BamH I and Nde I：50 μ L of reaction system, condition It it is 37 DEG C, 4 h, digestion products carry out detected through gel electrophoresis, as a result show that band is located at 5200 bp-5500 bp, meet The position of expected size, is recycled, the pET28a plasmids linearized from Ago-Gel after pET28a plasmid linearizations.

Take 2 μ L ExnaseTm II, 4 μ L, 5 CE II buffer, 60 ng of linearisation pET28a plasmids（2μL）, 120 ng of hTNFY87H/A145R genetic fragments（6μL）, reaction system adds ddH2O to complement to 20 μ L, 37 DEG C of 30 min of incubation, It is spare that it is placed in 5 min on ice immediately after.5 μ L homologous recombinations reaction solutions and 100 μ L E. Coli DH5 α are experienced by method 5 State cell is operated, and 300 μ L culture solutions is then taken to be coated with LB solid plates, and 37 DEG C are inverted culture 15 hours, and discovery grows white Color bacterium colony, picking monoclonal bacterium colony culture.Plasmid in extracting culture bacterium solution, and add in the system containing T7-F, T7-R, it carries out PCR reactions and electrophoresis detection PCR product find there is the bright band of specificity between 1000 bp to 1200 bp, meet band The expection size (about 1100 bp) of the hTNFY87H/A145R genes of SUMO protein gene.Above-mentioned specific band to occur Monoclonal bacterium solution send Nanjing Genscript Biotechnology Co., Ltd. to be sequenced, and sequence is correct, obtains pET28a-SUMO-hTNFY87H/ A145R plasmids.

The correct strain of above-mentioned sequencing is taken to correspond to 1 μ L of plasmid, it is thin that heat shock method converts 50 μ L E. Coli BL21 competence Born of the same parents take 300 μ L in LB solid plates（Kan 50 μg/mL）Coating is uniform, 37 DEG C of inversion overnight incubations.Picking monoclonal is inoculated with In 25 mL LB culture mediums（Kan 50 μg/mL）, 37 DEG C, 180 r/min shaking overnight incubations.1 will be pressed by bacterium overnight:500（v: v）It is forwarded to 2L TB culture mediums（Kan 50 μg/mL）, 37 DEG C, 200 r/min shaking culture 4-5h, when OD600nm reaches The 1 mol/L IPTG, 25 DEG C, 180 r/min shaking culture 20-24 h of 1mL is added in when 0.6.8000 r/min of room temperature centrifugations 5 Min collects thalline and weighs.

Every 1 g thalline are fully resuspended in 20 mL sample-loading buffers（500 mmol/L NaCl, 20 mmol/L Tris, 20 Mmol/L Imidazole, pH 8.0）Carry out ultrasonic cracking.Ultrasound condition is set：Ultrasonic 3s stops 5s, power 1%, time 10 min.Ultrasonic 4 DEG C of liquid, 12000 r/min take supernatant spare after centrifuging 40 min.By Ni-IDA affinity column equilibrium liquids （500 mmol/L NaCl, 20 mmol/L Tris, pH 8.0）It rinses more than 10 column volumes until baseline punching is flat.Supernatant With 2 mL/min flow velocity loadings, then with washing miscellaneous liquid（500 mmol/L NaCl, 20 mmol/L Tris, 50 mmol/L Imidazole, pH 8.0）20 column volumes are rinsed to ultraviolet peak stabilization and less than 20mAU, use eluent（500 mmol/L NaCl, 20 mmol/L Tris, 500 mmol/L Imidazole, pH 8.0）Albumen is eluted, when ultraviolet peak rises to 50mAU When start to collect, and when 50mAU is re-lowered to stop collect.

