CN108103077B - Variable shears for regulating and controlling plant shade-avoiding reaction and application thereof - Google Patents

Abstract

The invention provides a variable shears for regulating and controlling plant shade-avoiding reaction and application thereof, belonging to the technical field of plant genetic engineering. The variable spliceosome is derived from a variable spliceosome GmERa.2 of a homologous protein GmERa coded by a soybean GmERECTA gene, and the nucleotide sequence of the GmERa.2 is shown as SEQ ID No. 1; the amino acid sequence corresponding to the GmERa.2 nucleotide sequence is shown as SEQ ID No. 2. GmERa.2 only contains 15 Leucine-rich repeat sequences (LRR) in an extracellular domain, and through genetic transformation and physiological and biochemical experiments in Arabidopsis, the sensitivity of an Arabidopsis thaliana er deletion mutant to shade can be changed by over-expression of GmERa.2, which proves that the GmERa.2 is really involved in the shade-avoiding reaction of plants. The invention not only finds out a new shearing form of the receptor kinase, but also is beneficial to performing functional deletion mutation or silencing on the gene by utilizing the gene sequence, is beneficial to improving the variety of crops by utilizing the characteristics of the receptor kinase GmERECTA gene and applying a biotechnology means, and reduces the sensitivity of low-position crops to high-position crop shading in intercropping.

Description

Variable shears for regulating and controlling plant shade-avoiding reaction and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a variable clipper for regulating and controlling a plant shade-avoiding reaction and application thereof.

Background

The corn-soybean zonal intercropping planting mode popularized in large area in southwest China improves the land yield and the agricultural sustainable development, but the high-level crop corn can generate shading stress on the low-level crop soybean in the mode. In response to self-growth, crops such as soybean initiate shade-avoidance responses to changes in shade, which, while beneficial to single plant growth and reproduction, can result in reduced crop population yield for high-density crop populations. Therefore, how to overcome the shade-avoiding reaction of crops and reduce the influence of the crops on the yield is an important way for realizing high yield.

Disclosure of Invention

The invention aims to provide a variable clipper for regulating and controlling the shade-avoiding reaction of plants and application thereof aiming at the problems existing in the intercropping planting mode. The purpose of the invention is realized by the following technical scheme:

a variable spliceosome for regulating and controlling a plant shade-avoiding response, wherein the variable spliceosome is derived from a variable spliceosome GmERa.2 of a homologous protein GmERa coded by a soybean GmERECTA gene, and the nucleotide sequence of the GmERa.2 is shown as SEQ ID No. 1.

Furthermore, the amino acid sequence corresponding to the nucleotide sequence of the GmERA.2 is shown as SEQ ID No. 2.

The application of a variable spliceosome for regulating and controlling a plant shade-avoiding response, and the application of the variable spliceosome in regulating and controlling the plant shade-avoiding response.

As a specific example of the application of the variable shears for regulating and controlling the plant shade-avoiding reaction, the application of the variable shears in regulating and controlling the arabidopsis shade-avoiding reaction is provided.

As a specific example of the application of the variable shears for regulating and controlling the plant shade-avoiding reaction, the application of the variable shears in regulating and controlling the arabidopsis thaliana shade-avoiding reaction comprises the following steps:

1) cloning GmERa.2 from soybean;

2) an expression vector pBASTA-35S-GWR-GFP constructed by the nucleotide sequence of the soybean GmERA.2 is transferred into an Arabidopsis ERECTA mutant er-3 for over-expression, and the expression conditions of the gene transcription level and the protein level are detected.

As a specific example of the application of the variable cutter for regulating and controlling the shade-avoiding reaction of the plant, the cloning in the step 1) adopts a Gateway cloning method, and comprises the following steps:

A. the GmERa.2 gene fragment is connected with an attB sequence through two rounds of PCR amplification;

B. carrying out BP reaction on the gene connected with the attB sequence through glue recovery to construct an entry vector pDONR/zeo;

C. transforming a BP reaction product into DH5 α, coating the DH5 α on an LB culture medium containing 50 mu g/ml zeocin resistance, carrying out overnight culture at 37 ℃, after identifying colony PCR as a positive clone, selecting the positive clone to a liquid LB culture medium containing 50 mu g/ml zeocin, carrying out overnight shaking culture at 37 ℃, extracting a plasmid by using a kit, carrying out enzyme digestion identification on the plasmid, and then sequencing;

D. after the sequencing is correct, the constructed entry vector is subjected to LR reaction to construct a pBASTA-35S-GWR-GFP expression vector;

E. and finally, transforming the plasmid into agrobacterium GV3101, coating the agrobacterium GV3101 on a 50 mu g/ml kanamycin +50 mu g/ml gentamycin LB solid culture medium, culturing at 28 ℃ for 2d, and storing the strain in 15% of glycerol after the colony PCR is identified as a positive clone.

As a specific example of the application of the variable shears for regulating and controlling the plant shade-avoidance reaction, in step a, the primers used in the first round of PCR amplification are:

5'-AAAAAGCAGGCTTCATGAAACAGCTGGAAAATCTG-3' and

5'-AGAAAGCTGGGTCCAAGGATATAATGTTCTGAAGC-3', respectively; the primers used in the second round of PCR amplification are as follows:

5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3' and

5’-GGGGACCACTTTGTACAAGAAAGCTGGGT-3’。

as a specific example of the application of the variable cutter for regulating the plant shade-avoidance response, the primers used for colony PCR identification are 5'-ATGAAACAGCTGGAAAATCTG-3' and 5'-CAAGGATATAATGTTCTGAAGC-3'.

As a specific example of the application of the variable cutter for regulating and controlling the shade-avoidance response of plants, in step E, the enzyme digestion identification system is as follows: NEB Buffer 1.11. mu.l; BsrGI 0.1. mu.l; the recombinant plasmid pBASTA-35S-GmERA.2-GFP 8.9. mu.l is reacted in a water bath at 37 ℃ for 4 h.

