CN108125976B

CN108125976B - Molecular marker miR-4270 for predicting lung cancer brain metastasis and application thereof in medicines and diagnostic kits

Info

Publication number: CN108125976B
Application number: CN201711472921.8A
Authority: CN
Inventors: 孙国贵; 胡万宁
Original assignee: Tangshan people's hospital
Current assignee: Tangshan people's hospital
Priority date: 2017-12-29
Filing date: 2017-12-29
Publication date: 2020-07-31
Anticipated expiration: 2037-12-29
Also published as: CN108125976A

Abstract

The invention belongs to the technical field of molecular biology, and particularly discloses a group of molecular markers miR-4270 for predicting brain metastasis of lung cancer and application thereof in medicines and diagnostic kits. The invention discloses application of miR-4270 in preparation of a medicine for inhibiting tumor, application of miR-4270 in preparation of a medicine for inhibiting lung cancer brain metastasis and application of a molecular marker miR-4270 in preparation of a diagnostic kit for predicting brain metastasis of non-small cell lung cancer. The invention utilizes molecular biology technology, can effectively carry out molecular level detection to judge the sign of brain metastasis and targeted therapy of the patient with non-small cell lung cancer, and further provides convenience for individual therapy of the diseases. Meanwhile, the method has important guiding significance for the development of follow-up clinical research.

Description

Molecular marker miR-4270 for predicting lung cancer brain metastasis and application thereof in medicines and diagnostic kits

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a group of molecular markers miR-4270 for predicting lung cancer brain metastasis and application thereof in medicines and diagnostic kits.

Background

Worldwide, lung cancer is the leading cause of cancer death. Non-small cell lung cancer accounts for about 80% of all lung cancers, and brain metastases occur in about 25% of patients with non-small cell lung cancer. Locally advanced non-small cell lung cancer accounts for approximately 40% of non-small cell lung cancer, and brain metastases are one of the most common failures after comprehensive treatment of locally advanced non-small cell lung cancer. The risk of brain metastases in patients with early stage non-small cell lung cancer is 10%. However, the risk of brain metastases of locally advanced non-small cell lung cancer is high, about 30-50%. Brain metastases seriously compromise the survival and quality of life of the patient. Advances in surgical and radiological techniques have improved the local control of locally advanced non-small cell lung cancer. Systemic chemotherapy reduces the risk of extracranial metastases. The comprehensive treatment obviously prolongs the survival. Recent studies have reported that: the median survival after the comprehensive treatment of the locally advanced non-small cell lung cancer is 20-43 months, and the survival in 3 years is 34-63%. Nevertheless, the presence of the blood-brain barrier renders chemotherapy of limited effectiveness for brain metastases, thereby rendering brain treatment relatively inadequate. The risk of brain metastases rises with increasing survival. The study showed that: survival rate and brain metastasis rate of patients with local advanced non-small cell lung cancer are positively correlated, and harm of brain metastasis to survival gradually rises. With improved local and extracranial control, reducing the risk of brain metastases becomes increasingly important.

Prophylactic brain irradiation can improve survival in patients with small cell lung cancer. However, random grouping studies show that: although prophylactic brain irradiation reduces the brain metastasis rate of non-small cell lung cancer, it does not improve its survival. Death from local and extracranial progression may mask the visible benefit of prophylactic brain irradiation. However, not all patients with locally advanced non-small cell lung cancer should receive prophylactic brain irradiation, which prompts those skilled in the art to look for high risk factors for brain metastases to identify high risk subgroups of brain metastases that are most likely to benefit from prophylactic brain irradiation.

By utilizing the molecular biology technology, the risk of brain metastasis of malignant tumor patients can be effectively judged by molecular level detection, and convenience is provided for individual treatment of the diseases.

