CN108103234A - For detecting the specific primer of soy bean DNA and probe and real-time fluorescence quantitative PCR kit - Google Patents
For detecting the specific primer of soy bean DNA and probe and real-time fluorescence quantitative PCR kit Download PDFInfo
- Publication number
- CN108103234A CN108103234A CN201810130628.1A CN201810130628A CN108103234A CN 108103234 A CN108103234 A CN 108103234A CN 201810130628 A CN201810130628 A CN 201810130628A CN 108103234 A CN108103234 A CN 108103234A
- Authority
- CN
- China
- Prior art keywords
- probe
- real
- primer
- quantitative pcr
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention is provided to detect the specific primer of soy bean DNA and probe, the probe sequence is：5’‑AACCCTATCCTCACCCACTCG‑3’；The specific primer be following sequences or be following sequences complementary strand sequence：Upstream primer sequence is 5 ' CGATGTGGTCGATTTGAAGA 3 '；Downstream primer sequence is 5 ' AAAGCACGTCATGCGATTC 3 '.The present invention also provides corresponding real-time fluorescence quantitative PCR kits.The specific primer and probe and corresponding reagent box of the present invention can be used in the real-time fluorescence quantitative PCR detection of soy bean DNA, and the method established has hypersensitivity and high specific, specificity can differentiate soy bean DNA from a variety of oil crops such as peanut, flax, corn and soybean, potato, sesame, rape, walnut, sunflower, olive.
Description
Technical field
The invention belongs to molecular biology and external diagnosis reagent technical field, and in particular to for detecting soy bean DNA
Specific primer and probe and real-time fluorescence quantitative PCR kit.
Background technology
The gene of detection edible oil DNA mass mainly has chloroplaset ATP, RBCL gene and species-specific gene.Ye Lv
Body is the important organelle of plant cell, and chloroplast DNA is widely used in the research of phyletic evolution.Chloroplast gene has height
Conservative, and wherein rbcL genes be widely used in just because of its evolution feature botanical system generation research.It
Rate is slower during evolution for some code areas, than more conservative, and some noncoding regions evolutionary rate between different species
But than very fast, with conservative in certain interspecific difference opposite sex and kind, thus it is appropriate for species discriminating.By to rbcL genes
The preceding paragraph sequence carries out universal primer design, can be carried out at the same time amplification to different species, and has the interspecific difference opposite sex simultaneously,
Diversity ratio is larger between different species, is easy to carry out species discriminating.Chloroplast gene is in most plants with multicopy shape
Formula exists, so for the little table oil of DNA content, has more than single copy or few species-specific gene copied
Highly sensitive advantage.Species specificity reference gene needs to meet following 2 conditions：All there are the bases for all kinds of the crop
Cause；Other biological without or there is no expand the gene specific target sequence.It is detected by establishing species specificity PCR method
The species in food processing product are increasingly becoming the important means of food quality detection.
Real-time fluorescence quantitative PCR (Fluorescence quantitative PCR) technology is stepped from Standard PCR qualitative detection
The step of upper quantization, its relatively conventional round pcr is advanced, it is easy to operate, can realize reality using Real-Time Fluorescent Quantitative PCR Technique
When monitoring, absolute quantitation and the purpose quickly detected, while there is high sensitivity, specific good, simple operation, therefore
It is very suitable for clinical detection.
Real-Time Fluorescent Quantitative PCR Technique has many branches, and quantitative manner is also different, is broadly divided into fluorescent dye insertion skill
Art, fluorescent probe technique and itself quenching fluorescence technology etc..Fluorescent dye embedded technology is to utilize the SYBR green I intercalations of DNA
Double-strand is the increased characteristic of fluorescence intensity, fluorescence signal is introduced double-stranded DNA, this method specificity is poor, is as a result subjected to and draws
The existing interference of object dimer and lead to problems such as false positive, therefore be not suitable for food and examine soon.And fluorescent probe technique
Such as Taqman technologies, molecular beacons technology are because it is specific than fluorescent dye embedded technology and itself quenching fluorescence technology
It is good, therefore it is more suitable for Food Inspection use.
The content of the invention
Present invention aims at the specific primers and probe sequence of one group of soy bean DNA of design, and establish a kind of can answer extensively
For Food Inspection it is quick, sensitive, specificity is good uses fluorescent quantitative PCR detection method.The present invention uses gene cloning skill
The Lectin genetic fragments of soybean are inserted into carrier pMD18-T, obtain the restructuring containing LectinDNA genetic fragments by art
Plasmid, in this, as standard items.One group of spy is designed and synthesized according to the genetic fragment coding gene sequence of the LectinDNA of soybean
Specific primer and probe optimize PCR reaction conditions, establish the detection side using real-time fluorescence quantitative polymerase chain reaction as platform
Method, and the method to being established is assessed.
For the adulterated behavior of edible oil frequently occurred currently on the market, the present invention is using common oil crops soybean to grind
Study carefully object, with reference to Standard PCR, real-time fluorescence PCR, the real-time fluorescence probe of oil crops soybean and edible soybean oil is established in research
PCR method, it is intended to build quick, easy, the accurate and efficient common adulterated molecular biology authentication technique system of edible oil, be
Edible oil quality is supervised and control provides scientific method.Detection of adulterations is carried out to edible oil with Protocols in Molecular Biology, primarily
On condition that the DNA of suitable PCR amplification is extracted from grease.Since table oil production need to pass through high temperature and high pressure etc.