As a specific example of the application of the variable shears for regulating and controlling the shade-avoiding reaction of the plants, in the step 2), the constructed expression vector pBASTA-35S-GmERA.2-GFP is transferred to the Arabidopsis ERECTA mutant er-3 by adopting a floral dip method, and the method comprises the following steps:

A. preparation of agrobacterium infection liquid: preparing 5% sucrose solution according to twice volume of LB liquid, adding Silwet L-77 to the final concentration of 0.3 per mill; centrifuging Agrobacterium for 5min at 6500rpm, collecting thallus, and resuspending in 5% sucrose solution with OD600 of 0.8;

B. flower infection: when the arabidopsis thaliana shoots 10cm, carrying out flower soaking transformation mediated by agrobacterium, carrying out dip dyeing on flower buds in the agrobacterium liquid containing 0.3 per mill Silwet L-77 and 5% of sucrose solution for 20 seconds, placing the dip-dyed plants under weak light for 12 hours, continuing normal illumination growth, carrying out second dip dyeing after one week, carrying out second dip dyeing until the flowering phase is finished, when the seeds are mature, harvesting the seeds containing transgenic seeds, spraying 1 per mill glyphosate on leaves for screening transgenic seedlings after the next week of the transgenic seeds, wherein the glyphosate-resistant seedlings are overexpression plants of the GmERA.2 gene.

Compared with the prior art, the invention has the following beneficial effects:

the invention provides a variable cutter for regulating and controlling shade-avoiding response of plants, namely a variable cutter GmERa.2 of homologous protein GmERA of soybean GmERECTA. GmERa.2 only contains 15 Leucine-rich repeats (LRR) in the extracellular domain, is different from the variable shearing of common receptor kinases, and can restore the sensitivity of an arabidopsis thaliana er-3 deletion mutant to shade through genetic transformation and phenotypic analysis in arabidopsis thaliana, so that the GmERa.2 is proved to be involved in the shade-avoiding reaction of plants. The invention not only finds out a new shearing form of the receptor kinase, but also is beneficial to improving the variety of crops by using the characteristic of the receptor kinase GmERECTA gene and applying a biotechnology means, and reduces the sensitivity of lower crops to shade of higher crops in intercropping.

Drawings

FIG. 1 is a map of the alignment of the protein sequences of two variable shears of GmERa, GmERa.1 and GmERa.2, with the protein sequence of the Arabidopsis homologous protein AtER.

FIG. 2 shows the results of detection of gene transcription level by RT-PCR in example 1.

FIG. 3 shows the results of detection of protein expression using Western blot in example 1.

FIG. 4 shows the phenotype of two transgenic lines (pBASTA-35S-GmERa.2-GFP in ER-3#1 and pBASTA-35S-GmERa.2-GFP in ER-3#2) overexpressing GmERa.2 in Col-0, the ER deletion mutant, ER-3, the ER gene mutant, ER-3, under white light and shaded growth conditions.

FIG. 5 shows the statistical results of hypocotyl length of two transgenic lines (pBASTA-35S-GmERa.2-GFP in ER-3#1 and pBASTA-35S-GmERa.2-GFP in ER-3#2) overexpressing GmERa.2 in a Col-0, ER deletion mutant, ER-3, ER gene mutant, under white light and shade growth conditions.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

A variable spliceosome for regulating and controlling a plant shade-avoiding response, wherein the variable spliceosome is derived from a variable spliceosome GmERa.2 of a homologous protein GmERa coded by a soybean GmERECTA gene, and the nucleotide sequence of the GmERa.2 is shown as SEQ ID No. 1. The amino acid sequence corresponding to the nucleotide sequence of the GmERa.2 is shown as SEQ ID No. 2.

The soybeans are ordinary soybeans which can be purchased in the market, and the preferable soybean varieties are Nanchun beans 29, Nanchun beans 12, Nanxian beans 25, Nanhuan black beans 20, Tianlong I, and Weiliai 82 which all contain the variable shears GmERa.2 required by the invention.

The receptor kinase ERECTA (AtER) in Arabidopsis may modulate the shade-avoidance response. At present, the function of the full-length complete gene of ERECTA in Arabidopsis thaliana is only found, and the variable shearing of ERECTA and homologous genes is not found in model plant Arabidopsis thaliana and other crops. Alternative splicing is an important mechanism for regulating gene expression and generating proteome diversity, and by means of bioinformatics, we found homologous proteins of AtER in soybean and named GmERa, GmERb, GmERc, GmERd, and found that GmERa has two alternative splicing gmera.1 and gmera.2.

The results of the alignment of the two variable shears GmERa.1 and GmERa.2 of GmERa with the full-length sequence of the Arabidopsis AtERECTA protein are shown in FIG. 1. The short horizontal lines indicate that an amino acid or a certain amino acid sequence is not present in one of the proteins, but is present in the other two proteins, and that these amino acids are indicated by dashed lines in the absent protein. As can be seen from FIG. 1, GmERA.2 completely coincides with a sequence of GmERA.1, which has a similarity of 92.35% with the sequence corresponding to AtER. Meanwhile, GmERA.1 is most similar to AtER of Arabidopsis in sequence and structural composition, and consists of three parts, namely an extracellular domain, a transmembrane domain and an intracellular domain.

However, another splicer for GmERa, gmera.2, contains only a partial region of the extracellular domain of gmera.1, consisting of 15 LRRs (leucine-rich repeat). Many full-length receptor kinases have been found to play important roles in plant growth and development and environmental adaptation. Similar cleavage patterns of receptor kinases have not been reported so far, and it has not been reported that a similar extracellular domain of such a short receptor kinase functions, so GmERa.2 is relatively more valuable than GmERa.1, and according to our findings, GmERa.2 indeed regulates the shade-avoidance response of Arabidopsis thaliana, and its overexpression compensates for the change in shade sensitivity due to the loss of function of the Arabidopsis thaliana homolog gene AtER.

Through genetic transformation and phenotypic analysis experiments in arabidopsis, the sensitivity of the arabidopsis er deletion mutant to shade can be restored by verifying the overexpression of GmERa.2, and the fact that the arabidopsis er deletion mutant participates in the shade-avoiding reaction of plants is proved. The invention not only clones the new cutting form of the receptor kinase GmERa gene, but also has matched primers, thereby developing the imperative for the gene cloning and transformation of GmERa.2, recombining the full-length sequence of GmERa.2 to an expression vector containing a high-activity constitutive promoter 35S, and realizing the over-expression of the gene in Arabidopsis by an agrobacterium-mediated mode. On the basis, the GmERa.2 sequence can be directly applied, and the homologous sequence of the GmERa.2 can be modified by biotechnology for all plants containing the homologous sequence of the GmERa.2 in crops such as arabidopsis, soybean and the like, so that the sensitivity of the plants to shade can be changed.