MicroRNA is a small piece of single-stranded non-coding RNA of about 19-22 nucleotides in length. It controls gene expression by binding the complementary sequence of the 3' untranslated region of its target gene through defective base pairing, thereby down-regulating expression of the target gene at the transcriptional or translational level. Micrornas have recently become important and revolutionary conserved regulators of many pathophysiological processes, from growth to cancer. The effect of the same microRNA may differ in different malignancies. One microRNA can have a plurality of target genes belonging to different paths, and one gene can be regulated and controlled by several microRNAs. Scientists have developed techniques to identify specific gene expression markers that are relevant to tumor staging and patient prognosis to improve prognosis and treatment. Comprehensive transcriptional studies have been used to identify prognostic markers based on gene expression, but none have been clinically applied to date. microRNA tumor profiles appear to enable a more accurate determination of the classification of tumor subtypes compared to classical mRNA profiles. Increasing evidence supports specific microRNA markers for solid tumors. Meanwhile, more and more target genes of microRNA are found to play an important role in the occurrence of lung cancer, such as let-7, miR-34 family and miR-17-92 cluster. Currently, scientists have limited recognition of microRNA target genes. In the molecular framework, the mature microRNA becomes a microRNA-induced silencing complex (miRISC) after being charged. This complex contains the Argonaute family (a large family of proteins) that react with complementary sites usually located in the untranslated region at the 3' end of the target gene. The current model suggests that the reaction of microRNA with its target gene originates from a short 6 to 8 nucleotide fragment called "seed sequence" located at the 5' end of the microRNA. The MicroRNA-induced silencing complex is capable of reconfiguring target genes to a specific interval in which translation arrest and mRNA decay are addressed. Numerous studies have demonstrated microRNA-induced mRNA destabilization. Combined computational prediction, measurement of mRNA expression profiles represents an effective method for identifying functional microRNA-target relationships. In non-small cell lung cancer, many different micrornas dysregulate, may have oncogenic or anti-cancer effects, and predict prognosis. Identification of micrornas that can predict the prognosis of lung cancer patients is an important finding, suggesting that micrornas may play an important role in tumor progression. Current clinical pathology staging has its limitations in predicting brain metastases in patients. The prognosis of brain metastases may be significantly different in lung cancer patients with similar clinical pathological characteristics or the same stage. Molecular markers can help physicians identify high-risk patients for administering individualized treatment to patients, thereby improving survival.

The natural processes of metastasis of malignant tumors include: tumor cells shed from primary foci, respond to chemokines, invade and degrade the extracellular matrix, revascularize, and finally successfully grow in the target organ. Although it has become possible to understand the mechanism of metastasis of malignant tumor more deeply with the progress of molecular biological technology in recent years, we have not made much clear the molecular mechanism of mediating brain metastasis of lung cancer compared to metastasis of other organs, mainly because brain tissue has some characteristics different from other tissues and organs, including: blood brain barrier, self-regulation of blood flow, lack of lymphatic drainage, and failure of damaged neurons to regenerate. Tumor cells that metastasize to the brain must first adhere to microvascular endothelial cells, cross the blood-brain barrier, enter the brain parenchyma, and become blood vessels. Lung cancer, particularly adenocarcinoma, is a major source of brain metastases, in part because lung cancer cells readily reach the brain through the arterial circulation from the lung to the brain. Brain metastases are a significant cause of failure in the treatment of lung adenocarcinoma. At present, only 3 studies relate to the differential microRNA expression of brain metastasis of non-small cell lung cancer, however, the sample size of the studies is too small, and a complete mechanism study is lacked. To date, no more mature molecular markers can be or are expected to be potentially applied clinically to predict non-small cell lung cancer brain metastasis high-risk subpopulations. Our previous studies focused on 217 patients with post-total resection pathology III A-N2 non-small cell lung cancer, and evaluated this group for clinical risk factors for brain metastases. In multifactorial analysis, non-squamous cell carcinomas (RR:4.13, 95% CI: 1.86-9.19 and P ═ 0.001) and lymph node ratios > 30% (RR:3.33, 95% CI: 1.79-6.18 and P ═ 0.000) were significantly associated with an increased risk of brain metastases. The brain metastasis rates for adenosquamous, adenocarcinoma, large-cell and squamous cell carcinoma were 41.7% (5/12), 35.7% (40/112), 16.7(1/16) and 8.0% (7/87), respectively. Therefore, the formalin-fixed paraffin-embedded operation tumor specimen of the adenocarcinoma/adenosquamous carcinoma patient is selected, and the microRNA marker of brain metastasis is researched by adopting a high-throughput microRNA expression profiling chip technology, so that a good foundation is laid for further researching the regulation mechanism of microRNA in lung adenocarcinoma brain metastasis and screening a high-risk brain metastasis subgroup which is possibly beneficial to preventive brain irradiation in the future.

The inventor researches the small cell lung cancer in China by using a microRNA gene chip and a qRT-PCR technology, and unexpectedly discovers that the expression of the microRNA-423-5p in a brain transfer group is obviously up-regulated; the expression level of the microRNA is obviously related to the brain metastasis risk, and the microRNA marker formed by the microRNA is an independent prediction factor of the brain metastasis.

Tumor molecular markers (Tumor markers) are chemical species that reflect the presence of tumors. They are not existed in normal adult tissue but only in embryonic tissue, or their content in tumor tissue is greatly greater than that in normal tissue, and their existence or quantity can indicate the nature of tumor, so that it can know the tissue generation, cell differentiation and cell function of tumor, and can help diagnosis, classification, prognosis and treatment guidance of tumor.

Disclosure of Invention

In order to solve the technical problems that the early detection of the brain metastasis of the non-small cell lung cancer patient is difficult, and the risk of the brain metastasis of the non-small cell lung cancer patient cannot be judged by effectively performing molecular level detection at present, the invention provides a molecular marker miR-4270 for predicting the brain metastasis of the lung cancer and application thereof in medicines and diagnostic kits.