Reason, DNA degradation therein is fragment not of uniform size, and content is extremely low, this causes very big difficulty to DNA extractions.Thus DNA
Extractive technique becomes the bottleneck of edible oil PCR detection techniques, is the key point of edible oil detection success or not.The present invention uses
Molecular biology correlation technique is carried out edible oil Variety identification technical research, will be carried for the quality safety management of edible oil
For scientific method, be conducive to the specification of domestic edible oil market, high-end edible oil foreign trade being smoothed out and entirely eating
With the sound development of oily industry.
First purpose of the present invention is to provide the specific primer and probe that detect soy bean DNA, the probe sequence
It is classified as：5’-AACCCTATCCTCACCCACTCG-3’；
The specific primer be following sequences or be following sequences complementary strand sequence：
Upstream primer sequence is 5 '-CGATGTGGTCGATTTGAAGA-3 '；
Downstream primer sequence is 5 '-AAAGCACGTCATGCGATTC-3 '.
Preferably, the fluorescent reporter group that 5 ' ends mark in probe is one kind in FAM, TET, JOE, HEX, VIC, 3 '
The fluorescent quenching group of end mark is one kind in TAMRA, DABCYL, BHQ.
Preferably, the sense primer and the anti-sense primer are to extend one to several bases to 5 ' ends and 3 ' extreme directions
Or delete a sequence obtained to several bases.
Second object of the present invention is to provide a kind of real-time fluorescence quantitative PCR kit for being used to detect soy bean DNA, institute
Stating real-time fluorescence quantitative PCR kit includes claim 1-3 any one of them specific primer and probe.
Preferably, in 10 μ l PCR reaction systems, the dosage of the sense primer is 0.1 μ l, the anti-sense primer
Dosage for 0.1 μ l, the dosage of the probe is 0.2 μ l.
Preferably, the real-time fluorescence quantitative PCR kit further includes series concentration standard items and positive control；It is described
Series concentration standard items are to be connected soybean Lectin rDNA genes with carrier, convert into competent cell induced expression, carry
Recombinant plasmid is taken, is diluted after recombinant plasmid is quantified, obtains series concentration standard items.
Preferably, the nucleotides sequence of the standard items is classified as sequence 1 in sequence table.
Third object of the present invention is to provide above-mentioned specific primer and probe, real-time fluorescence quantitative PCR kit
It is following it is any in application：
(1) qualitatively or quantitatively detection or auxiliary detect soybean；
(2) product of qualitative or quantitative detection or auxiliary detection soybean is prepared；
(3) qualitatively or quantitatively whether soybean oil is contained in detection or auxiliary detection vegetable oil；
(4) prepare in qualitative or quantitative detection or auxiliary detection vegetable oil whether the product containing soybean oil.
Fourth object of the present invention be to provide it is a kind of detection or auxiliary detection vegetable oil in whether the side containing soybean oil
Method respectively using series concentration standard items and sample to be tested DNA as template, carries out real-time fluorescence using specific primer and probe and determines
PCR is measured, draws standard curve, result is judged by the Ct values of standard curve and sample to be tested；Preferably, the sample to be tested
DNA is extracted using freeze-drying.
Preferably, the reaction condition of the real-time fluorescence quantitative PCR is：94 DEG C of pre-degenerations 2 minutes, 94 DEG C 15 seconds, 60
DEG C 40s simultaneously collects fluorescence signal, 40 cycles.
The soybean Lectin primer sequences that the present invention designs, by being carried out to soybean Lectin alignments, and to it
Blast analyzes when specificity, the results showed that, which is soybean species specificity sequence.The expansion of the soybean primer of design
Growth degree is 101bp, and amplified fragments size and amplification gene composition are critically important to PCR amplification table oil DNA.Expand piece
Duan Yue little, PCR amplification success rate is higher, and G/C content it is high DNA it is more stable in process engineering, endogenous gene compares foreign gene
It is more stable in process.So PCR amplification edible oil DNA should select the genomic fragment that segment is small and G/C content is high.
The present invention is provided to carry out the primer and probe of qualitative and quantitative analysis to soy bean DNA, by extracting test sample to be checked
DNA in product in conjunction with real-time fluorescence quantitative PCR detection technique, can reach soybean oil DNA content in accurate quantitative analysis sample to be measured
Purpose.Primer and probe provided by the present invention can be used for carrying out soy bean DNA in scientific research and Food Inspection qualitative, quantitative point
Analysis is conducive to carry out edible oil Variety identification technical research, will provide scientific method for the quality safety management of edible oil,
Be conducive to specification, being smoothed out for high-end edible oil foreign trade and being good for for entire edible oil industry of domestic edible oil market
Kang Fazhan.Below in conjunction with the accompanying drawings and the present invention is described in detail in specific embodiment.
Description of the drawings
Attached drawing is used for providing a further understanding of the present invention, and a part for constitution instruction, the reality with the present invention
Example is applied together for explaining the present invention, is not construed as limiting the invention.In the accompanying drawings：
Fig. 1 is the result that soybean Lectin rDNA genes carry out blast comparisons in NCBI.
Fig. 2-4 is 3 pairs of primed probe specific b LAST comparison results.
Fig. 5 is amplified production electrophoresis result after the optimal primer pair is expanded different templates using regular-PCR method.
Fig. 6 is primer and probe system optimization experimental result of the present invention.
Fig. 7 is the standard curve of soybean standard items of the present invention.
Fig. 8 is sensitivity experiment result of the present invention.
Fig. 9 is specificity experiments result of the present invention.
