CN108085381B - Application of gene mutation sites in preparation of reagent or kit for diagnosing chronic pancreatitis and evaluating prognosis - Google Patents
Application of gene mutation sites in preparation of reagent or kit for diagnosing chronic pancreatitis and evaluating prognosis Download PDFInfo
- Publication number
- CN108085381B CN108085381B CN201711262768.6A CN201711262768A CN108085381B CN 108085381 B CN108085381 B CN 108085381B CN 201711262768 A CN201711262768 A CN 201711262768A CN 108085381 B CN108085381 B CN 108085381B
- Authority
- CN
- China
- Prior art keywords
- gene
- chronic pancreatitis
- kit
- mutation sites
- gene mutation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the fields of biotechnology and medical diagnosis, in particular to a group of pathogenic gene mutation sites related to chronic pancreatitis and application of the gene mutation sites in preparation of reagents or kits for diagnosing or treating chronic pancreatitis and evaluating prognosis. The invention has the advantages that: the invention discovers the names and frequencies of 6 common pathogenic mutations of chronic pancreatitis in China, and the total carrying frequency is as high as 46.1%, and simultaneously discloses that the pathogenic mutations have the function of accelerating the clinical course occurrence and the development speed of chronic pancreatitis, thereby providing scientific basis for the next clinical early diagnosis and the formulation of individualized treatment schemes.
Description
Technical Field
The invention relates to the field of biotechnology and medical diagnosis, in particular to a group of pathogenic gene mutation sites related to Chronic Pancreatitis (CP) and application of the gene mutation sites in preparation of reagents or kits for diagnosing CP and evaluating prognosis.
Background
Chronic Pancreatitis (CP) refers to a chronic inflammatory disease with irreversible pancreatic tissue and function caused by various causes, the course of the disease is long or the disease is lifelong, and clinical manifestations of abdominal pain, absorption or malnutrition (exocrine insufficiency) and diabetes (endocrine insufficiency) seriously affect the quality of life of patients. The specific pathogenesis of CP is not clear, and the presence or absence of symptoms in a patient depends on the magnitude of the combined effects of a certain degree of genetic risk factors and exogenous stimuli (especially alcohol consumption). The incidence of CP in China is on the rising trend year by year, the etiology of the CP is complex, and the CP mainly comprises a large amount of drinking, genetic factors, bile-pancreatic duct confluence, trauma, autoimmune factors and the like. The etiology of the disease is different in regions or living habits: in western countries, drinking is the leading cause of CP (60-90%); while more than 70% of CP patients in China have uncertain causes and may be related to genetic factors.
The research of the genetics has strongly promoted the understanding of human beings on the pathogenesis of CP, the research of the past 15 years proves that the role of genetic factors in the etiology of CP is more and more important, more than 10 CP susceptible genes are reported, in recent years, 2 CP susceptible genes CE L and CPA1 reported in Europe have no obvious difference after the prior sequencing verification, which shows that the susceptible genes or functional mutations of CP have obvious regional and ethnic differences, Chinese people are different from European and American people.
Disclosure of Invention
The invention aims to clarify the specific pathogenic genes and mutation distribution characteristics of CP in China and discloses a specific process and a candidate gene list of a targeted next generation sequencing method; the names and frequencies of the found 6 common pathogenic mutations are disclosed, and the total carrying frequency is as high as 46.1%, thereby providing scientific basis for the next clinical early diagnosis and the formulation of an individual treatment scheme.
The first aspect of the invention provides a group of gene mutation sites closely related to chronic pancreatitis in China, which comprises the following 6: c.101A > G and c.194+2T > C located on the SPINK1 gene, c.346C > T, c.365G > A and c.623G > C located on the PRSS1 gene, and c.180C > T located on the CTRC gene.
Wherein 2 are located on the SPINK1 gene (c.101A > G and c.194+2T > C), and the c.101A > G indicates that the 101-th coding base on the No.3 exon of the SPINK1 gene is mutated from A to G, so that the 34-th asparagine is mutated into serine; the c.194+2T > C indicates that the splice site base on the No.3 intron of the SPINK1 gene is changed from T to C, the mutant site is positioned at the splice site of the gene, and research has proved that the mRNA stability and expression level are influenced, and the pathogenicity is realized.
3 are positioned on PRSS1 gene (c.346C > T, c.365G > A and c.623G > C), the c.346C > T represents that 346 th coding base on No.3 exon on PRSS1 gene is mutated from C to T, thereby leading the 116 th amino acid to be mutated from arginine to cysteine; c.365G > A represents that the 365 th coding base on the No.3 exon of the PRSS1 gene is mutated from G to A, so that the 122 th amino acid is mutated from arginine to histidine; the c.623G > C indicates that the 623 th coding base on the No.5 exon of the PRSS1 gene is mutated from G to C, thereby leading to the mutation of the 208 th amino acid from glycine to alanine.