In order to solve the technical problem, the invention is solved by the following technical scheme:

the invention provides the application of the following substances in preparing the medicine for inhibiting tumor:

a)microRNA-4270；

b) a recombinant vector containing a non-coding gene of microRNA-4270;

c) a recombinant viral vector containing a non-coding gene of microRNA-4270.

Wherein the sequence of the microRNA-4270 is 3 'CGGGAGGGGACUGAGGGACU 5'.

In one possible embodiment in combination with the first aspect, the tumor is non-small cell lung cancer.

The second aspect of the invention provides an application of the following substances in preparing a medicine for inhibiting lung cancer brain metastasis:

a)microRNA-4270；

b) a recombinant vector containing a non-coding gene of microRNA-4270;

c) a recombinant viral vector containing a non-coding gene of microRNA-4270.

In one possible embodiment, in combination with the second aspect, the lung cancer is non-small cell lung cancer.

In one possible embodiment, in combination with the second aspect, the non-small cell lung cancer is lung adenocarcinoma.

In a third aspect, the invention provides a molecular marker for the treatment of non-small cell lung cancer brain metastasis

The molecular marker is microRNA-4270.

In one possible embodiment, in combination with the third aspect, the non-small cell lung cancer is lung adenocarcinoma.

The fourth aspect of the invention provides application of a molecular marker microRNA-427 in preparation of a diagnostic kit for predicting brain metastasis of non-small cell lung cancer.

In one possible embodiment, in combination with the fourth aspect, the non-small cell lung cancer is lung adenocarcinoma.

The molecular marker is microRNA-4270, which is called miR-4270 for short.

Compared with the prior art, the invention has the following beneficial technical effects:

1) the invention provides a molecular marker microRNA-4270, which can effectively detect the molecular level to judge the brain metastasis condition of a patient with non-small cell lung cancer and target treatment by using a molecular biology technology, thereby providing convenience for individual treatment of the diseases.

2) The invention provides a drug which is prepared from a molecular marker microRNA-4270 and has the effect of inhibiting the brain metastasis of lung cancer, and the drug has a very definite clinical curative effect of inhibiting the occurrence of the brain metastasis.

3) The invention provides application of a molecular marker microRNA-4270 in preparation of a diagnostic kit for predicting brain metastasis of non-small cell lung cancer, and the kit not only has high accuracy, but also has important guiding significance for development of subsequent clinical research.

Drawings

FIG. 1 is a hierarchical clustering analysis diagram of miR-4270 expressing significant differences in brain metastasis group (BM) and non-brain metastasis group (NBM) according to the invention.

Fig. 2 is a comparison graph of the miR-4270 patients with high expression group in which the risk of brain metastasis is significantly lower than that of the patients with low expression group (experimental group, n is 87).

FIG. 3 is a graph of an experiment that miR-4270 provided by the invention is expressed and reduced in lung adenocarcinoma tissues with brain metastasis.

Fig. 4 is a comparison graph of the miR-4270 patients with high expression group with significantly lower brain metastasis risk than the low expression group (validation group, n ═ 68).

Fig. 5 is a comparison graph of the miR-4270 patients with high expression group with significantly lower brain metastasis risk than the low expression group (whole group, n ═ 155).

FIG. 6 is a diagram showing that miR-4270 disclosed by the invention is highly expressed and can inhibit cell proliferation, plate clone formation capacity and cell migration and transfer capacity of non-small cell lung cancer cell strain cells.

FIG. 7 is a diagram showing that the miR-4270 low expression can promote cell proliferation, plate clone formation capability and cell migration and transfer capability of non-small cell lung cancer cell strain cells.

FIG. 8 is a graph showing that miR-4270 obviously promotes the growth of nude mouse transplanted tumor after down-regulation expression in vivo experiments of the invention.

FIG. 9 is a generation diagram of miR-4270 which obviously promotes lung metastasis and brain metastasis after the in vivo experiment of the invention proves that the expression is reduced.

Detailed Description

The invention is further described with reference to the following drawings and examples, which are not intended to limit the invention in any way.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The experimental methods under specific conditions not specified in the examples are generally conventional in the art.

The detection method related to the embodiment comprises the steps of microRNA probe design, extraction, qRT-PCR verification, cell proliferation, clone colony formation, invasion and metastasis experiments, nude mouse subcutaneous transplantation tumor and metastasis tumor treatment experiments. In the future clinical application, only two technologies of microRNA extraction and qRT-PCR are used. Both methods are routine for the skilled person and therefore the model is easy to generalise in the clinic.