Specific embodiment
Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is conventional method unless otherwise specified.The primer, probe and sequencing efforts used are by raw work biology work
Journey (Shanghai) limited company synthesizes and completes.
The preparation of embodiment 1Lectin gene standard items,
Establish real time fluorescence quantifying PCR method it may first have to which the external standards needed for preparation method, standard items should wrap
Containing highly conserved, special sequence, it is ensured that the high specific of reaction.The present invention is using soybean Lectin rDNA as target sequence
Row.The present embodiment mainly expands soya seeds Lectin rDNA genes using round pcr, is connected using gene recombination technology
It is connected in plasmid vector pMD18-T, constructs recombinant plasmid pMD18-T-Lectin, and carry out corresponding PCR identifications and sequencing
Identification most afterwards through quantitative as the standard items for treating method for building up, lays the foundation for the method and assessment of next step.
First, the preparation of template DNA
1st, soya seeds genomic DNA is extracted, the template as the amplification of Lectin rDNA gene PCRs.Work is given birth to using Shanghai
The Ezup pillar plant genome DNA extraction agent box kits of Bioisystech Co., Ltd's production extract soya seeds gene
Group DNA, specific extracting method are as follows：
Suitable plant tissue is taken to add in liquid nitrogen in mortar and is fully milled into subdivision.Transfer subdivision (fresh tissues of plants
It 100mg) to 1.5ml centrifuge tubes, not thaw, add in 550 μ l, 65 DEG C of preheating Buffer P1 and 4 μ l RNaseA and be acutely vortexed
It vibrates mixing 1 minute, is placed at room temperature for 10 minutes.The Buffer P2 of 130 μ l, abundant mixing are added in, 12000rpm is centrifuged 3 minutes.
Careful supernatant of drawing is careful not to be drawn onto boundary material, 12000rpm is centrifuged 1 minute, collects lower liquid to a splitter A.Add
The Buffer P3 for entering 1.5 times of volumes are softly vortexed at once, abundant mixing.Mixture obtained by previous step is added in into an adsorption column
In AC, (adsorption column is added in collecting pipe) 12000rpm is centrifuged 1 minute, outwells the waste liquid in collecting pipe.Add in 700 μ l rinsing liquids
WB, 12000rpm are centrifuged 1 minute, discard waste liquid.500 μ l rinsing liquids WB, 12000rpm centrifugation 1 minute is added in, discards waste liquid.It will
Adsorption column AC is put back in sky collecting pipe, and 13000rpm is centrifuged 3-5 minutes, removes rinsing liquid as far as possible, is taken out adsorption column AC, is put into one
In a clean centrifuge tubes, 50 μ l elution buffer EB are added in the middle part of adsorption column, are placed at room temperature for 3-5 minutes,
12000rpm is centrifuged 1 minute and is collected DNA, can put -20 DEG C of preservations.
2nd, the PCR amplification of Lectin rDNA genetic fragments
1st, the design and synthesis of primer
Soybean Lectin genes are the Inner sources genes in soybean, and Inner sources gene is more more stable than foreign gene work in-process, should
Gene is respectively provided with very high conservative in each stage that soybean develops.
The present invention to soybean endogenous gene Lectin rDNA complete sequences in ncbi database by carrying out bioinformatics ratio
To analysis, choose and be suitble to the conservative fragments sequence of design primer and probe for target, using 5 softwares of Primer Premier,
Devise one group of primer pair.
The extension increasing sequence that the present invention chooses is as follows：
5’-CGATGTGGTCGATTTGAAGACTTCTCTTCCCGAGTGGGTGAGGATAGGGTTCTCTGCTGCCACGGG
ACTCGACATACCTGGGGAATCGCATGACGTGCTTT-3’。
The primer pair that the present invention designs is as follows：
Sense primer：Lectin 1637F：5’-CGATGTGGTCGATTTGAAGA-3’
Anti-sense primer：Lectin 1737R：5’-AAAGCACGTCATGCGATTC-3’.
2nd, PCR reaction systems and reaction condition
Using the soy bean DNA of extraction as template, draw by amplification of above-mentioned special primer Lectin 1637F/Lectin 1737R
Object carries out PCR amplification using following systems and reaction condition.PCR system is as follows：
Wherein primer uses Lectin1637F/Lectin 1737R, and Taq enzyme wins day (BSA09M2) using Hangzhou, and PCR expands
Increase instrument as the grand PCR model MG96+ in Xi'an day.
Amplification program/reaction condition：94 DEG C of pre-degeneration 5min；94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min, 35 Xun Huans；72
DEG C 10min takes 3 μ L amplified productions to carry out 1% agarose electrophoresis, detects PCR product size, is then produced using AXYGEN companies
The purifying of DNA gel QIAquick Gel Extraction Kit recycle remaining pcr amplification product.The sequence expanded using above-mentioned primer pair is：
5’-CGATGTGGTCGATTTGAAGACTTCTCTTCCCGAGTGGGTGAGGATAGGGTTCTCTGCTGCCACGGG
ACTCGACATACCTGGGGAATCGCATGACGTGCTTT-3’。
3rd, the structure of recombinant plasmid pMD18-T-Lectin rDNA and conversion
1st, coupled reaction：The pcr amplification product that above-mentioned purifying obtains and pMD18-T (Dalian treasured biotech firm) are connected
It connects, is prepared using following linked system：
Preparation completion is placed on 16 DEG C and carries out staying overnight coupled reaction.