The invention also provides application of the variable shears for regulating and controlling the plant shade-avoiding reaction, and the application of the variable shears in regulating and controlling the plant shade-avoiding reaction. Furthermore, the variable shears have application in regulating and controlling the shade-avoiding reaction of soybeans. The variable shears are applied to regulating and controlling the shade-avoiding reaction of plants, and can change the sensitivity of low-position crops to the shade generated by high-position crops under the condition of close planting or intercropping.

The invention uses the variable spliceosome of the soybean GmERa to carry out cross-species application in the arabidopsis thaliana, and can change the sensitivity of the arabidopsis thaliana to shading stress. According to the bioinformatics analysis, the soybean GmER has high homology with the Arabidopsis AtER, so that the GmER has similar functions with the AtER according to the reasoning of the conventional biological functional characteristics of genes and proteins. However, a similar variable cleavage as GmERa.2 and corresponding function of modulating the shade-avoidance response was not found in Arabidopsis. Since the soybean GmERa.2 can play a role in the shade-avoiding reaction of a dicotyledonous plant, namely Arabidopsis thaliana, the fact that the GmERa.2 can play a role in regulating the shade-avoiding reaction in plants, such as dicotyledonous plants, soybean and the like is deduced from species-crossing experimental results, particularly, the existence of the variable cutter in the soybean maintains the sensitivity of the soybean to shade to a certain extent, and further experimental verification is needed for the effectiveness of monocotyledonous plants. Although soybean has GmERa.2 gene, the gene is not artificially activated or inactivated in a large amount, but can be expressed and exerted only under a special condition, and the expression of the gene is regulated by the plant to change the external environment. Results from previous studies have shown that artificial overexpression of a truncated arabidopsis ER in tomato enhances the drought resistance of tomato (vilagarcia et al, 2012). Trans-species overexpression of arabidopsis ER in arabidopsis thaliana and other crops, rice and tomato, can enhance the heat resistance of the crop (Shen et al, 2015), while these species contain ER homologous genes themselves but do not exhibit such significant drought resistance or heat resistance. It is deduced that the function of better regulating and controlling shade-avoidance response can be exerted by means of artificial activation of expression, such as overexpression of GmERa.2 under the action of 35S continuous activation type promoter in soybean.

Further, the variable spliceosome is applied to the regulation and control of arabidopsis shade-avoiding reaction. The variable splicer GmERa.2 disclosed by the invention is applied to arabidopsis thaliana, and genetic transformation and phenotype analysis in arabidopsis thaliana verify that the overexpression GmERa.2 can compensate and change the sensitivity of an arabidopsis thaliana er deletion mutant to shading, so that the variable splicer GmERa.2 is proved to be really involved in the shading reaction regulation of arabidopsis thaliana. As can be seen from the results of the current cross-species studies on ER, this effect will work well in the soybean species, which is native, even in other dicotyledonous plants such as tomato and even in the monocotyledonous rice plant.

Further, the application of the variable spliceosome in regulating and controlling the shade-avoiding reaction of arabidopsis thaliana comprises the following steps:

1) GmERA.2 was cloned from soybean.

The method adopts nested PCR and Gateway cloning method, and comprises the following steps:

A. the gmera.2 gene fragment was amplified by two rounds of PCR with attB sequences attached.

Specifically, nested PCR is performed by a first round of PCR using a specific primer of a certain gene (e.g., GmERa.2) and adding a hanging sequence designed to match with the subsequent vector sequenceFor this purpose (e.g.specific primer 5' of GmERa.2)AAAAAGCAGGCTTCATGAAACAGCTGGAAAATCTG-3' and 5-AGAAAGCTGGGTCCAAGGATATAATGTTCTGAAGC-3’。

Wherein, the sequence without underlining is the sequence strictly matched with both ends of the GmERA.2 gene, the underlining part is a part of attB sequence, and the part is the sequence matched with a pDONR/zeo vector) to amplify the target gene segment. And then, taking the first round of PCR as a template, carrying out second round of PCR on the basis, and continuously carrying out amplification in a first round of PCR primer suspension mode during second round of PCR amplification, so that not only can the amplification specificity be increased on the basis of the first round of PCR, but also the length of a suspension sequence can be continuously increased at two ends of a first round of PCR product. The primer used can be specifically combined with the first round amplification product, so that the target gene can be accurately amplified, and the specificity of the reaction is improved. After obtaining the target gene fragment, the target gene fragment is replaced with the specific fragment on the pDONR vector under the action of recombinase BP enzyme by a Gateway method, so that the amplified target gene fragment is constructed on the pDONR vector. In the experiment, during amplification of GmERa.2, in order to add attB sequences at two ends of GmERa.2, a one-round PCR method can be adopted, full-length attB1 and attB2 sequences are directly added to two ends of a GmERa.2 gene specific primer sequence during primer design, and attB1 and attB2 sequences can be added to two ends of the GmERa.2 gene only by one-time PCR amplification. Alternatively, amplification can be performed by nested PCR as used in the present method. In the experiment, a nested PCR method is selected for amplification, because attB sequences are longer, if two rounds of PCR are used, the hanging sequences can be divided into two times and added to two ends of the GmERA.2 gene, and the success rate of the PCR can be increased and the amplification specificity can be increased through the two times of amplification.

Specifically, on the basis of following the principle of primer design, primer premier 6.0 software is used to design amplification primers, and the primers used in the first round of PCR amplification are:

5’-AAAAAGCAGGCTTCATGAAACAGCTGGAAAATCTG-3' and

5’-AGAAAGCTGGGTCCAAGGATATAATGTTCTGAAGC-3'. The sequence of the upstream primer amplified by the first round of PCR is shown as SEQ ID No.3, and the sequence of the downstream primer is shown as SEQ ID No. 4.