Still another 1 is located on the CTRC gene (c.180C > T), said c.180C > T indicates that 180 th coding base on No.3 exon of CTRC gene is changed from C to T, although it does not cause amino acid change, the research proves that there is a clear difference between CP and control, belonging to pathogenic mutation.
In a second aspect of the invention, the application of a group of gene mutation sites in preparing a reagent or a kit for diagnosing chronic pancreatitis is provided, wherein the gene mutation sites comprise the following 6: c.101A > G and c.194+2T > C located on the SPINK1 gene, c.346C > T, c.365G > A and c.623G > C located on the PRSS1 gene, and c.180C > T located on the CTRC gene.
Wherein, the forward primer sequence for detecting c.101A > G and c.194+2T > C on the SPINK1 gene is shown as SEQ ID NO.1, and the reverse primer sequence is shown as SEQ ID NO. 2;
detecting that the forward primer sequence of c.346C > T and c.365G > A on the PRSS1 gene is shown as SEQ ID NO.3, and the reverse primer sequence is shown as SEQ ID NO. 4;
detecting that the forward primer sequence of c.623G > C on PRSS1 gene is shown as SEQ ID NO.5, and the reverse primer sequence is shown as SEQ ID NO. 6;
the forward primer sequence for detecting c.180C > T on the CTRC gene is shown as SEQ ID NO.7, and the reverse primer sequence is shown as SEQ ID NO. 8.
In a third aspect of the invention, the application of a group of gene mutation sites in preparing a medicament for treating chronic pancreatitis is provided, wherein the gene mutation sites comprise the following 6: c.101A > G and c.194+2T > C located on the SPINK1 gene, c.346C > T, c.365G > A and c.623G > C located on the PRSS1 gene, and c.180C > T located on the CTRC gene.
The fourth aspect of the invention provides an application of a group of gene mutation sites in preparation of a reagent or a kit for assessing and prognosing chronic pancreatitis, wherein the gene mutation sites comprise the following 6: c.101A > G and c.194+2T > C located on the SPINK1 gene, c.346C > T, c.365G > A and c.623G > C located on the PRSS1 gene, and c.180C > T located on the CTRC gene.
In a fifth aspect of the present invention, there is provided a kit for detecting chronic pancreatitis or assessing the prognosis of chronic pancreatitis, comprising: (i) detecting an effective amount of one or more reagents for detecting the 6 gene mutation sites; (ii) one or more selected from the group consisting of: containers, instructions for use, positive controls, negative controls, buffers, adjuvants or solvents, such as solutions for suspending or immobilizing cells, detectable labels or labels, solutions for facilitating hybridization of nucleic acids, solutions for lysing cells, or solutions for nucleic acid purification.
The kit can be accompanied with instructions for using the kit, wherein the instructions describe how to use the kit for detection, and how to use the detection result for judging the chronic pancreatitis, selecting a treatment scheme and/or evaluating the prognosis.
With the kit of the present invention, the above 6 gene mutation sites can be detected by various methods (including but not limited to) selected from the group consisting of: PCR (polymerase chain reaction) combined with one-generation sequencing, gene mutation DNA probe hybridization using a marker, restriction fragment length polymorphism method or sequence-specific primer method.
Of course, the kit also comprises other reagents clinically used for judging the chronic pancreatitis, selecting a treatment scheme and/or evaluating the prognosis so as to assist or verify the result obtained by detecting the 6 gene mutation sites. One of ordinary skill in the art can routinely select the desired compound according to particular needs.
Generally, the detection kit of the present invention can be used for diagnosis, drug preparation and/or prognosis evaluation of chronic pancreatitis as follows: (a) obtaining a test sample from a subject; (b) contacting a sample to be detected with a detection reagent in the detection kit of the invention; (c) detecting the 6 gene mutation sites in the sample to be detected; (d) and (3) carrying out diagnosis, medicine preparation and/or prognosis evaluation on the chronic pancreatitis according to the detection result: if the detection result shows that the tissue of the subject carries the 6 gene mutation sites, the tendency of the subject to suffer from the chronic pancreatitis disease or poor prognosis is suggested.
Wherein, extracting DNA from whole blood: the paramagnetic particle method was used to extract genomic DNA from blood using a kit (Ranuchui).