2nd, the conversion of pMD18-T-Lectin plasmids and PCR identifications
1. taking out the DH5 α competent cells frozen from -70 DEG C of ultra low temperature freezer, being placed on ice chest makes it solve naturally
Freeze；
2. 10 μ L of connection product is taken to add in the DH5 α competent cells of 50 μ L, postposition ice bath is gently shaken up 30 minutes；
3. heat shock 90 seconds, puts cooled on ice 2min immediately in 42 DEG C of water-baths after heat shock；
After 4. LB fluid nutrient mediums (being free of ampicillin) mixing of the 400ml of precooling is added in into 1.5ml EP pipes,
37 DEG C of 200 revs/min of jog culture 1h；
5. 100 μ l is taken to be coated on the LB tablets containing Amp after above-mentioned culture solution is shaken up, face up and place 30min, treat
After bacterium solution is cultured base absorption completely, 37 DEG C of insulating box overnight incubations of culture dish are inverted；
6. next day is observed, picking white monoclonal diluting colonies draw 2 μ L conducts in 50 μ L sterile waters from tablet
Pcr template, remaining dilution bacterium solution are added in the LB culture mediums of 20ml expand and shake；
7. expanding above-mentioned dilution bacterium solution with carrier universal primer RV-M/M13-47, PCR product uses 1% Ago-Gel
Electrophoresis identifies positive transformant by detecting PCR product size.
Primer RV-M/M13-47 sequences are as follows：
Primer RV-M:5’-GAGCGGATAACAATTTCACACAGG-3’
Primer M13-47:5’-CGCCAGGGTTTTCCCAGTCACGAC-3’
PCR reaction systems are as follows：
Amplification program/reaction condition：94 DEG C of pre-degeneration 5min；94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min, 35 Xun Huans；72
℃10min。
Using the Plasmid Preparation kit extraction positive recombinant plasmid pMD18-T-Lectin of Axygen companies production
RDNA, measured concentration and purity, while draw a part of plasmid purification and supreme marine growth Engineering Co., Ltd is given to be sequenced, really
The gene order for determining Insert Fragment is consistent with aim sequence.
4th, the acquisition of standard items and quantitative
1st, the 100 μ L of bacillus coli DH 5 alpha containing recombinant plasmid pMD18-T-Lectin rDNA that step 3 obtains is taken to turn
For kind in the LB fluid nutrient mediums of 5mL, 37 DEG C of 200rpm shake training overnight；
2nd, the bacterium solution transferred speciess of 1ml overnight incubations is taken in 30ml LB fluid nutrient mediums, when 200rpm Zengjing Granules 2-3 is small, so
Afterwards using the Plasmid Preparation kit extraction plasmid of Axygen companies production；
3rd, the plasmid of extraction is measured using ultramicron ultraviolet-uisible spectrophotometer, measures A260、A280, according to
A260/A280The purity of plasmid is judged, according to A260Absorbance can calculate the content of Plasmid DNA in sample, i.e. 1OD values phase
When in 50 μ g/ml double-stranded DNAs.
4th, plasmid pMD18-T-Lectin rDNA concentration (copy number) calculates
(1) molecular weight=2793bp × 660 (average molecular weight of each pair base) of plasmid
(2) plasmid concentration is measured as 417.65 μ g/ul.Cause is when carrying out real-time fluorescence quantitative PCR, it is necessary to " copy number "
For unit, it is therefore desirable to by Conversion of measurement unit into copies/ml.
Plasmid copies/ml=Avgadro constants × plasmid molal quantity
Wherein Avgadro constant=6.02 × 1023copies/mol。
Therefore plasmid concentration copies/ml=417.65 μ g/ml × 10 of extraction-9×6.02×1023copies/mol÷
(2793bp×660g/bp·mol)
=13.63 × 1010copies/ml
The sterile water of+136.3 μ l of 10 μ l plasmids just obtains concentration as 1.00 × 1010The plasmid of copies/ml, then by the matter
Grain 10 doubling dilutions of progress just can obtain a series of plasmid of concentration and be preserved to get to the standard items of series concentration, and in -20 DEG C
It is spare.2 real-time fluorescence quantitative PCR kit of embodiment
First, the design and synthesis of specific primer and probe
Using the conservative fragments of the Lectin rDNA genes of the soybean of above-mentioned selection as target, using Primer
5 softwares of Premier devise one group of real-time fluorescence quantitative PCR primer and probe.
In order to distinguish the Vegetable Oils such as soybean and peanut, corn, sesame, rape, flax, walnut, sunflower and olive
Detection, the soybean detection zone that the present invention chooses are the Lectin rDNA genes of soybean, are had in each stage of soybean development
There is very high conservative.Soybean Lectin rDNA genes are subjected to blast comparisons in NCBI, as a result such as Fig. 1：
Comparison result shows that soybean Lectin rDNA gene conservatives are very high.With Vegetable Oils such as peanut oil
Arah1 genes, flax FAD3a genes, corn Zein rDNA genes, sesame oil Zein rDNA bases, sunflower oil 11S rDNA bases
Because without any homology, therefore primed probe can be designed on this gene for detecting soybean oil.
Soybean Lectin rDNA genes are downloaded on NCBI, pass through Primer Premier 5 and Becon Designer
Software for Design multipair Lectin rDNA gene primers and probe, and pass through the BLAST in NCBI and carry out primer specificity and test
Card, it is believed that wherein have that three pairs of primer specificities are all very high, and comparison result is shown in Fig. 2-4.