The method for searching the markers of the metastasis, prognosis and targeted therapy of the non-small cell lung cancer in the embodiment is as follows:

first, patient and specimen:

retrospectively of patients who had undergone post-operative pathology with lung adenocarcinoma or adenosquamous carcinoma stages III A-N2 from month 1 in 2003 to month 12 in 2005 and who did not receive prior radiotherapy or other treatment for the tumor. Staging criteria was the sixth edition of the united states joint committee on cancer staging (Greene, 2002). Patients with other primary tumors or a prior history of lung cancer were excluded. Patients were enrolled with pre-treatment brain magnetic resonance or CT examinations.

Patient history and follow-up data were reviewed to record patient and treatment characteristics and recurrence patterns. All patients gave informed consent. The case screening criteria were as follows: the medical record is complete; the patient survives for more than 4 months after the operation; the follow-up visit is complete; the formalin fixed paraffin embedded surgical tumor specimen was intact and the specimen tumor content was greater than 75%. Finally, 87 specimens including 32 specimens in the brain metastasis group and 55 specimens in the non-brain metastasis group are screened out.

Compared with the non-brain metastasis group, the brain metastasis group has more patients who have received postoperative radiation treatment, and has more patients with a ratio of the number of metastatic lymph nodes to the number of resected lymph nodes (lymph node ratio) ≥ 1/3. In addition, the gender, age, pathological type and differentiation, smoking history, T stage and whether adjuvant chemotherapy was given were matched between the two groups.

The gene chip detects tumor tissue specimens and screens the gene microRNA-4270 related to brain metastasis.

Chip data processing: the screening of the differential expression genes is carried out by using SAM (Significance Analysis of microarray) software, the screening standard is as follows: (1) q-value is less than or equal to 5 percent; (2) the difference multiple is more than or equal to 2.

Down-regulated genes, the screening criteria were: (1) q-value is less than or equal to 5 percent; (2) the difference multiple is less than or equal to 0.5.

The cluster analysis software is cluster 3.0, and adopts the algorithm of hierarchy, media Center (gene) and average linkage. And dividing the expression values of the microRNAs with the expression differences between the brain metastasis group and the non-brain metastasis group into low expression and high expression according to median values, and then carrying out single-factor Cox regression to analyze the risk of brain metastasis. Risk ratio of dangerous micrornas > 1. Thereafter, patients were divided into high-risk and low-risk groups based on median risk score, and the two groups of brain metastasis risks were compared using the log-rank method. Multifactor Cox regression analysis influences independent variables of brain metastases. All statistical tests were two-way, with p <0.05 being statistically different. Statistical analysis used SPSS 18.0.

PCR data collection and processing: normalization was performed using U6RNA as an internal standard. The prognosis was evaluated using the model obtained from the chip.

2. Clinical data for microRNA verification of qRT-PCR

Patient history and follow-up data from patients from month 1 to month 2008 were reviewed to record patient and treatment characteristics and relapse patterns. All patients gave informed consent. The case screening criteria were as follows: the medical record is complete; the patient survives for more than 4 months after the operation; the follow-up visit is complete; the formalin fixed paraffin embedded surgical tumor specimen was intact and the specimen tumor content was greater than 75%. Finally, 68 specimens are screened out, including 30 specimens in the brain metastasis group and 38 specimens in the non-brain metastasis group.

Secondly, in situ hybridization:

dewaxing to water, washing with phosphate buffer solution (PBS, main components are K2HPO4, KH2PO) for 3min ×, incubating with 0.1M glycine for 5min ×, treating with 0.3% Triton X-100(PBS) for 15min, washing with PBS for 3min ×, treating with protease K (20 ug/ml)37 deg.C (preheating) for 20min, washing with PBS for 3min ×, fixing with 4% paraformaldehyde for 5min, washing with PBS for 3min ×, treating with 0.25% acetic anhydride (0.1M triethanolamine, pH8.0) for 10min, washing with PBS for 3min ×, treating with 70%, 85% and 100% ethanol for 5min at-20 deg.C for 5min, dehydrating, air drying, adding dropwise (4 probes for 1: 250 dilution, adding dropwise to each slice as required, 50 ul/piece), covering with slide, placing in 48 deg.C, hybridizing for 16-18h, hybridizing with buffer solution after hybridization, adding buffer solution for 5min, diluting with sodium chloride buffer solution, adding buffer solution for 5min, diluting buffer solution with sodium chloride, adding buffer solution for 5min, adding sodium chloride, diluting buffer solution for 5min, diluting with sodium chloride, diluting buffer solution for 5min, adding sodium chloride, diluting buffer solution for 5min, adding sodium chloride, and diluting with sodium chloride, adding buffer solution for 5min, adding sodium chloride, and diluting for 5 buffer solution for 5min, adding sodium chloride, and adding sodium chloride, and adding sodium chloride for 5 times.

RNA extraction, quality detection, chip hybridization and data processing

Paraffin embedded tissue processed by lemon oil fine dewaxing

Pre-processing of paraffin-embedded tissue sample, if the paraffin-embedded tissue is sliced, selecting ten slices with the thickness of no more than 50 μm, removing surrounding paraffin as much as possible, and placing the slices in a centrifugal tube of 1.5m L.