By SUMO protease（2mg/mL）With protein eluate by volume 1:After 100 abundant mixings, in bag filter （3.5 kDa apertures, purchased from Thermo companies）, bag filter is placed in 4L PBS（0.01 mol/L Na2HPO4,0.002 mol/ L KH2PO4,0.137 mol/L NaCl, 0.0027 mol/L KCl, pH 7.4）In 4 DEG C dialysis.One was replaced every 12 hours Secondary PBS（0.01 mol/L Na2HPO4,0.002 mol/L KH2PO4,0.137 mol/L NaCl, 0.0027 mol/L KCl, pH 7.4）Solution is repeated 2 times.Whether detection digestion in the 12nd hour is abundant after last time replaces solution.Take dialysis sample 40 μ L add in 10 μ L 5 denaturation reduction buffer solutions, carry out boiling water bath again five minutes after abundant mixing, carry out 12% SDS-PAGE eggs White appliances are swum, 10 μ L of loading, concentrate 90 V electrophoresis of glue, later 120 V of voltage, total time about 90min, the preparation of protein adhesive And Running buffer are prepared with reference to Bio-Rad standard recipes.Determine that proteolytic cleavage is complete after coomassie brilliant blue staining, again Prepared Ni-IDA affinity columns, AKTA connection methods are with preparation of reagents according to method 8.With 2 mL/min flow velocity loadings, when Ultraviolet peak starts to collect when rising to 40mAU, and stops collecting when 40mAU is re-lowered to.

It takes and flows through 40 μ L of peak and add in the 10 μ L 5 denaturation reduction abundant mixings of buffer solution, carry out 5 min of boiling water bath.It will Sample progress SDS-PAGE electrophoresis detections after above-mentioned processing, 10 μ L of loading, resolving gel concentration 12%, preceding 90 V of 20min voltages, it 120 V of voltage afterwards, total time about 90min, the preparation of protein adhesive and denaturation reduction buffer are matched with reference to Bio-Rad standards Side.After coomassie brilliant blue staining purity of protein is analyzed with gel imaging system embedded software.Using BCA sizing techniques, using 3kD holes The super filter tube of diameter is concentrated.Until destination protein concentration is adjusted into most 0.5-1mg/mL.In super-clean bench, by what is prepared Protein solution often pipe 1mL be dispensed into 1.5mL EP pipes freeze in -70 DEG C of refrigerators in case subsequent experimental use.

Each primer used in this part is synthesized by Nanjing Genscript Biotechnology Co., Ltd.（Such as following table）：

Primer Sequence 5 ' -3 '

T7-F TAATACGACTCACTATAGGG

T7-R GCTAGTTATTGCTCAGCGG

Y87H-F CGCCGTCTCCCACCAGACCAAGG

Y87H-R CCTTGGTCTGGTGGGAGACGGCG

A145R-F CTTTCGCGAGTCTGGGCAGG

A145R-R CCTGCCCAGACTCGCGAAAG

2 CTB are gene constructed, Protein expression and purification

It is ground using the pSJF2 universal support pCTB2 containing CTB genes built as skeleton plasmid from Jiangsu Province's traditional Chinese medicine Study carefully institute's cell and Molecular Biology Lab.PCR amplification is carried out with primer CTB-R and CTB-F, obtains CTB genetic fragments.PCR Product carries out electrophoresis detection and gel recycling, obtains CTB genetic fragments.

Linearization process is carried out to pET28a empty plasmids with restriction endonuclease BamH I and Nde I：50 μ L of reaction system, condition It it is 37 DEG C, 4 h, digestion products carry out detected through gel electrophoresis, as a result show that band is located at 5200 bp-5500 bp, meet The position of expected size, is recycled, the pET28a plasmids linearized from Ago-Gel after pET28a plasmid linearizations.

Take 2 μ L ExnaseTm II, 4 μ L, 5 CE II buffer, 60 ng of linearisation pET28a plasmids（2μL）, CTB 120 ng of genetic fragment（6μL）, reaction system adds ddH2O to complement to 20 μ L, and 37 DEG C of 30 min of incubation are placed in ice immediately after Upper 5 min is spare.5 μ L homologous recombinations reaction solutions and 100 μ L E. Coli DH5 α competent cells are operated by method 5, Then 300 μ L culture solutions is taken to be coated with LB solid plates, 37 DEG C are inverted culture 15 hours, and discovery grows white colony, picking Dan Ke Grand bacterium colony culture.Plasmid in extracting culture bacterium solution, and add in the system containing T7-F, T7-R, carry out PCR reactions and electrophoresis inspection Survey PCR product.Nanjing Genscript Biotechnology Co., Ltd. is sent to be sequenced the monoclonal bacterium solution for above-mentioned specific band occur, sequence Row are correct, obtain pET28a-SUMO- CTB plasmids.