Fig. 2-Fig. 4 is 3 pairs of primed probe specific b LAST comparison results.
Every pair of primers of soybean is subjected to primer specificity screening by regular-PCR, the template of selection is：Flax, greatly
Beans, sunflower, peanut, rape, corn, sesame, olive, walnut, potato, using water as feminine gender, amplified band runs glue, in three pairs of primers
There are the PCR specificity highests of pair of primers, the nucleotides sequence of the primer pair is classified as：
Sense primer is 5 '-CGATGTGGTCGATTTGAAGA-3 ',
Anti-sense primer is 5 '-AAAGCACGTCATGCGATTC-3 '.
Fig. 5 is amplified production electrophoresis result after the optimal primer pair is expanded different templates using regular-PCR method.Its
In, from left to right it is followed successively by：Mark, flax, sunflower, soybean, peanut, rape, corn, sesame, olive, walnut, potato, water.
Fluorescence quantification PCR primer specificity screening is carried out using the primer and probe, experimental result is that the primed probe is true
Specific requirements can be met in fact.It is specific as follows：
As the core of the present invention, one group of primer and probe nucleotide sequence for soybean real time fluorescent PCR detection method with
And amplified fragments are as described below：
Sense primer is 5 '-CGATGTGGTCGATTTGAAGA-3 ',
Anti-sense primer is 5 '-AAAGCACGTCATGCGATTC-3 ',
Probe is 5 '-FAM-AACCCTATCCTCACCCACTCG-TAMRA-3 '.
The fluorescent reporter group that probe 5 ' is held is FAM, and 3 ' end marks are fluorescent quenching group TAMRA, while can also
Mark others fluorescent reporter group such as TET, JOE, HEX, VIC and fluorescent quenching group such as DABCYL, BHQ etc..
The nucleotides sequence of amplification is classified as：
5’-CGATGTGGTCGATTTGAAGACTTCTCTTCCCGAGTGGGTGAGGATAGGGTTCTCTGCTGCCACGGG
ACTCGACATACCTGGGGAATCGCATGACGTGCTTT-3’
2nd, the preparation of sample to be tested
The present invention extracts vegetable oil DNA using freeze-drying, ensures the purity and concentration of vegetable oil DNA extractions.
Because refined oil is less by complicated processing rear impurity, therefore how effectively the emphasis that DNA is extracted in refined oil is
Enriching plant oil in minim DNA.The process as a concentration is freeze-dried, DNA concentration can be made to be increased to precipitation and made
In the range of, prepare for subsequent precipitation, ensure the purity and concentration of vegetable oil DNA extractions.Specific processing method is as follows：
1. sample pre-treatments
1) soybean oil 20ml is taken in 50ml centrifuge tubes, adds 20ml sterile waters, vibrates 30min；
2) 5000r/min centrifuges 30min, is carefully mutually transferred to water in culture dish；
3) culture dish is put in -80 DEG C of freeze overnights, culture dish then is gone to vacuum drying machine steams completely to moisture
Hair.
2. cracking is with separating
1) plus 1-2ml CTAB Extraction buffers (in 1000ml water dissolve CTAB 20g, Tris 12.1114g,
NaCl81.1816g, Na2EDTA7.4144g, high pressure sterilization) into culture dish, 65 DEG C of warm bath 10min；
2) culture dish is rinsed repeatedly with CTAB Extraction buffer carefuls, buffer solution is transferred to 1.5ml centrifuge tubes
In；
3) 400 μ L/ are managed, and add 1 μ L2.5% linear acrylamides, 3mol/l NaAc, the 1ml absolute ethyl alcohols of 1/10 volume,
Mixing, -20 DEG C of placement 1h；
4) 15000r/min centrifuges 10min removal supernatants, and 70% ethyl alcohol is washed precipitation 1 time, dried；
5) plus 100 μ L sterile waters fully dissolve precipitation, -20 DEG C of preservations.
3rd, real-time fluorescence quantitative PCR condition optimizing
Using concentration as 1.00 × 106The positive plasmid of copies/ml be template, using hundred Imtech production 2 ×
Real-timePCR Premixture (probe) real-time fluorescence quantitative PCR kit is tested, and tests the real-time glimmering of use
Fluorescent Quantitative PCR instrument is the ASA-9600 real-time fluorescence quantitative PCRs of Suzhou Bai Yuan gene technology Co., Ltd production.
Reaction system uses 10 μ l systems, and the wherein amount of primer and probe is reacted using the combination of table 1.
Table 1
Reaction condition：94 DEG C of pre-degenerations 2 minutes, 94 DEG C 15 seconds, 60 DEG C of 40s and collect fluorescence signal, 40 cycles.As a result
Reference Fig. 1, when data show 10 μ l systems, when primer (5 μM) is separately added into (5 μM) 0.2 μ l of addition of 0.1 μ l and probe, Ct values
Minimum, fluorescence signal are most strong.