The reagents used for targeted sequencing were KAPA 2G Robust HotStart ReadyMix, shrimp alkaline phosphatase (SAP; Affymetrix)/exonuclease I (Exo I; Bio L abs), KAPA HiFi HotStart DNA polymerase.
Reagents used for first generation sequencing validation: premix Taq DNA polymerase (Takara); DNA purification kit (Tiangen, Beijing) was used for purification.
In a sixth aspect of the present invention, there is provided a set of primer sets for diagnosing chronic pancreatitis or assessing prognosis of chronic pancreatitis, comprising:
detecting that the forward primer sequence of c.101A > G and c.194+2T > C on the SPINK1 gene is shown as SEQ ID NO.1, and the reverse primer sequence is shown as SEQ ID NO. 2;
detecting that the forward primer sequence of c.346C > T and c.365G > A on the PRSS1 gene is shown as SEQ ID NO.3, and the reverse primer sequence is shown as SEQ ID NO. 4;
detecting that the forward primer sequence of c.623G > C on PRSS1 gene is shown as SEQ ID NO.5, and the reverse primer sequence is shown as SEQ ID NO. 6;
the forward primer sequence for detecting c.180C > T on the CTRC gene is shown as SEQ ID NO.7, and the reverse primer sequence is shown as SEQ ID NO. 8.
The seventh aspect of the invention provides application of the primer group in preparation of a kit for diagnosing chronic pancreatitis or evaluating prognosis of chronic pancreatitis.
The technical scheme adopted by the invention is as follows:
whole blood samples from 1082 clinically confirmed chronic pancreatitis and 1196 healthy controls from the department of digestion at the long-sea hospital, university of military medical science, were subjected to second generation targeted sequencing by committing the Bio-X center at shanghai transportation university, with the sequencing platform IlluminaHiSeq 2500.
The method adopted by the invention is amplicon sequencing, is a high-targeting second-generation sequencing method, and the ultra-deep sequencing of the PCR product (amplicon) can effectively identify variation and carry out characteristic analysis on the variation. The chronic pancreatitis is a polygene-related complex disease, and mutations are widely distributed and are rare and common; compared with other second-generation sequencing methods, amplicon sequencing has the following advantages: 1) the specific area is deeply researched, so that deeper coverage and higher data accuracy are obtained, and the detection capability of rare variation is improved; 2) the method is more economical and effective, has higher flux and is suitable for large sample volume research; 3) the research period is shortened.
We used Primer3(http:// sim 19https:// genome.ucsc.edu) to design target-specific primers for the coding sequence and exon/intron regions of 26 genes (FIG. 1, human GRCh37/hg19https:// genome. ucsc.edu), primers were synthesized at their 5' ends using conventional linker sequences, all primers were divided into two multiplex Primer pools after preamplification of labeled gene amplicons, generating tagged DNA libraries for multiplex high throughput sequencing, quantification and purification of DNA libraries, and on-machine sequencing using Burrows-Wheeler Aligner to compare the originally paired 150bp long fragments with the ginseng genome, then local re-alignment and re-calibration of basic quality values using the genome analysis kit (GATK, version 3.1) were performed, respectively creating a new BAM file based on the quality value re-calibration module, re-aligning the original single nucleotide variants and small insertions or deletions with the original nucleotide variants and re-calibration results if these were found in the original codon sequence analysis process (SAGE) and the result of the addition of these mutations was found by the simple substitution of a DNA sequence substitution by the intron 2. 20. sub-coding sequence substitution map, the origin DNA sequence, the origin DNA sequence, the deletion, the origin DNA sequence, the origin DNA, the origin of which was found by the origin of.
The results found 6 common gene mutation sites closely related to CP in China (Table 1): 2 located on the SPINK1 gene (c.101a > G and c.194+2T > C), said c.101a > G indicating that the 101 st coding base on exon 3 of SPINK1 is mutated from a to G, resulting in mutation of the 34 th asparagine to serine; the c.194+2T > C indicates that the splice site base on the No.3 intron of the SPINK1 gene is changed from T to C, the mutant site is positioned at the splice site of the gene, and research has proved that the mRNA stability and expression level are influenced, and the pathogenicity is realized. 3 are positioned on PRSS1 gene (c.346C > T, c.365G > A and c.623G > C), the c.346C > T represents that 346 th coding base on No.3 exon on PRSS1 gene is mutated from C to T, thereby leading the 116 th amino acid to be mutated from arginine to cysteine; c.365G > A represents that the 365 th coding base on the No.3 exon of the PRSS1 gene is mutated from G to A, so that the 122 th amino acid is mutated from arginine to histidine; the c.623G > C indicates that the 623 th coding base on the No.5 exon of the PRSS1 gene is mutated from G to C, thereby leading to the mutation of the 208 th amino acid from glycine to alanine. Still another 1 is located on the CTRC gene (c.180C > T), said c.180C > T indicates that 180 th coding base on No.3 exon of CTRC gene is changed from C to T, although it does not cause amino acid change, the research proves that there is a clear difference between CP and control, belonging to pathogenic mutation. (FIG. 2).