If the paraffin-embedded tissue is a whole block, the tissue can be gently scraped by a sharp blade and placed in a centrifugal tube of 1.5m L to avoid scraping paraffin as much as possible, and the amount of the scraped tissue is controlled within 100 mg.

Dewaxing lemon olein:

1ml of limonene (L imonen) was added to the centrifuge tube, mixed well with shaking at 55 ℃ for 5 min.13, centrifuged at 200rpm for 2min at room temperature, and the supernatant was discarded, this step was performed 3 times in total.

Adding 1ml of absolute ethyl alcohol into a centrifuge tube, shaking and uniformly mixing for 2min at 55 ℃, centrifuging for 2min at room temperature of 13,200rpm, and discarding the supernatant. This step was repeated once.

The supernatant was discarded, centrifuged briefly at room temperature, and the remaining absolute ethanol was aspirated by a pipette.

The tube was placed in a vacuum desiccator and pumped to dry the tissue to a dry powder.

(II) extraction of RNA and microRNA from lung tissue specimen

1. Extraction of tissue RNA

The whole procedure was carried out exactly as described in the Trizol kit, in a RNase-free environment, using test tips and solutions that were routinely treated with 1% aqueous Diethylpyrocarbonate (DEPC) water (with the exception of Tris), overnight at room temperature.

(1) Respectively taking 50-l 00mg of each of the frozen lung cancer tissue and the paracancer normal tissue, placing the frozen lung cancer tissue and the paracancer normal tissue into a 1.5ml Eppendorf small tube in which 0.5ml of Trizol lysate is added in advance, continuously grinding the mixture into a slurry by using a homogenizer, and adding the Trizol lysate to 1 ml.

(2) Incubating for 5 minutes at 15-30 ℃ to completely dissolve the nucleoprotein complex, adding 0.2ml of chloroform into 1ml of Trizol reaction solution, strongly shaking for 15 seconds, and incubating for 2-3 minutes at 15-30 ℃.

(3) After centrifugation at 12,000g for 15 minutes at 4 ℃ the supernatant was transferred to another Eppendorf tube at a volume of about 60% of the volume of the Trizol reaction solution added.

(4) And (3) RNA precipitation: 0.5ml of isopropanol is added to every 1ml of Trizol, and the mixture is incubated for lO minutes at 15-30 ℃.

(5) Centrifuging at 2-8 ℃ and less than or equal to 12 at 000g for 10 minutes.

(6) The supernatant was discarded and the lml rinse was carried out 2 times with 70% ethanol (made with DEPC treated triple distilled water).

(7) 7 at 2-8 ℃, and centrifuging for 5 minutes at 500 g.

(8) The RNA was vacuum dried and dissolved in 50. mu.l DEPC water. Storing at-70 deg.C for use.

(9) RNA quantification and electrophoretic identification

A. Mu.l of RNA solution is taken and added with 100 mu.l of water, after being mixed evenly, the ratio of A260 to A280 to A260/A280 is measured by an ultraviolet-visible spectrophotometer, and the RNA concentration is read. Should be 1.8 to 2.0.

B.1.2% formaldehyde denaturing agarose gel electrophoresis for identifying RNA quality:

① the electrophoresis tank was soaked in 0.3% H202 for 30 minutes, rinsed with DEPC water and dried.

② preparing gel (20ml) containing agarose 0.24g, no RNAase water 17.4ml, 10 × MOPS 2ml, 37% formaldehyde 0.6ml and EB lml, adding water into the agarose, heating in a microwave oven to melt, adding 10 × MOPS, cooling the gel to 60 ℃, adding formaldehyde and EB., pouring the gel into a gel tank, inserting a comb, horizontally placing for solidification, and using.

③ the gel was pre-electrophoresed for 5min and the voltage dropped to 5V/cm.

④ adding electrophoresis buffer (10 ×)2 μ l, formaldehyde 3.5 μ l, formamide l0 μ l, mixing, keeping at 60 deg.C for 10min, cooling rapidly on ice, adding 3 μ l loading buffer, mixing, adding into gel sample application hole, and adding RNA standard substance.

⑤ after electrophoresis, the picture is taken under an ultraviolet lamp.

Two bands, 28S and 18S, were seen after electrophoresis, and 28S: an 18S ratio greater than 2 indicates that the RNA is not degraded.

2. Extraction of cellular small RNA

Extraction of cell line small molecular RNA (less than or equal to 200nt) is extracted by a mirvana (TM) miRNA extraction kit according to an instruction. The method is briefly described as follows:

cells (<107) were harvested and lysed with 600 μ l lysis/binding buffer (appropriate amount of tissue (<250mg) was taken, ground to powder in liquid nitrogen, transferred to 600 μ l lysis/binding buffer for lysis), added to 60 μ l lmiRNA homogenate and kept l omin on ice. Add 600. mu.l of phenol/chloroform, mix vigorously for 30-60s and centrifuge at 10000rpm for 5min at room temperature (complete separation). The supernatant was carefully pipetted into a new, rnase-free 1.5ml centrifuge tube.