Fig. 6 is primer and probe system optimization experimental result of the present invention.When 10 μ l systems are shown in figure, a represents primer (5 μ
M (5 μM) 0.2 μ l of addition of 0.1 μ l and probe) are added in；B represents (5 μM) of primer and adds in (5 μM) 0.1 μ l of addition of 0.2 μ l and probe；c
It represents (5 μM) of primer and adds in (5 μM) 0.1 μ l of addition of 0.1 μ l and probe；D represents (5 μM) of primer and adds in 0.1 μ l and probe (5 μM)
Add in 0.3 μ l；E represents (5 μM) of primer and adds in (5 μM) 0.2 μ l of addition of 0.3 μ l and probe；F represents (5 μM) 0.2 μ l of addition of primer
With (5 μM) 0.2 μ l of addition of probe.4th, the foundation of real-time fluorescence quantitative PCR kit
1st, real-time fluorescence quantitative PCR kit includes following components：
2 × premix, final concentration of 5 μM of sense primer, final concentration of 5 μM of anti-sense primer, final concentration of 5 μM of spy
(series concentration of series concentration standard items is Lectin rDNA gene series concentration standards prepared by pin, embodiment 1：
(1.00×108copies/ml、1.00×107copies/ml、1.00×106copies/ml、1.00×105copies/ml、
1.00×104Copies/ml), (concentration is 1.00 × 10 to positive control7Recombinant plasmid prepared by the embodiment 1 of copies/ml
PMD18-T-Lectin rDNA) and ddH2O, ddH2O is used as reagent and negative control.
Sense primer is 5 '-CGATGTGGTCGATTTGAAGA-3 ',
Anti-sense primer is 5 '-AAAGCACGTCATGCGATTC-3 ',
Probe is 5 '-FAM-AACCCTATCCTCACCCACTCG-TAMRA-3 '.
2nd, using the standard curve of real-time fluorescence quantitative PCR kit measurement standard items
The Lectin rDNA gene series concentration standards (series concentrations of series concentration standard items prepared with embodiment 1
For：(1.00×108copies/ml、1.00×107copies/ml、1.00×106copies/ml、1.00×105copies/
ml、1.00×104Copies/ml it is) template, using the primer and probe in kit, carries out fluorescent quantitative PCR, together
When positive control and negative control are set.
PCR reaction systems are as follows：
Reaction condition：94 DEG C of pre-degenerations 2 minutes, 94 DEG C 15 seconds, 60 DEG C of 40s and collect fluorescence signal, 40 cycles.
The preparation method of standard curve：Using the logarithm of the plasmid concentration of standard items as abscissa, obtained using ct values as ordinate
To standard curve, as a result with reference to figure 7.Standard curve original equation is y=a+bx, and the equation of this standard curve is Y=
39.13-3.13x。
Fig. 7 is the standard curve of soybean standard items of the present invention.As shown in Figure 7, standard items standard curve is smooth, related coefficient
Height is specially R2=0.9958, meet the requirement of real-time fluorescence quantitative PCR detection.
3 real-time fluorescence quantitative PCR kit of embodiment is to the quantitative detecting method of sample to be tested
The Lectin rDNA gene series concentration standards prepared respectively with sample to be tested DNA and embodiment 1 are (serial dense
Degree standard items series concentration be：(1.00×108copies/ml、1.00×107copies/ml、1.00×106copies/
ml、1.00×105copies/ml、1.00×104Copies/ml it is) template, using the primer and probe in kit, carries out
Fluorescent quantitative PCR, while positive control and negative control are set.
PCR reaction systems are as follows：
Reaction condition：94 DEG C of pre-degenerations 2 minutes, 94 DEG C 15 seconds, 60 DEG C of 40s and collect fluorescence signal, 40 cycles.It draws
Standard curve carries out Quantitative detection by the Ct values of standard curve and sample to be tested.
The performance test of 4 real-time fluorescence quantitative PCR kit of embodiment
1st, sensitivity experiment
The recombinant plasmid pMD18-T-Lectin rDNA that embodiment 1 is prepared are subjected to 10 doubling dilutions and obtain a system
The plasmid of row concentration, it is 1.00 × 10 to choose concentration9copies/ml、1.00×108copies/ml、1.00×107copies/
ml、1.00×106copies/ml、1.00×105copies/ml、1.00×104copies/ml、1.00×103copies/
ml、1.00×102Copies/ml etc. is used as gradient template.Reaction system is as follows：
Reaction condition：94 DEG C of pre-degenerations 2 minutes, 94 DEG C 15 seconds, 60 DEG C of 40s and collect fluorescence signal, 40 cycles.According to
Fluorescence signal detected by instrument obtains fluorescence curve through software processing, observes the signal of fluorescence curve, is as a result shown (see Fig. 8)
Show when plasmid concentration reaches 1.00 × 102Still have fluorescence signal during copies/ml, and when plasmid concentration reaches 1.00 ×
101There is no fluorescence signal during copies/ml, therefore the sensitivity of this method is 1.00 × 102copies/ml。
Fig. 8 is sensitivity experiment result of the present invention.It is respectively 1.00 × 10 that wherein A1-J1, which corresponds to plasmid concentration,9copies/
ml、1.00×108copies/ml、1.00×107copies/ml、1.00×106copies/ml、1.00×105copies/
ml、1.00×104copies/ml、1.00×103copies/ml、1.00×102copies/ml、1.00×101copies/
Ml, negative control.
2nd, specificity experiments
In order to confirm specificity of the present invention to soybean detection, we have chosen other oil crops and do specificity experiments,
The oil crops of selection include：Peanut, flax, corn and soybean, potato, sesame, rape, walnut, sunflower, olive.
Wherein peanut, flax, corn and soybean, potato, sesame, rape, walnut, sunflower, olive etc. use hundred Tyke of Beijing
New quick-speed plant tissue gene group DNA extraction kit (DP3111) extracts DNA.Using hundred Imtech production 2 ×
Real-time PCR Premixture (probe) real-time fluorescence quantitative PCR kit is tested, and reaction system is as follows：
Primer and probe is described in embodiment 2.