The correct strain of above-mentioned sequencing is taken to correspond to 1 μ L of plasmid, it is thin that heat shock method converts 50 μ L E. Coli BL21 competence Born of the same parents take 300 μ L in LB solid plates（Kan 50 μg/mL）Coating is uniform, 37 DEG C of inversion overnight incubations.Picking monoclonal is inoculated with In 25 mL LB culture mediums（Kan 50 μg/mL）, 37 DEG C, 180 r/min shaking overnight incubations.1 will be pressed by bacterium overnight:500（v: v）It is forwarded to 2L TB culture mediums（Kan 50 μg/mL）, 37 DEG C, 200 r/min shaking culture 4-5h, when OD600nm reaches The 1 mol/L IPTG, 25 DEG C, 180 r/min shaking culture 20-24 h of 1mL is added in when 0.6.8000 r/min of room temperature centrifugations 5 Min collects thalline and weighs.

Every 1 g thalline are fully resuspended in 20 mL sample-loading buffers（500 mmol/L NaCl, 20 mmol/L Tris, 20 Mmol/L Imidazole, pH 8.0）Carry out ultrasonic cracking.Ultrasound condition is set：Ultrasonic 3s stops 5s, power 1%, time 10 min.Ultrasonic 4 DEG C of liquid, 12000 r/min take supernatant spare after centrifuging 40 min.By Ni-IDA affinity column equilibrium liquids （500 mmol/L NaCl, 20 mmol/L Tris, pH 8.0）It rinses more than 10 column volumes until baseline punching is flat.Supernatant With 2 mL/min flow velocity loadings, then with washing miscellaneous liquid（500 mmol/L NaCl, 20 mmol/L Tris, 50 mmol/L Imidazole, pH 8.0）20 column volumes are rinsed to ultraviolet peak stabilization and less than 20mAU, use eluent（500 mmol/L NaCl, 20 mmol/L Tris, 500 mmol/L Imidazole, pH 8.0）Albumen is eluted, when ultraviolet peak rises to 50mAU When start to collect, and when 50mAU is re-lowered to stop collect.

By SUMO protease（2mg/mL）With protein eluate by volume 1:After 100 abundant mixings, in bag filter （3.5 kDa apertures, purchased from Thermo companies）, bag filter is placed in 4L PBS（0.01 mol/L Na2HPO4,0.002 mol/ L KH2PO4,0.137 mol/L NaCl, 0.0027 mol/L KCl, pH 7.4）In 4 DEG C dialysis.One was replaced every 12 hours Secondary PBS（0.01 mol/L Na2HPO4,0.002 mol/L KH2PO4,0.137 mol/L NaCl, 0.0027 mol/L KCl, pH 7.4）Solution is repeated 2 times.Whether detection digestion in the 12nd hour is abundant after last time replaces solution.Take dialysis sample 40 μ L add in 10 μ L 5 denaturation reduction buffer solutions, carry out boiling water bath again five minutes after abundant mixing, carry out 12% SDS-PAGE eggs White appliances are swum, 10 μ L of loading, concentrate 90 V electrophoresis of glue, later 120 V of voltage, total time about 90min, the preparation of protein adhesive And Running buffer are prepared with reference to Bio-Rad standard recipes.Determine that proteolytic cleavage is complete after coomassie brilliant blue staining, again Prepared Ni-IDA affinity columns, AKTA connection methods are with preparation of reagents according to method 8.With 2 mL/min flow velocity loadings, when Ultraviolet peak starts to collect when rising to 40mAU, and stops collecting when 40mAU is re-lowered to.