Adding anhydrous ethanol with volume of l/3, completely mixing, adding into a centrifugal column (700 μ l each time) in a collecting tube, centrifuging lmin at room temperature at 10000rpm, and collecting eluate.

Adding 2/3 volume of anhydrous ethanol into the collected effluent, completely mixing, adding into another new centrifugal column in a collecting tube, centrifuging lmin at l0000rpm at room temperature, and discarding the effluent.

Adding 700 mu l miRNA washing solution 1 into the centrifugal column, and centrifuging for 5-10s for rinsing.

The plate was rinsed twice with 500. mu.l of 2/3 as described above. The lmin is centrifuged again to completely remove the ethanol.

Mu.l of the eluent at room temperature was added thereto, and the lmin was centrifuged at l0000rpm to recover RNA.

After the RNA is diluted by 25 times, the values of OD260 and OD280 of the RNA are measured by an ultraviolet spectrophotometer, and the OD260/D280 is calculated, and when the ratio is more than 1.8, the purity of the RNA is better. The concentration of RNA was also calculated from OD 260.

Transient transfection of tetra, mimic or inhibitor

① mix or inhibit, adding 250 μ l 1 × universal buffer solution into 5nmol double-strand siRNA to obtain 20 μ M mix or inhibit mother liquor, and storing at-20 deg.C.

② cells with good growth status were collected and inoculated on a 60mm petri dish (without antibiotics) the day before transfection, and the cell density reached around 30% at transfection.

③ the complex is prepared by diluting mimic or inhibitor with appropriate concentration in 500. mu.l of serum-free medium, mixing gently, diluting solution B with 10. mu.l of L ipofectamine 2000 (mixed gently before use) in 500. mu.l of serum-free medium, mixing well, and incubating at room temperature for 5 min.

④ the diluted liposomes were mixed with the diluted mimic or inhibitor, gently mixed and incubated for 20 minutes at room temperature (the complex remained stable within 6 hours at room temperature).

⑤ adding 1000 μ l of the mixed compound into a cell culture dish, adding serum-free culture medium to 5ml, mixing gently, discarding the original culture medium after 6 hours, and changing to culture medium containing 10% serum.

⑥ 48 hours later, cells were harvested for Westernblot, RT-PCR, MTS and other corresponding experiments.

Fifth, MTS method for detecting cell proliferation curve

When the cells grow to the logarithmic growth phase, cell transfection or corresponding treatment is carried out, the cells are collected and diluted into cell suspension with proper concentration, the cell suspension is added into a 96-well cell culture plate, each well contains 5000 cells/100 mu l, and the culture is continued in an incubator for proper time. For each experimental group, 6 parallel wells were made and the wells containing medium alone were used as blanks. Four time points are set: 0h (measured after the cells are plated and adhered to the wall), 24h, 48h, 72h and 96 h. The cell activity is measured by adopting an MTS colorimetric method, 15 mul of MTS reagent (500 mu g/ml) is added into each hole, the light absorption value (OD) is measured at the position of 570nm of wavelength by using an enzyme-labeled spectrophotometer after the culture is continued for 2 hours, the zero adjustment is carried out by using a blank hole, and the higher the OD value is, the more the cell number is.

Sixth, clone colony formation experiment

① cells are transfected or treated as required by the experiment.

② Large dishes were prepared, 10ml of medium was added per well, and 800 cells were added.

③ cells were cultured under standard conditions for 10-14 days and observed for colony formation.

④ when the cells form macroscopic colonies, the culture is terminated, the medium is discarded, the cells are washed carefully 2 times with PBS, 4% formaldehyde is added for fixation, 1 ml/well is fixed for 15min, the fixation solution is discarded, the cells are washed clean slowly with running water, 1ml of crystal violet staining solution is added for staining for 3min, the staining solution is washed off slowly with running water, dried in a fume hood, and photographed.

Seven, chemotaxis chamber experiment (Transwell)

① cells were counted, 5 × 105 cells were added to the chamber, 500ul serum free medium was added to the upper chamber, and 800ul 10% serum containing medium was added to the lower chamber.

② transferring for 12-18 hours, discarding culture solution of the upper and lower chambers of the filter membrane, washing with preheated PBS, slightly blowing PBS to clean the lower surface of the filter membrane, and repeating for 1 time;

③ transferring into 600 μ l of 4% paraformaldehyde in the lower chamber, and immersing the lower surface of the filter membrane in the solution for fixing cells for 15 min;

④ discarding the fixed solution, inverting the transwell chamber to make the lower surface of the filter membrane upward, and naturally air drying;

⑤ air drying, and dripping Giemsa dye solution on the lower surface of the filter membrane of the inverted transwell chamber for 10 min;

⑥ washed with distilled water, and the non-migrated cells on the cell surface were wiped off with a cotton ball and counted under an inverted microscope.