Reaction condition：94 DEG C of pre-degenerations 2 minutes, 94 DEG C 15 seconds, 60 DEG C of 40s and collect fluorescence signal, 40 cycles.According to
Fluorescence signal detected by instrument obtains fluorescence curve through software processing, observes the signal of fluorescence curve, analysis specificity.Knot
Fruit is feminine gender for only soybean test positive, remaining oil crops with reference to figure 4, concrete outcome, and it is fine to show that the present invention has
Specificity (ct values>35 be feminine gender).Testing result such as table 2.
Table 2
Fig. 9 is specificity experiments result of the present invention.Wherein template is respectively：Peanut, flax, corn and soybean, potato, sesame
Fiber crops, rape, walnut, sunflower, olive, negative control.
Finally it should be noted that：The foregoing is only a preferred embodiment of the present invention, is not intended to limit the invention,
Although the present invention is described in detail with reference to the foregoing embodiments, for those skilled in the art, still may be used
To modify to the technical solution recorded in foregoing embodiments or carry out equivalent substitution to which part technical characteristic.
Within the spirit and principles of the invention, any modifications, equivalent replacements and improvements are made should be included in the present invention's
Within protection domain.
Sequence table
<110>Suzhou Bai Yuan gene technology Co., Ltd
<120>For detecting the specific primer of soy bean DNA and probe and real-time fluorescence quantitative PCR kit
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 101
<212> DNA
<213>Soybean Lectin genes (Lectin DNA)
<400> 1
cgatgtggtc gatttgaaga cttctcttcc cgagtgggtg aggatagggt tctctgctgc 60
cacgggactc gacatacctg gggaatcgca tgacgtgctt t 101
Claims (10)
1. for detecting the specific primer and probe of soy bean DNA, it is characterised in that：The probe sequence is：5’-
AACCCTATCCTCACCCACTCG-3’；
The specific primer be following sequences or be following sequences complementary strand sequence：
Upstream primer sequence is 5 '-CGATGTGGTCGATTTGAAGA-3 '；
Downstream primer sequence is 5 '-AAAGCACGTCATGCGATTC-3 '.
2. specific primer according to claim 1 and probe, it is characterised in that：The fluorescence report of 5 ' end marks in probe
Group is one kind in FAM, TET, JOE, HEX, VIC, and the fluorescent quenching group of 3 ' end marks is in TAMRA, DABCYL, BHQ
One kind.
3. specific primer according to claim 1 and probe, it is characterised in that：The sense primer and the downstream are drawn
Object is to 5 ' ends and 3 ' extreme directions extension one to several bases or deletes a sequence obtained to several bases.
4. a kind of real-time fluorescence quantitative PCR kit for being used to detect soy bean DNA, it is characterised in that：The real time fluorescent quantitative
PCR kit includes claim 1-3 any one of them specific primer and probe.
5. real-time fluorescence quantitative PCR kit according to claim 4, it is characterised in that：In 10 μ l PCR reaction systems
In, the dosage of the sense primer is 0.1 μ l, and the dosage of the anti-sense primer is 0.1 μ l, and the dosage of the probe is 0.2 μ l.
6. real-time fluorescence quantitative PCR kit according to claim 4 or 5, it is characterised in that：The real time fluorescent quantitative
PCR kit further includes series concentration standard items and positive control；The series concentration standard items are by soybean Lectin rDNA
Gene is connected with carrier, converts into competent cell induced expression, is extracted recombinant plasmid, is diluted after recombinant plasmid is quantified,
Obtain series concentration standard items.
7. real-time fluorescence quantitative PCR kit according to claim 6, it is characterised in that：The nucleotide of the standard items
Sequence is sequence 1 in sequence table.
8. any specific primers of claim 1-3 and any real time fluorescent quantitative of probe, claim 4-7
PCR kit it is following it is any in application：
(1) qualitatively or quantitatively detection or auxiliary detect soybean；
(2) product of qualitative or quantitative detection or auxiliary detection soybean is prepared；
(3) qualitatively or quantitatively whether soybean oil is contained in detection or auxiliary detection vegetable oil；
(4) prepare in qualitative or quantitative detection or auxiliary detection vegetable oil whether the product containing soybean oil.
9. it is a kind of detection or auxiliary detection vegetable oil in whether the method containing soybean oil, it is characterised in that：It is dense with series respectively
It is template to spend standard items and sample to be tested DNA, carries out real-time fluorescence quantitative PCR using specific primer and probe, draws standard
Curve judges result by the Ct values of standard curve and sample to be tested；Preferably, the sample to be tested DNA is dry using freezing
Dry method extraction.