Wherein, the sequence without underlining is the sequence strictly matched with both ends of the GmERa.2 gene, and the underlining part is a part of attB sequence which is matched with the pDONR/zeo vector. On the basis of following the principle of primer design, designing an amplification primer by using software, wherein the primers used in the second round of PCR amplification are as follows:

5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3' and

5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3' are provided. The sequence of the upstream primer of the second round of PCR amplification is shown as SEQ ID No.5, and the sequence of the downstream primer is shown as SEQ ID No. 6.

It is understood that the specific implementation and operation of the PCR amplification described in this step is well known to those skilled in the art, and will not be described in detail herein, so long as the purpose of the attB sequence is to be amplified by the primer sequences disclosed herein.

B. The gene with the attB sequence is recovered by glue to carry out BP reaction, and the gene is constructed into an entry vector pDONR/zeo.

Specifically, a GmERA.2 gene fragment with attB sequences suspended at both ends by a PCR method is subjected to BP reaction by using BP enzyme to construct an entry vector pDONR/zeo.

Further, the gene to which attB1(GGGGACAAGTTTGTACAAAAAAGCAGGCTTC) and attB2(GGGGACCACTTTGTACAAGAAAGCTGGGTC) sequences were ligated was subjected to BP reaction by gel recovery to construct an entry vector pDONR/zeo. BP reaction according to Invitrogen BP

II enzyme mix (cat. No. 11789-020) instructions.

C. and (3) transforming the BP reaction product into escherichia coli DH5 α, coating the escherichia coli DH5 α on an LB culture medium containing 50 mu g/ml zeocin resistance, carrying out overnight culture at 37 ℃, after identifying the colony PCR as a positive clone, selecting the positive clone to be in an LB culture medium containing 50 mu g/ml zeocin liquid, carrying out overnight shaking culture at 37 ℃, extracting a plasmid by using a kit, carrying out restriction enzyme identification on the plasmid, and then sequencing.

D. After the sequencing is correct, the constructed entry vector is subjected to LR reaction to construct a pBASTA-35S-GWR-GFP expression vector.

E. and finally, transforming the plasmid into agrobacterium GV3101, coating the agrobacterium GV3101 on a 50 mu g/ml kanamycin +50 mu g/ml gentamycin LB solid culture medium, culturing at 28 ℃ for 2d, and storing the strain in 15% of glycerol after the colony PCR is identified as a positive clone.

Further, the colony PCR identification used primers 5'-ATGAAACAGCTGGAAAATCTG-3' and 5'-CAAGGATATAATGTTCTGAAGC-3'. The colony PCR identification upstream primer sequence is shown as SEQ ID No.7, and the downstream primer sequence is shown as SEQ ID No. 8.

Further, the enzyme digestion identification system is as follows: NEB Buffer 1.11. mu.l; BsrGI 0.1. mu.l; the recombinant plasmid pBASTA-35S-GmERA.2-GFP 8.9. mu.l is reacted in a water bath at 37 ℃ for 4 h.

2) An expression vector pBASTA-35S-GWR-GFP constructed by the nucleotide sequence of the soybean GmERA.2 is transferred into an Arabidopsis ERECTA mutant er-3 for over-expression, and the gene transcription level and the protein level expression condition are detected.

Specifically, the constructed expression vector pBASTA-35S-GmERA.2-GFP is transferred into the Arabidopsis ERECTA mutant er-3 by adopting a floral dip method, and the method comprises the following steps:

A. preparation of agrobacterium infection liquid: preparing 5% sucrose solution according to twice volume of LB liquid, adding Silwet L-77 to the final concentration of 0.3 per mill; the Agrobacterium is centrifuged at 6500rpm for 5min, the thallus is collected and resuspended in 5% sucrose solution, OD600 is 0.8. The detailed operation process is as follows:

1) the Agrobacterium strain stored at-80 ℃ was thawed on ice, 10. mu.l was added to 50ml YEP liquid medium (50. mu.l/ml kanamycin + 50. mu.l/ml gentamicin), shake-cultured at 28 ℃ and 200rpm for 48 h.

2) Sucking 100 mul of bacterial liquid, transferring the bacterial liquid into a new 200ml YEP liquid culture medium containing antibiotics, carrying out shake culture at 28 ℃ and 200rpm for 16h, and centrifuging the bacterial liquid at 5000rpm for 5min when the bacterial liquid OD600 reaches 1.5 to collect thalli;

3) and (3) suspending the thallus precipitate in a 5% sucrose solution, adding a surfactant Silwet L-77 to a final concentration of 0.3 per mill, and uniformly mixing until the final OD600 reaches 0.8.

B. Flower infection: when the arabidopsis thaliana shoots 10cm, carrying out flower soaking transformation mediated by agrobacterium, carrying out dip dyeing on flower buds in the agrobacterium liquid containing 0.3 per mill Silwet L-77 and 5% of sucrose solution for 20 seconds, placing the dipped plants under weak light for half a day, continuing normal illumination growth, carrying out secondary dip dyeing when the dipped flower buds grow out of fruit pods after one week and new flower buds grow out again until the flowering phase is finished, when the seeds are mature, harvesting the seeds containing transgenic seeds, spraying 1 per mill glyphosate on leaves after the transgenic seeds are planted for one week, and screening transgenic seedlings, wherein the glyphosate-resistant seedlings are overexpression plants of the GmERA.2 gene.

Further, RT-PCR and Western blot methods are used for respectively detecting the expression conditions of the gene transcription level and the protein level so as to judge the transformation completion condition and the expression condition in arabidopsis thaliana.

The variable shears for regulating plant shade-avoidance response and the application thereof of the present invention are further described below with reference to specific examples.

Example 1

The application of the variable shears GmERa.2 in regulating and controlling the shade-avoiding reaction of arabidopsis thaliana is specifically illustrated in the example. The specific operation is as follows:

1) GmERA.2 was cloned from soybean.

The nested PCR and Gateway cloning method is adopted, and comprises the following steps:

A. the gene of interest was amplified by two rounds of PCR and recombined with attB sequence by BR reaction.

Specifically, the primers used in the first round of PCR amplification are:

5'-AAAAAGCAGGCTTCATGAAACAGCTGGAAAATCTG-3', and 5'-AGAAAGCTGGGTCCAAGGATATAATGTTCTGAAGC-3'. The sequence of the upstream primer amplified by the first round of PCR is shown as SEQ ID No.3, and the sequence of the downstream primer is shown as SEQ ID No. 4.