Experiment on transplantation tumor of nude mouse and formation and treatment of lung metastasis tumor

SPF-grade BABIC nude mice (5-6 weeks old, half male and female, 10/group/cell line), 1 × 106 stably transfected miR-4270 non-small cell lung cancer cells and blank control cell strains are respectively inoculated on the subcutaneous and tail veins of the right back of the nude mice to form nude mouse transplantation tumor and metastasis tumor models, the nude mice are killed by a neck pulling method after 42 days, nude mouse transplantation tumor and lung metastasis tumor tissues are dissected and stripped, and formalin fixation is carried out.

Specific nude mouse transplanted tumor and lung metastasis tumor formation and treatment experiments are shown in fig. 8 and 9, and fig. 8 is an in vivo experiment which proves that after miR-4270 is down-regulated and expressed, the growth of the nude mouse transplanted tumor is obviously promoted, and the nude mouse transplanted tumor volume is obviously increased. FIG. 9 shows that in vivo experiments prove that after miR-4270 is used for reducing expression, the occurrence of lung metastasis and brain metastasis is obviously promoted. Therefore, the miR-4270 has a very definite clinical curative effect of inhibiting the occurrence of brain metastasis.

The embodiment also provides an application of the following substances in preparing a medicine for inhibiting tumor:

a)microRNA-4270；

b) a recombinant vector containing a non-coding gene of microRNA-4270;

c) a recombinant viral vector containing a non-coding gene of microRNA-4270.

Wherein the sequence of the microRNA-4270 is 3 'CGGGAGGGGACUGAGGGACU 5'.

Preferably, the tumor is non-small cell lung cancer.

The embodiment also provides an application of the following substances in preparing a medicine for inhibiting the brain metastasis of the lung cancer:

a)microRNA-4270；

b) a recombinant vector containing a non-coding gene of microRNA-4270;

c) a recombinant viral vector containing a non-coding gene of microRNA-4270.

Preferably, the lung cancer is non-small cell lung cancer.

Preferably, the non-small cell lung cancer is lung adenocarcinoma.

In the embodiment, the method for searching the marker microRNA-4270 for the brain metastasis and the targeted therapy of the non-small cell lung cancer has the following experimental effects:

the microRNA-4270 is used for detecting the brain metastasis of the non-small cell lung cancer.

(1) The expression condition is used as a marker for judging the non-small cell lung cancer brain metastasis.

The expression level of the microRNA-4270 in the non-small cell tissue with brain metastasis is obviously higher than that of the non-small cell tissue without brain metastasis; the expression level of miR-4270 has no obvious negative correlation with the age, sex, tumor differentiation degree, tumor size, clinical stage and lymph node metastasis of a patient, but has obvious correlation with brain metastasis.

The risk model shows that the risk of brain metastasis of patients with miR-4270 high expression group is obviously lower than that of patients with miR-4270 low expression group.

Cox risk ratio model analysis shows that miR-4270 expression can be used as an independent marker for poor prognosis of non-small cell lung cancer patients. The prognosis model can divide the non-small cell lung cancer brain metastasis into two types of low-risk and high-risk, different types adopt different treatment schemes, low-risk lesion can adopt local means such as operation, local radiotherapy and the like, for high-risk lesion, the treatment is relatively aggressive, and the brain radiotherapy is needed to be assisted at the same time of the operation and the radiotherapy and the chemotherapy. Thereby having epoch-making significance for changing the treatment mode of the non-small cell lung cancer.

(2) The influence of miR-4270 on the proliferation, migration and invasion capacities of the non-small cell lung cancer cells is researched, and the research shows that miR-4270 can regulate the growth and cell invasion and transfer capacities of non-small cell lung cancer cell strains. The miR-4270 overexpression can inhibit the proliferation of non-small cell lung cancer cells and the invasion and transfer capacity of the cells. Conversely, miR-4270 down-regulation leads to an increase in this capacity. The method also provides evidence for the function of the miR-4270 in the invasion and metastasis and treatment of the non-small cell lung cancer.

Specific clinical effects see fig. 1-7, as follows:

referring to fig. 1, hierarchical clustering analysis of miR-4270 expressing significant differences in Brain Metastasis (BM) and non-brain metastasis (NBM) groups.

Referring to fig. 2, the risk of brain metastasis in patients with miR-4270 high expression group is significantly lower than that in low expression group (experimental group, n ═ 87).

Referring to fig. 3, miR-4270 expression was reduced in lung adenocarcinoma tissue with brain metastases.