10. according to the method described in claim 9, it is characterized in that：The reaction condition of the real-time fluorescence quantitative PCR is：94
DEG C pre-degeneration 2 minutes, 94 DEG C 15 seconds, 60 DEG C of 40s and collect fluorescence signal, 40 cycles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810130628.1A CN108103234A (en) | 2018-02-08 | 2018-02-08 | For detecting the specific primer of soy bean DNA and probe and real-time fluorescence quantitative PCR kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810130628.1A CN108103234A (en) | 2018-02-08 | 2018-02-08 | For detecting the specific primer of soy bean DNA and probe and real-time fluorescence quantitative PCR kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108103234A true CN108103234A (en) | 2018-06-01 |
Family
ID=62221012
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810130628.1A Withdrawn CN108103234A (en) | 2018-02-08 | 2018-02-08 | For detecting the specific primer of soy bean DNA and probe and real-time fluorescence quantitative PCR kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108103234A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115369185A (en) * | 2022-09-06 | 2022-11-22 | 中华人民共和国大连海关 | Complete set of reagent for real-time fluorescent PCR detection of pea-derived components and detection method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2107126A1 (en) * | 2008-03-31 | 2009-10-07 | Eppendorf Array Technologies SA | Detection of unspecified genetically modified organism (GMO) on micro-arrays |
| CN104450946A (en) * | 2014-12-30 | 2015-03-25 | 暨南大学 | Transgenic soybean GTS40-3-2 and endogenous and exogenous gene multi-nested fluorescent quantitative PCR (polymerase chain reaction) detection primer combination method |
| CN105603056A (en) * | 2014-11-21 | 2016-05-25 | 丰益(上海)生物技术研发中心有限公司 | Method for detecting doped impurity in vegetable fat |
-
2018
- 2018-02-08 CN CN201810130628.1A patent/CN108103234A/en not_active Withdrawn
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2107126A1 (en) * | 2008-03-31 | 2009-10-07 | Eppendorf Array Technologies SA | Detection of unspecified genetically modified organism (GMO) on micro-arrays |
| CN105603056A (en) * | 2014-11-21 | 2016-05-25 | 丰益(上海)生物技术研发中心有限公司 | Method for detecting doped impurity in vegetable fat |
| CN104450946A (en) * | 2014-12-30 | 2015-03-25 | 暨南大学 | Transgenic soybean GTS40-3-2 and endogenous and exogenous gene multi-nested fluorescent quantitative PCR (polymerase chain reaction) detection primer combination method |
Non-Patent Citations (6)
| Title |
|---|
| NICOLAS GRYSON等: "Influence of cocoa components on the PCR detection of soy lecithin DNA", 《EUR FOOD RES TECHNOL》 * |
| VODKIN,L.O.等: "Soybean lectin (Le1) gene, complete cds", 《GENBANK》 * |
| 周云龙: "《转基因生物标准物质研制与应用》", 31 August 2014, 中国质检出版社 * |
| 比毕等: "《分子生态学》", 31 October 2009, 中山大学出版社 * |
| 王德莲等: "PCR方法检测花生油掺假研究", 《粮食与油脂》 * |
| 白立群等: "一种有效的大豆精炼油DNA 提取新方法—冷冻干燥法", 《分离与提取》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115369185A (en) * | 2022-09-06 | 2022-11-22 | 中华人民共和国大连海关 | Complete set of reagent for real-time fluorescent PCR detection of pea-derived components and detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102965438B (en) | Duplex polymerase chain reaction (PCR) detection primer group, kit and method for pathogenic channa source aeromonas schubertii | |
| CN107058594A (en) | A kind of method, primer and kit for detecting gout tumor susceptibility gene SNP genotype | |
| CN105063229B (en) | For detecting quantitative fluorescent PCR specific primer, probe and its kit of sheep derived material in meat products | |
| CN106399511A (en) | Method and primer for detecting soil watermelon fusarium oxysporum through fluorescent quantitative real-time PCR | |
| CN108060267A (en) | PCR primer and its detection method used in a kind of detection Brassica 2 et 4 | |
| CN110066880A (en) | A kind of method of four large Chinese carp fish product of fast qualitative detection | |
| CN108315471B (en) | Specific gene and specific primer for identifying plasmodiophora tumefaciens No.4 physiological race, kit containing primer and application of kit | |
| CN108165650A (en) | For detecting the specific primer of sesame DNA and probe and real-time fluorescence quantitative PCR kit | |
| CN108103234A (en) | For detecting the specific primer of soy bean DNA and probe and real-time fluorescence quantitative PCR kit | |
| Shen et al. | Genetic diversity of Ustilago scitaminea Syd. in Southern China revealed by combined ISSR and RAPD analysis | |
| CN108559783B (en) | RPA primer, kit and detection method for detecting four common root-knot nematodes | |
| CN108103233A (en) | For detecting the specific primer of peanut DNA and probe and real-time fluorescence quantitative PCR kit | |
| CN111690759B (en) | Specific primer, kit and method for detecting RPA of citrus canker pathogen | |
| CN108103156A (en) | For detecting the specific primer of sunflower DNA and probe and real-time fluorescence quantitative PCR kit | |
| WO2020047949A1 (en) | Method for predicting symptom appearance rate and severity of sweet potato viral disease in nursery stage | |
| CN102796825B (en) | Specificity polymerase chain reaction (PCR) method for detecting heterodera elachista ohshima | |
| CN108103232A (en) | For detecting the specific primer of flax DNA and probe and real-time fluorescence quantitative PCR kit | |
| CN110331223B (en) | Molecular marker, primer pair, kit and method for identifying different cane shoots types | |
| CN108277294A (en) | Specific primer and probe for detecting maize dna and real-time fluorescence quantitative PCR kit | |
| CN116287391A (en) | RPA primer for detecting tobacco target spot disease, primer/probe combination and application thereof | |
| CN109988860B (en) | Primer and probe composition for detecting phytophthora hibernalis, kit and detection method thereof | |
| CN106755602B (en) | Method for synchronously detecting SPVG, SPLV and SPMMV | |
| CN106755557A (en) | A kind of transgenic wheat and the detection method of cotton | |
| CN109943652A (en) | A kind of multiple PCR reagent kit and the method with its quick detection Pediococcus acidilactici | |
| CN105219878A (en) | A kind of neosporosis detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20180601 |