It takes and flows through 40 μ L of peak and add in the 10 μ L 5 denaturation reduction abundant mixings of buffer solution, carry out 5 min of boiling water bath.It will Sample progress SDS-PAGE electrophoresis detections after above-mentioned processing, 10 μ L of loading, resolving gel concentration 12%, preceding 90 V of 20min voltages, it 120 V of voltage afterwards, total time about 90min, the preparation of protein adhesive and denaturation reduction buffer are matched with reference to Bio-Rad standards Side.After coomassie brilliant blue staining purity of protein is analyzed with gel imaging system embedded software.Using BCA sizing techniques, using 3kD holes The super filter tube of diameter is concentrated.Until destination protein concentration is adjusted into most 0.5-1mg/mL.In super-clean bench, by what is prepared Protein solution often pipe 1mL be dispensed into 1.5mL EP pipes freeze in -70 DEG C of refrigerators in case subsequent experimental use.

Each primer used in this part is synthesized by Nanjing Genscript Biotechnology Co., Ltd.（Such as following table）：

Primer Sequence 5 ' -3 '

T7-F TAATACGACTCACTATAGGG

T7-R GCTAGTTATTGCTCAGCGG

CTB-F CCGGAA TTCA TGATT AAAT TAAAAT T TG

CTB -R CCGCTCGAGATCT TAA TT TGCCA TAC

It is prepared by 3 hTNF-YA-KLH antigens：It is coupled using bifunctional coupling agent glutaraldehyde.The hTNF- of above-mentioned recombinant expression The α and KLH of commercialization（Purchased from Sigma, Inc.）After being dissolved in PBS, the mixing in bottle is coupled slowly is dripped into mixed liquor Add 0.25% glutaraldehyde solution, in 4 oC react 4 hours, then reaction solution in 4 oC to PBS dialyse, obtain chemical coupling hTNF-KLH。

It is prepared by 4 hTNF-YA-CTB antigens：It is coupled using bifunctional coupling agent glutaraldehyde.Above-mentioned recombinant expression After hTNF- α and CTB are dissolved in PBS, the mixing in bottle is coupled 0.25% glutaraldehyde solution is slowly added dropwise into mixed liquor, in 4 OC reacts 4 hours, and then reaction solution dialyses to PBS in 4 oC, obtains the hTNF-CTB of chemical coupling.

It is prepared by 5 hTNF-YA-OVA antigens：It is coupled using bifunctional coupling agent glutaraldehyde.Above-mentioned recombinant expression The hTNF- α and OVA of commercialization（Purchased from Sigma, Inc.）After being dissolved in PBS, the mixing in bottle is coupled, into mixed liquor slowly 0.25% glutaraldehyde solution of dropwise addition, in 4 oC react 4 hours, then reaction solution in 4 oC to PBS dialyse, obtain chemical coupling HTNF-OVA.

It is prepared by 6 hTNF-YA-BSA antigens：It is coupled using bifunctional coupling agent glutaraldehyde.Above-mentioned recombinant expression The hTNF- α and BSA of commercialization（Purchased from Sigma, Inc.）After being dissolved in PBS, the mixing in bottle is coupled, into mixed liquor slowly 0.25% glutaraldehyde solution of dropwise addition, in 4 oC react 4 hours, then reaction solution in 4 oC to PBS dialyse, obtain chemical coupling HTNF-BSA.

7 collect antigen：Use cutoff value at least 100 kDa（It is preferred that 300 kDa）Filter membrane carry out tangential flow filtration, make It obtains molecular weight and is less than 100 kDa（It is preferred that 300 kDa）Substance removed from the product.