From the perspective of carrying frequency, 6 common mutations are up to 46.12% in CP patients in China, and there are 499 positive carriers in total. The SPINK1c.194+2T > C mutation is the most common mutation, the carrying rate is as high as 37.62%, and the risk of pathogenesis is the highest (the OR value is 54.87). Second, we collected detailed clinical data of all CP patients, and divided them into mutation-positive and mutation-negative two groups for comparison, and found that the average age of the population with common mutations presenting the first symptoms of abdominal pain was 30 years (95% confidence interval 28-32 years), significantly earlier than non-mutation carriers (45 years, 95% confidence interval 43-46 years), and p <0.001 (fig. 3A). For endocrine function markers, mutant carriers were 40 years old (95% confidence interval 38-42 years old), significantly older than non-mutant carriers (46 years old, 95% confidence interval 44-48 years old), and p <0.001 (fig. 3B). For the exocrine function index, the age of the mutant carriers with steatorrhea was 40 years (95% confidence interval 38-42 years), earlier than the non-mutant carriers (43 years, 95% confidence interval 39-46 years), and p was 0.007 (fig. 3C). Suggesting that the clinical course of the mutation carrier of CP patients is more serious.
TABLE 1 Targeted sequencing for detection of common pathogenic Gene mutation results
The invention has the advantages that:
the invention carries out second-generation targeted sequencing (containing 26 genes) on 1082 chronic pancreatitis patients and 1196 healthy people, which is the sequencing research on the maximum sample size of chronic pancreatitis in China at present, and finds 6 common gene mutation sites closely related to chronic pancreatitis in China as a result: 2 located on the SPINK1 gene c.101a > G and c.194+2T > C), 3 located on the PRSS1 gene (c.346c > T, c.365G > a and c.623g > C), and 1 located on the CTRC gene (c.180c > T). The SPINK1c.194+2T > C mutation is the most common mutation, the carrying rate is as high as 37.62%, and the risk of pathogenesis is the highest (the OR value is 54.87).
The invention discovers the names and frequencies of 6 common pathogenic mutations in chronic pancreatitis in China, and the total carrying frequency is as high as 46.12%; meanwhile, the high risk group with the most common mutation is also disclosed, and scientific basis is provided for the next clinical early diagnosis and the formulation of an individual treatment scheme.
Drawings
FIG. 1. screening process of pathogenic mutation associated with chronic pancreatitis.
FIG. 2. results of common pathogenic mutations associated with chronic pancreatitis.
FIG. 3 shows the age of abdominal pain (A), diabetes (B) and steatorrhea (C) in the common sudden change carrying state of chronic pancreatitis.
Detailed Description
The invention is further described below with reference to the accompanying drawings.
Example 1
1. Multiplex PCR primer design
The 26 gene coding sequences and exon/intron regions were designed using Primer3(http:// gummene. com/Primer3), the 5' ends of the primers were synthesized using common linker sequences, i.e., all 5' end primers contained CS1(5'-ACACTGACGACATGGTTCTACA-3'), all 3' primers contained CS2(5'-TACGGTAGCAGAGACTTGGTCT-3'), all primers and some other Primer pairs were divided into two multiplex Primer pools (table 2).
TABLE 2 SPINK1, PRSS1, and CTRC all exon-targeted sequencing primer List
2. Pre-amplification of tagged Gene amplicons
The labeled amplicon was first amplified in two multiplex PCRs, the reaction was as follows:
the PCR reaction conditions were as follows:
mu.l of the PCR product as above was treated as follows:
first at 37 ℃ for 60min, and then at 80 ℃ for 20 min. The treated sample was diluted 100-fold and used as a template in the next round of PCR.