The primers used in the second round of PCR amplification are as follows:

5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3', and 5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3'. The sequence of the upstream primer amplified by the second round of PCR is shown as SEQ ID No.5, and the sequence of the downstream primer is shown as SEQ ID No. 6.

B. The gene with the attB sequence is recovered by glue to carry out BP reaction, and the gene is constructed into an entry vector pDONR/zeo.

Specifically, the GmERA.2 gene fragment with attB1(GGGGACAAGTTTGTACAAAAAAGCAGGCTTC) and attB2(GGGGACCACTTTGTACAAGAAAGCTGGGTC) sequences attached thereto was subjected to a BP reaction by gel recovery to construct an entry vector pDONR/zeo. BP reaction according to Invitrogen BP

II enzyme mix (cat. No. 11789-020) instructions.

C. and (3) transforming the BP reaction product into escherichia coli DH5 α, coating the escherichia coli DH5 α on an LB culture medium containing 50 mu g/ml zeocin resistance, carrying out overnight culture at 37 ℃, after identifying the colony PCR as a positive clone, selecting the positive clone to be in an LB culture medium containing 50 mu g/ml zeocin liquid, carrying out overnight shaking culture at 37 ℃, extracting a plasmid by using a kit, carrying out restriction enzyme identification on the plasmid, and then sequencing.

D. After the sequencing is correct, the constructed entry vector is subjected to LR reaction to construct a pBASTA-35S-GWR-GFP expression vector.

E. and finally, transforming the plasmid into agrobacterium GV3101, coating the agrobacterium GV3101 on a 50 mu g/ml kanamycin +50 mu g/ml gentamycin LB solid culture medium, culturing at 28 ℃ for 2d, and storing the strain in 15% of glycerol after the colony PCR is identified as a positive clone.

Wherein, primers 5'-ATGAAACAGCTGGAAAATCTG-3' and 5'-CAAGGATATAATGTTCTGAAGC-3' are adopted for colony PCR identification. The colony PCR identification upstream primer sequence is shown as SEQ ID No.7, and the downstream primer sequence is shown as SEQ ID No. 8.

The enzyme digestion identification system in the step C and the step E is as follows: NEB Buffer 1.11. mu.l; BsrGI 0.1. mu.l; the recombinant plasmid pBASTA-35S-GmERA.2-GFP 8.9. mu.l is reacted in a water bath at 37 ℃ for 4 h.

2) An expression vector pBASTA-35S-GWR-GFP constructed by the nucleotide sequence of the soybean GmERA.2 is transferred into an Arabidopsis ERECTA mutant er-3 for over-expression, and the expression conditions of the gene transcription level and the protein level are detected.

Specifically, the constructed expression vector pBASTA-35S-GmERA.2-GFP is transferred into the Arabidopsis ERECTA mutant er-3 by adopting a floral dip method, and the method comprises the following steps:

A. preparation of agrobacterium infection liquid: preparing 5% sucrose solution according to twice volume of LB liquid, adding Silwet L-77 to the final concentration of 0.3 per mill; centrifuging Agrobacterium for 5min at 6500rpm, collecting thallus, and resuspending in 5% sucrose solution with OD600 of 0.8;

B. flower infection: when the arabidopsis thaliana shoots 10cm, carrying out flower soaking transformation mediated by agrobacterium, carrying out dip dyeing on flower buds in the agrobacterium liquid containing 0.3 per mill Silwet L-77 and 5% of sucrose solution for 20 seconds, placing the dipped plants under weak light for half a day, continuing normal illumination growth, carrying out secondary dip dyeing when the dipped flower buds grow out of fruit pods after one week and new flower buds grow out again until the flowering phase is finished, when the seeds are mature, harvesting the seeds containing transgenic seeds, spraying 1 per mill glyphosate on leaves after the transgenic seeds are planted for one week, and screening transgenic seedlings, wherein the glyphosate-resistant seedlings are overexpression plants of the GmERA.2 gene.

RT-PCR and Western blot methods are used for respectively detecting the expression conditions of the gene transcription level and the protein level, and the results are shown in fig. 2 and fig. 3, which show that the conversion of the variable spliceosome GmERA.2 is completed and the expression is successful in arabidopsis.

FIG. 2 shows the results of detection of gene transcription level by RT-PCR. The figure shows that the expression situation of the GmERa.2 gene in two transgenic lines (pBASTA-35S-GmERa.2-GFP in ER-3#1 and pBASTA-35S-GmERa.2-GFP in ER-3#2) which excessively express the GmERa.2 in the ER-3 mutant is detected by taking the mutant ER-3 of the wild type Col-0 and ER genes as a negative control material. The result shows that the GmERa.2 gene is not expressed in Col-0 and er-3, but is expressed in the artificially transgenic plants pBASTA-35S-GmERa.2-GFP in er-3#1 and pBASTA-35S-GmERa.2-GFP in er-3# 2. In these 4 materials, the expression level of ACTIN2 in the 4 materials was detected by using the housekeeping gene ACTIN2 as a control, and the results showed that the expression levels of ACTIN2 in the 4 materials were consistent, indicating that the total RNA concentration of each material was quantified at the early stage and that the reverse transcription was performed without errors. The primers used for detecting the expression of GmERa.2 are 5'-ATGAAACAGCTGGAAAATCTG-3' and 5'-CAAGGATATAATGTTCTGAAGC-3', and the primers used for detecting the housekeeping gene ACTIN2 are 5'-AGCGCTGAGGCTGATGATATTCAAC-3' and 5'-TCTAGAAACATTTTCTGTGAACGATTC-3'.

FIG. 3 shows the results of detection of protein expression using Western blot. In FIG. 3, the expression of GFP protein in two transgenic lines (pBASTA-35S-GmERa.2-GFP in ER-3#1 and pBASTA-35S-GmERa.2-GFP in ER-3#2) which excessively express GmERa.2 in the ER-3 mutant was examined by using the wild type Col-0 and the ER gene mutant ER-3 as negative control materials, respectively, and the results showed that GFP was not expressed in non-transgenic Col-0 and ER-3, but was expressed normally in human transgenic plants pBASTA-35S-GmERa.2-GFPin ER-3#1 and pBASTA-35S-GmERa.2-GFP in ER-3# 2. In the figure, CBB shows the results of total protein electrophoresis using Coomassie Brilliant blue staining of 4 materials with similar intensity and band thickness, indicating that the quantification of total protein is accurate, thus showing that GFP is not expressed in Col-0 and er-3, but is expressed normally in pBASTA-35S-GmERA.2-GFP in er-3#1 and pBASTA-35S-GmERA.2-GFP in er-3#2, not caused by human error, but is an accurate experimental result.