8 animal immunes：The SPF grades BALB/c mouse of female 6-8 week old purchased from dimension tonneau North China capital company, and according to AAALAC guidelines are raised.Before immune, with PBS（0.01 mol/L Na2HPO4,0.002 mol/L KH2PO4, 0.137 mol/L NaCl, 0.0027 mol/L KCl, pH 7.4）By hTNF-KLH, hTNF-CTB, hTNF-OVA, hTNF- BSA is diluted to 0.5 mg/mL, then with aluminum hydroxide adjuvant by volume 1:1 is mixed to 250 μ g/mL of final concentration of protein. 30 mouse, are randomly divided into 3 groups, every group 10, respectively with PBS, hTNF-KLH, hTNF-CTB, hTNF-OVA, hTNF-BSA/ Aluminium hydroxide immunity inoculation.Inoculation method and dosage are：Mouse axillary lymph knot position is chosen 4 points and is subcutaneously injected, often Secondary 200 μ L of every mouse.Booster immunization is primary every two weeks, after third time is 7 days immune, takes blood from each mouse orbit, room temperature is quiet 2 h are put, after 4000 r/min centrifuge 10 min, abandons and precipitates and take -20 DEG C of top serum spare.

9 immune responses detect：With coating buffer solution（50 mmol/L bicarbonate buffers, pH 9.6）By wild type HTNF- α albumen is diluted to a concentration of 100 ng/100 μ L, is then transferred on 96 orifice plate of polystyrene（Add 100 μ L per hole） 4 DEG C of overnight incubations.Use PBST（0.01 mol/L Na2HPO4,0.002 mol/L KH2PO4,0.137mol/L NaCl, 0.0027 mol/L KCl, 0.15% (v:V) Tween-20, pH 7.4）300 μ L board-washings of every hole 6 times, every time 5 minutes.It adds 300 μ L contain 5%（m/v）The confining liquid of skimmed milk power（It is dissolved in PBST）, 37 DEG C are incubated and are closed for 2 hours.Use PBST（0.01 Mol/L Na2HPO4,0.002 mol/L KH2PO4,0.137mol/L NaCl, 0.0027 mol/L KCl, 0.15% (v:v) Tween-20, pH 7.4）300 μ L board-washings of every hole 6 times, 5 minutes every time, then with containing 5%（m/v）The confining liquid of skimmed milk power（It is molten In PBST）The antiserum collected in method 14 is diluted 100 times, adds 100 μ L per hole later, 37 DEG C are incubated 1 hour, use PBST （0.01 mol/L Na2HPO4,0.002 mol/L KH2PO4,0.137mol/L NaCl, 0.0027 mol/L KCl, 0.15% (v:V) Tween-20, pH 7.4）300 μ L board-washings of every hole 6 times, every time 5 minutes.By secondary antibody（Sheep anti mouse-IgG- horseradish peroxides Compound enzyme conjugate）With containing 5%（m/v）The confining liquid of skimmed milk power（It is dissolved in PBST）8000 times of dilution adds in 100 μ L to every hole Secondary antibody after dilution, 37 DEG C are incubated 1 hour.Use PBST（0.01 mol/L Na2HPO4,0.002 mol/L KH2PO4, 0.137mol/L NaCl, 0.0027 mol/L KCl, 0.15% (v:V) Tween-20, pH 7.4）300 μ L board-washings of every hole 6 times, 5 minutes every time.Add 100 μ L substrate solutions TMB per hole（Purchased from green skies company biotechnology）, 15min is placed in 37 DEG C, then The H2SO4 for adding in 25 μ L, 2 mol/L terminates reaction.OD450nm values are measured with microplate reader.

Measure TNF-YA-KLH OD450nm values be：

PBS：0.12、0.12、0.18、0.09、0.14、0.11、0.1、0.09、0.07、0.11

TNF-YA-KLH：1.25、1.36、1.54、1.34、1.35、1.25、1.55、1.94、2.01、1.54

According to above-mentioned OD450nm as a result, making Fig. 1 using 5.0 softwares of GraphPad Prism.As can be known from the results, with wild type HTNF- α albumen is as envelope antigen, when the mouse resisting anteserum of each mutain immune group is incubated as primary antibody, hTNF-KLH Antibody in antiserum can identify wild type hTNF- α albumen, illustrate that the antigen remains immunogenicity.