Referring to fig. 4, the risk of brain metastasis in patients with miR-4270 in the high expression group is significantly lower than that in the low expression group (validation group, n ═ 68).

Referring to fig. 5, the risk of brain metastasis in patients with miR-4270 high expression group is significantly lower than that in low expression group (full group, n ═ 155).

Referring to FIG. 6, the high expression of miR-4270 can inhibit the cell proliferation, plate clone formation ability and cell migration and transfer ability of non-small cell lung cancer cell strain cells.

Referring to FIG. 7, the low expression of miR-4270 can promote the cell proliferation, plate clone formation capability and cell migration and transfer capability of non-small cell lung cancer cell strain cells.

The embodiment provides a molecular marker for brain metastasis treatment of non-small cell lung cancer, and the molecular marker is microRNA-4270.

Preferably, the non-small cell lung cancer is lung adenocarcinoma.

In the embodiment, the molecular marker microRNA-4270 is applied to preparation of a diagnostic kit for predicting brain metastasis of non-small cell lung cancer.

Preferably, the non-small cell lung cancer is lung adenocarcinoma.

The diagnostic kit in this embodiment is prepared according to a conventional method.

The kit of the molecular marker microRNA-4270 in the embodiment monitors the brain metastasis of lung adenocarcinoma.

10 patients with confirmed lung adenocarcinoma from pathology examinations were selected and followed. The patient samples are from lung adenocarcinoma patients in people's hospitals in Tangshan City, and all collected patients are treated effectively, so that the clinical data and follow-up resources are complete. Firstly collecting blood of 10 patients six weeks after lung adenocarcinoma treatment, detecting the expression level of the corresponding gene in the blood, checking once every three months, tracking nine months, and detecting four times.

The relative expression level of the corresponding gene in the blood of 10 cases of patients with lung adenocarcinoma is detected by using the kit. Judging whether the lung adenocarcinoma patient has brain metastasis according to the changed level of the relative expression quantity of the corresponding gene in the blood sample at 6 weeks, 3 months, 6 months and 9 months after the treatment of the patient with the non-small cell lung cancer compared with the level before the treatment. Judging whether the relative expression level of the gene after treatment is reduced by more than or equal to 35% compared with that before treatment, judging that the brain is transferred; when the relative expression level of the gene after the treatment was decreased by less than 35% compared to that before the treatment, it was judged that there was no brain metastasis.

The results of the detection judgment of the kit are shown in Table 1.

Table 1: detection judgment result of kit

Serial number	6 weeks	3 months old	6 months old	9 months old	Clinical results
						1	The increase is 27 percent	The increase is 22 percent	The increase is 19 percent	The increase is 25 percent	Without brain metastasis
2	The increase is 22 percent	The increase is 18 percent	The reduction is 20 percent	The reduction is 42 percent	Brain metastasis
						3	Increase by 26%	The increase is 22 percent	The increase is 23 percent	The increase is 20 percent	Without brain metastasis
4	The increase is 19 percent	The increase is 16 percent	The increase is 10 percent	The reduction is 48 percent	Brain metastasis
						5	The increase is 29 percent	The increase is 25 percent	The increase is 20 percent	The increase is 18 percent	Without brain metastasis
6	The increase is 25 percent	The increase is 20 percent	The increase is 8 percent	The reduction is 42 percent	Brain metastasis
						7	The increase is 23 percent	The increase is 20 percent	The increase is 15 percent	The increase is 13 percent	Without brain metastasis
8	The increase is 25 percent	The increase is 20 percent	The increase is 15 percent	The increase is 12 percent	Without brain metastasis
						9	The increase is 28 percent	The increase is 15 percent	The reduction is 20 percent	The reduction is 61 percent	Brain metastasis
10	The increase is 29 percent	The increase is 23 percent	The increase is 25 percent	The increase is 22 percent	Without brain metastasis

As shown in table 1, the clinical diagnosis results showed that 4 of 10 patients with lung adenocarcinoma had brain metastases and 6 patients had no brain metastases after treatment. The kit of the embodiment is used for monitoring the brain metastasis condition of the lung adenocarcinoma, can be found earlier than clinical symptoms and signs, and provides reference for doctors to intervene in advance.

The details not described in the present specification are within the common general knowledge of those skilled in the art.

Although the present invention has been described in detail with reference to the preferred embodiments, it should be understood that various modifications and adaptations of the present invention may occur to those skilled in the art without departing from the spirit and scope of the present invention.

Claims

1. The application of the following substances in preparing the medicine for inhibiting the non-small cell lung cancer brain metastasis:

a）microRNA-4270；

b) a recombinant vector containing a non-coding gene of microRNA-4270.

2. The use of claim 1, wherein the non-small cell lung cancer is lung adenocarcinoma.

3. The use according to claim 1, characterized in that the recombinant viral vector contains a non-coding gene for microRNA-4270.