FIG. 4 shows the phenotype of two transgenic lines (pBASTA-35S-GmERa.2-GFP in ER-3#1 and pBASTA-35S-GmERa.2-GFP in ER-3#2) overexpressing GmERa.2 in Col-0, a deletion mutant of ER, a mutant of the ER gene, ER-3, under white light (denoted as W) and shaded (denoted as S) growth conditions. The elongation of the hypocotyl of the wild Col-0 is inhibited under white light, and the elongation of the hypocotyl is obvious under a shading condition; in the ER deletion mutant ER-3, the induction of elongation of hypocotyls by shading is obviously inhibited compared with Col-0, and a relatively insensitive phenotype to shading is shown; two transgenic lines (pBASTA-35S-GmERa.2-GFP in ER-3#1 and pBASTA-35S-GmERa.2-GFP inner-3 #2) which excessively express GmERa.2 in the ER gene mutant ER-3 obviously restore the length of hypocotyls under shade, and change the character that the original ER-3 is not sensitive to shade. The GmERa.2 from soybean can act in Arabidopsis across species, change the sensitivity of Arabidopsis to shade and regulate the shade-avoiding reaction characteristic of Arabidopsis.

FIG. 5 shows the statistical results of hypocotyl length of two transgenic lines (pBASTA-35S-GmERa.2-GFP in ER-3#1 and pBASTA-35S-GmERa.2-GFP in ER-3#2) overexpressing GmERa.2 in Col-0, a deletion mutant of ER, a mutant ER-3 of the ER gene, under White light (as White light) and shadow (as Shade) growth conditions. Statistical results of hypocotyl length show that overexpression of GmERa.2 alters the sensitivity of ER deletion mutant ER-3 to shading (corresponding to the phenotype of FIG. 4). Compared with white light, the elongation of the hypocotyl of the wild Col-0 is obviously promoted under the shading condition; in the ER deletion mutant ER-3, the induction of elongation of the hypocotyl by shading is obviously inhibited compared with the length of the hypocotyl of Col-0 under shading, and a phenotype which is relatively insensitive to shading is shown; two transgenic lines (pBASTA-35S-GmERa.2-GFP in ER-3#1 and pBASTA-35S-GmERa.2-GFP in ER-3#2) which excessively express GmERa.2 in the ER gene mutant ER-3 obviously restore the length of hypocotyls under shade, and change the character that the original ER-3 is not sensitive to shade. The GmERa.2 from soybean can act in Arabidopsis across species, change the sensitivity of Arabidopsis to shade and regulate the shade-avoiding reaction characteristic of Arabidopsis. The significance between hypocotyl lengths under shade conditions between 4 materials was analyzed using the T-test in the figure, P < 0.0001.

Morphological indexes and statistical results from fig. 4 and 5 show that overexpression of gmera.2 can well restore the sensitivity of the er-3 deletion mutant to shade. Compared with Col-0, the er deletion mutant (er-3) has lower embryonic axis length under the shading condition and is insensitive to shading, and the over-expression of GmERa.2 in er-3 changes the sensitivity of er-3 to shading and restores to the phenotype similar to Col-0, which indicates that GmERa.2 participates in the shading reaction of Arabidopsis.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

SEQUENCE LISTING

<110> Sichuan university of agriculture

<120> variable shears for regulating and controlling plant shade-avoiding reaction and application thereof

<130>2018

<160>8

<170>PatentIn version 3.3

<210>1

<211>2785

<212>DNA

<213> nucleotide sequence of variable splicer GmERA.2 of homologous protein GmERA encoded by soybean GmERECTA gene