Measure TNF-YA-CTB OD450nm values be：

PBS：0.12、0.12、0.18、0.09、0.14、0.11、0.1、0.09、0.07、0.11

hTNF-CTB：2.05、2.33、1.86、2.08、2.08、1.98、2.36、2.48、1.99、1.78

According to above-mentioned OD450nm as a result, making Fig. 2 using 5.0 softwares of GraphPad Prism.As can be known from the results, with wild type HTNF- α albumen is as envelope antigen, when the mouse resisting anteserum of each mutain immune group is incubated as primary antibody, hTNF-CTB Antibody in antiserum can identify wild type hTNF- α albumen, illustrate that the antigen remains immunogenicity.

Measure TNF-YA-OVA OD450nm values be：

PBS：0.12、0.12、0.18、0.09、0.14、0.11、0.1、0.09、0.07、0.11

hTNF-OVA：2.34、2.58、2.35、2.34、1.85、1.95、1.75、2.84、2.01、2.05

According to above-mentioned OD450nm as a result, making Fig. 3 using 5.0 softwares of GraphPad Prism.As can be known from the results, with wild type HTNF- α albumen is as envelope antigen, when the mouse resisting anteserum of each mutain immune group is incubated as primary antibody, hTNF-OVA Antibody in antiserum can identify wild type hTNF- α albumen, illustrate that the antigen remains immunogenicity.

Measure hTNF-BSA OD450nm values be：

PBS：0.12、0.12、0.18、0.09、0.14、0.11、0.1、0.09、0.07、0.11

hTNF-BSA：1.85、1.56、1.62、1.88、1.85、1.87、1.58、1.84、2.55、1.88

According to above-mentioned OD450nm as a result, making Fig. 4 using 5.0 softwares of GraphPad Prism.As can be known from the results, with wild type HTNF- α albumen is as envelope antigen, when the mouse resisting anteserum of each mutain immune group is incubated as primary antibody, hTNF-BSA Antibody in antiserum can identify wild type hTNF- α albumen, illustrate that the antigen remains immunogenicity.

Claims (9)

1. a kind of protein vaccine of the anti-tnf-alpha containing adjuvant, which is characterized in that including humanTNF-α, carrier protein and liquid Adjuvant.

2. the protein vaccine of anti-tnf-alpha described in accordance with the claim 1, it is characterised in that：HumanTNF-α's mutant is Y87H/ A145R is mutated.

3. the protein vaccine of anti-tnf-alpha described in accordance with the claim 1, it is characterised in that：Carrier protein is KLH, CTB, OVA And BSA.

4. the protein vaccine of anti-tnf-alpha described in accordance with the claim 1, it is characterised in that：Liquid adjuvant is aluminium hydroxide.

5. the protein vaccine of anti-tnf-alpha described in accordance with the claim 1, it is characterised in that：Chemical coupling agent is there are two bands The glutaraldehyde of active aldehyde radical.

6. the protein vaccine of anti-tnf-alpha described in accordance with the claim 1, it is characterised in that：Both it can be used alone or can be with medicine Pharmaceutical composition is made in the combination of object carrier.

7. the protein vaccine of anti-tnf-alpha described in accordance with the claim 1, it is characterised in that：Both it can be used alone or can be with medicine Pharmaceutical composition is made in object active constituent.

8. a kind of preparation method of the protein vaccine of anti-tnf-alpha, it is characterised in that：Including step：（1）It is prepared by recombinant expression HTNF- alpha-mutant albumen；（2）Recombinant expression prepares P64K albumen, the albumen as carrier, can effectively present antigen to MHC classes On molecule；（3）HTNF- alpha-mutants albumen and P64K are coupled with glutaraldehyde；（3）Introduce adjuvant aluminum hydroxide adjuvant.

9. according to the protein vaccine of the anti-tnf-alpha described in claim 7, it is characterised in that：The vaccine is for (but and unlimited In) rheumatoid arthritis, psoriasis, inflammatory enteritis etc..