<400>1

atgaaacagc tggaaaatct gtgagttctt ttgagctttc tatttcactg aggttttgtt 60

ttgcccccta ggctgtgaca aggttttttt tttgctaaat gtgttctcag aattttgaaa 120

aataatcagc taattggacc aattccttca actctctctc aggttcctaa cttgaagatt 180

ctgtaagtta tttttccgtt ttctcttcag aaggatgact ttagtatcca taactatcat 240

tcactaaatt ttgaaaactg gttctgttct agagacctgg cacagaataa tcttagcggg 300

gagataccaa gacttatata ctggaatgaa gttttacaat atctgtgagc actactaatt 360

cgcaatgaaa cctaactctt aattgactta tttatctgtg cttcttttag gctctatgct 420

gtgttcttgc tgtcaatctt tgtttgtgtc tttccttttc ctatgctagt ggcttgcgag 480

gtaacaattt ggtgggttca ctttctccag acatgtgcca gttaactgga ttgtggtact 540

tgtaagttag aacaatgact ctctttttat ttctaagcct tgaaagttta catttcctta 600

aacaaaatgt aattagtttc atcataccat tttgcagtga cgtgagaaac aatagcttga 660

caggcactat tcctgaaaac ataggcaatt gtactacttt aggggtcttg tatgtatatc 720

caactgtatc tgtgtgaccg acttcgcttc accatgtctt ctcttttctt ttttaatata 780

ttctattaat gtcacttgtc agggatttat cctacaacaa gctaaccgga gagataccat 840

tcaatattgg gtatctgcaa gtagcaactc tgtatgtaca gcattatcct ttttcagtta 900

tttttagaaa caatggcatg tggtcttcca ttttgcttat ttaggaggct ccttttaaac 960

ttgtttgagg ttgataggtc attgcaaggc aataaattct tggggcatat tccatcagtg 1020

attggtctga tgcaagcgct tactgtcttg taagcattgt actaaagcaa acttattttc 1080

tttgttgtct tgatattttt tctcttgttt actaatccct cctcccacat ttcttttaga 1140

gatttgagtt gtaatatgtt aagtggacca atccctccta tcttgggaaa tttgacctac 1200

acagaaaaat tgtaagtata tgctagtagt tttgaatctg tatcttttaa gtttgatttt 1260

gccttaaagt gtgtgcatta agtcataaat ttaagactca ttggataaaa tatgcaatgt 1320

ttgaaggtat ttacatggaa acaagctgac tggcctcatc cccccagaac ttggaaatat 1380

gacaaacctt cactatttgt aagatgcttt agtcattagt tggccatatg catcctctat 1440

ttcttttctg gactcttgaa atcagcagta gcggcttact gacaatggtt aatcatttca 1500

cttttgaatt ttacaacttc taaaagaaca tcttgtcagt ttccttttta caatttttta 1560

agctgacatt tgttttgaac aaatataact tacgaagagg tgcaacttgg tttaaatttg 1620

tcatctaatg cttcacactt caattgcagg gaattgaatg acaaccattt aagtggacat 1680

atcccacctg agcttggaaa gcttactgat ttgtttgact tgtaagtggc attaatttga 1740

agcatcaact ttgttggttt tttagtaatt tcatgagtca aacttgatgt tgcagaaatg 1800

tcgccaacaa caaccttgag ggtccagttc ctgataatct tagctcatgt aaaaacctca 1860

acagcctgta agcaataagc cttgtatatc aatttgtatt aaggaatttt atattacatt 1920

aagctgatgg attttccaac cgtcatgcat cagcaatgtg catgggaata agctgagtgg 1980

aacagtcccc tcagcttttc atagcttgga gagtatgacc tatctgtaag tttcaccttg 2040

acattgtagt acatttgttc aatatatatt tgtaattcca ctgtgattag ttctgttcct 2100

tctctaaaca tgtcaataca cacaaacttt tatgctagct tatctggatt cctaccacag 2160

ttggccaata cttaacagtt taaacatcaa cctaatactc atttacttaa ttgattctta 2220

ttctttcatg actttgtggg gcccatgctt aggaatcttt cttcaaacaa gcttcaaggc 2280

tccattccag ttgaactttc acggattggt aatttggata cactgtaagt atgaatgatt 2340

taacatgcct ccttatatca atcctctgat ttcattctaa taaatgtttg atttccaggg 2400

atatatcaaa taataatata attggttcta ttccttcttc cattggtgac ttggaacatc 2460

ttctgaagtt gtgagttttt ttggcaagtt acttttgaaa tctagaatgt tacttcttac 2520

tgattgctag taatcatttt gctaggaatc tgagcagaaa tcatttaaca gggtttattc 2580

cagcagaatt tggaaatcta agaagtgtca tggatatgta ggtccattaa ctttctgatg 2640

agaataaaac aaatcttttg ttggttttta taccaactaa atgacgaatt tcacaattct 2700

gtatgacagt gatctttcaa ataatcaact ctctggcttg attcctgaag aacttagtca 2760

gcttcagaac attatatcct tgtaa 2785

<210>2

<211>366

<212>PRT

<213> amino acid sequence corresponding to the nucleotide sequence of the variable splicer GmERA.2 of the homologous protein GmERECTA encoded by the soybean GmERECTA gene

<400>2

Met Lys Gln Leu Glu Asn Leu Ile Leu Lys Asn Asn Gln Leu Ile Gly

1 5 10 15

Pro Ile Pro Ser Thr Leu Ser Gln Val Pro Asn Leu Lys Ile Leu Asp

20 25 30

Leu Ala Gln Asn Asn Leu Ser Gly Glu Ile Pro Arg Leu Ile Tyr Trp

35 40 45

Asn Glu Val Leu Gln Tyr Leu Gly Leu Arg Gly Asn Asn Leu Val Gly

50 55 60

Ser Leu Ser Pro Asp Met Cys Gln Leu Thr Gly Leu Trp Tyr Phe Asp

65 70 75 80

Val Arg Asn Asn Ser Leu Thr Gly Thr Ile Pro Glu Asn Ile Gly Asn

85 90 95

Cys Thr Thr Leu Gly Val Leu Asp Leu Ser Tyr Asn Lys Leu Thr Gly

100 105 110

Glu Ile Pro Phe Asn Ile Gly Tyr Leu Gln Val Ala Thr Leu Ser Leu

115 120 125

Gln Gly Asn Lys Phe Leu Gly His Ile Pro Ser Val Ile Gly Leu Met

130 135 140

Gln Ala Leu Thr Val Leu Asp Leu Ser Cys Asn Met Leu Ser Gly Pro

145 150 155 160

Ile Pro Pro Ile Leu Gly Asn Leu Thr Tyr Thr Glu Lys Leu Tyr Leu

165 170 175

His Gly Asn Lys Leu Thr Gly Leu Ile Pro Pro Glu Leu Gly Asn Met

180 185 190

Thr Asn Leu His Tyr Leu Glu Leu Asn Asp Asn His Leu Ser Gly His

195 200 205

Ile Pro Pro Glu Leu Gly Lys Leu Thr Asp Leu Phe Asp Leu Asn Val

210 215 220

Ala Asn Asn Asn Leu Glu Gly Pro Val Pro Asp Asn Leu Ser Ser Cys

225 230 235 240

Lys Asn Leu Asn Ser Leu Asn Val His Gly Asn Lys Leu Ser Gly Thr

245 250 255

Val Pro Ser Ala Phe His Ser Leu Glu Ser Met Thr Tyr Leu Asn Leu

260 265 270

Ser Ser Asn Asn Leu Gln Gly Ser Ile Pro Ile Glu Leu Ser Arg Ile

275 280 285

Gly Asn Leu Asp Thr Leu Asp Ile Ser Asn Asn Asn Ile Ile Gly Ser

290 295 300

Ile Pro Ser Ser Ile Gly Asp Leu Glu His Leu Leu Lys Leu Asn Leu

305 310 315 320

Ser Arg Asn His Leu Thr Gly Phe Ile Pro Ala Glu Phe Gly Asn Leu

325 330 335

Arg Ser Val Met Asp Ile Asp Leu Ser Asn Asn Gln Leu Ser Gly Leu

340 345 350

Ile Pro Glu Glu Leu Ser Gln Leu Gln Asn Ile Ile Ser Leu

355 360 365

<210>3

<211>35

<212>DNA

<213> upstream primer sequence of first round PCR amplification of GmERa.2 gene fragment

<400>3

aaaaagcagg cttcatgaaa cagctggaaa atctg 35

<210>4

<211>35

<212>DNA

<213> first round PCR amplification downstream primer sequence of GmERa.2 gene segment

<400>4

agaaagctgg gtccaaggat ataatgttct gaagc 35

<210>5

<211>29

<212>DNA

<213> second round PCR amplification upstream primer sequence of GmERa.2 gene fragment

<400>5

ggggacaagt ttgtacaaaa aagcaggct 29

<210>6

<211>29

<212>DNA

<213> second round PCR amplification downstream primer sequence of GmERa.2 gene segment

<400>6

ggggaccact ttgtacaaga aagctgggt 29

<210>7

<211>21

<212>DNA

<213> PCR identification of upstream primer sequence of clone colony of GmERa.2 gene fragment

<400>7

atgaaacagc tggaaaatct g 21

<210>8

<211>22

<212>DNA

<213> downstream primer sequence identified by clone colony PCR of GmERa.2 gene fragment

<400>8

caaggatata atgttctgaa gc 22

Claims (10)

1. A variable splicer for regulating a shade-avoiding response of a plant, which is a variable splicer GmERa.2 from a homologous protein GmERa coded by a soybean GmERECTA gene, wherein the nucleotide sequence of the GmERa.2 is shown as SEQ ID No. 1.

2. The variable shears for regulating plant shade-avoidance response of claim 1, wherein the nucleotide sequence of GmERa.2 corresponds to an amino acid sequence shown as SEQ ID No. 2.

3. The use of a variable spliceosome for modulating a plant shade-avoidance response according to claim 1, wherein the variable spliceosome is used for modulating a plant shade-avoidance response.

4. The use of a variable spliceosome for regulating a plant shade-avoidance response according to claim 3, wherein the variable spliceosome is used for regulating an Arabidopsis thaliana shade-avoidance response.

5. The use of a variable spliceosome for regulating a plant shade-avoidance response according to claim 4, wherein the use of the variable spliceosome for regulating an Arabidopsis thaliana shade-avoidance response comprises the following steps:

1) cloning GmERa.2 from soybean;

2) an expression vector pBASTA-35S-GWR-GFP constructed by the nucleotide sequence of the soybean GmERA.2 is transferred into an Arabidopsis ERECTA mutant er-3 for over-expression, and the expression conditions of the gene transcription level and the protein level are detected.

6. The use of a variable cutter for modulating a shade-avoidance response in a plant according to claim 5, wherein the cloning of step 1) is performed by the Gateway cloning method comprising the steps of:

A. the GmERa.2 gene fragment is connected with an attB sequence through two rounds of PCR amplification;

B. carrying out BP reaction on the gene connected with the attB sequence through glue recovery to construct an entry vector pDONR/zeo;

C. transforming a BP reaction product into escherichia coli DH5 α, coating the escherichia coli DH5 α on an LB culture medium containing 50 mu g/ml zeocin resistance, carrying out overnight culture at 37 ℃, selecting a positive clone to a liquid LB culture medium containing 50 mu g/ml zeocin after colony PCR is identified as the positive clone, carrying out overnight shaking culture at 37 ℃, extracting a plasmid by using a kit, and sequencing after the plasmid enzyme digestion identification;

D. after the sequencing is correct, the constructed entry vector is subjected to LR reaction to construct a pBASTA-35S-GWR-GFP expression vector;

E. and finally, transforming the plasmid into agrobacterium GV3101, coating the agrobacterium GV3101 on a 50 mu g/ml kanamycin +50 mu g/ml gentamycin LB solid culture medium, culturing at 28 ℃ for 2d, and storing the strain in 15% of glycerol after the colony PCR is identified as a positive clone.

7. The use of the variable shears for regulating plant shade-avoidance response of claim 6, wherein in step A, the primers used in the first round of PCR amplification in the two rounds of PCR amplification are:

5'-AAAAAGCAGGCTTCATGAAACAGCTGGAAAATCTG-3' and

5'-AGAAAGCTGGGTCCAAGGATATAATGTTCTGAAGC-3', respectively; the primers used in the second round of PCR amplification in the two rounds of PCR amplification are as follows:

5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3' and

5’-GGGGACCACTTTGTACAAGAAAGCTGGGT-3’。

8. the use of a variable cutter for modulating a plant shade-avoidance response according to claim 6, wherein the primers used for PCR identification of the colonies are 5'-ATGAAACAGCTGGAAAATCTG-3' and 5'-CAAGGATATAATGTTCTGAAGC-3'.

9. The use of the alternative cutter for modulating a plant shade-avoidance response of claim 6, wherein in step E, the enzyme cleavage identification system is: NEB Buffer 1.11. mu.l; BsrGI 0.1. mu.l; the recombinant plasmid pBASTA-35S-GmERA.2-GFP 8.9. mu.l is reacted in a water bath at 37 ℃ for 4 h.

10. The use of the alternative cutter for regulating and controlling plant shade-avoidance response of claim 5, wherein in step 2), the constructed expression vector pBASTA-35S-GmERA.2-GFP is transferred to Arabidopsis ERECTA mutant er-3 by using the floral dip method, comprising the following steps:

A. preparation of agrobacterium infection liquid: preparing 5% sucrose solution according to twice volume of LB liquid, adding Silwet L-77 to final concentration of 0.3 ‰; centrifuging Agrobacterium for 5min at 6500rpm, collecting thallus, and resuspending in 5% sucrose solution with OD600 of 0.8;

B. flower infection: when the arabidopsis thaliana shoots 10cm, carrying out flower soaking transformation mediated by agrobacterium, carrying out dip dyeing on flower buds in the agrobacterium liquid containing 0.3 per mill Silwet L-77 and 5% of sucrose solution for 20 seconds, placing the dip-dyed plants under weak light for 12 hours, continuing normal illumination growth, carrying out second dip dyeing after one week, carrying out second dip dyeing until the flowering phase is finished, when the seeds are mature, harvesting the seeds containing transgenic seeds, spraying 1 per mill glyphosate on leaves for screening transgenic seedlings after the next week of the transgenic seeds, wherein the glyphosate-resistant seedlings are overexpression plants of the GmERA.2 gene.

Images