3. Creation of tag DNA library
The tag (BC) primer used, which contains PE1 or PE2 sequence generated by Illumina cluster, is a tag 10-bp before the CS1 or CS2 linker sequence. Mu.l of the above 100-fold diluted PCR product was added to the corresponding wells of two 384-well PCR plates, each containing 9. mu.l of the pre-sample mixture, as follows:
then, 10. mu.l of the PE1-CS1 and PE2-BC-CS2 primer pairs were added to one well, while 10. mu.l of the PE1-CS2 and PE2-BC-CS1 primer pairs were added to the other well. In two corresponding wells, the tag sequences within the two primer pairs are identical. The PCR procedure was as follows:
quantification and purification of DNA libraries and in-machine sequencing
The tagged PCR products were analyzed on agarose gel electrophoresis to verify and confirm the expected size (approximately 350 bp). The products from both plates were pooled together in equal volumes and purified using AMPure XP beads. The target DNA fragments were selected using E-Gel Precast agarose electrophoresis (Thermofeisher) and extracted using the QIAquick Gel Extraction Kit. The library was quantified by an Agilent BioAnalyzer and paired end fragment sequencing was performed using the Illumina Hiseq2500 platform according to the manufacturer's instructions.
5. Sanger sequencing validation of identified variations
All selected rare variations were confirmed by Sanger sequencing. The PCR program was adjusted for the specific primers and amplification length. The appropriate size bands were excised from the agarose gel and then purified using a DNA purification kit (Tiangen, Beijing, China). The PCR products were sequenced by the corresponding sequencing primers using the BigDye Terminator sequencing kit (ABI, USA) in an ABI 3730x1DNA analyzer.
Example 2
Statistical analysis evaluation of single mutation detection and 6 mutations joint detection efficiency. As shown in Table 3, the sensitivity of detecting the occurrence of chronic pancreatitis by using the c.101A > G, c.194+2T > C, c.346C > T, c.365G > A, c.623G > C and c.180C > T mutations alone is respectively 2.2%, 37.6%, 1.3%, 2.2%, 8.6%, 1.8% and 46.1%, and the sensitivity of detecting the occurrence of the chronic pancreatitis in a combined manner is 46.1%, which are all obviously higher than that of a single mutation detection group (p < 0.001).
TABLE 3 detection of 6 mutations alone and in combination in patients with chronic pancreatitis
All mutations were verified by PCR-sequencing, and the PCR reaction was performed using the HotStarTaq enzyme (Qiagen, Germany) as follows:
1) for c.101A > G, c.194+2T > C on SPINK1 gene:
the detection forward primer used was CCAATCACAGTTATTCCCCAGAG (SEQ ID NO.1) and the reverse primer was GTTTGCTTTTCTCGGGGTGAG (SEQ ID NO. 2).
The PCR reaction conditions were as follows:
2) for c.346C > T, c.365G > A on PRSS1 gene:
the forward primer used for detection was AAGGTGGGATAGGTGCCCTG (SEQ ID NO.3), and the reverse primer was: GGATGGAGGGAAGTAGAAGGACT (SEQ ID NO. 4).
The PCR reaction conditions were as above.
3) For c.623G > C on PRSS1 gene:
the forward primer used for detection was TATTCCTCCTCCATCTCTCCATAC (SEQ ID NO.5) and the reverse primer was CAGTGTGAAGGAGTGAGAGG (SEQ ID NO. 6).
The PCR reaction conditions were as follows:
4) for c.180c > T on CTRC gene:
the forward primer used for detection was CCCCGTGACACAGTAAAATATC (SEQ ID NO.7) and the reverse primer was TGGGTGTGAGTAGATTATGTAG (SEQ ID NO. 8).
The PCR reaction conditions were as follows:
while the preferred embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that the invention is not limited thereto, and that various changes and modifications may be made without departing from the spirit of the invention, and the scope of the appended claims is to be accorded the full range of equivalents.
Sequence listing
<110> Shanghai Changhai Hospital
<120> application of a group of gene mutation sites in preparation of reagent or kit for diagnosing chronic pancreatitis and evaluating prognosis
<130>/
<141>2017-12-04
<160>8
<170>SIPOSequenceListing 1.0
<210>1
<211>23
<212>DNA
<213> Artificial sequence (Artificial)
<400>1
ccaatcacag ttattcccca gag 23
<210>2
<211>21
<212>DNA
<213> Artificial sequence (Artificial)
<400>2
gtttgctttt ctcggggtga g 21
<210>3
<211>20
<212>DNA
<213> Artificial sequence (Artificial)
<400>3
aaggtgggat aggtgccctg 20
<210>4
<211>23
<212>DNA
<213> Artificial sequence (Artificial)
<400>4
ggatggaggg aagtagaagg act 23
<210>5
<211>24
<212>DNA
<213> Artificial sequence (Artificial)
<400>5
tattcctcct ccatctctcc atac 24
<210>6
<211>20
<212>DNA
<213> Artificial sequence (Artificial)
<400>6
cagtgtgaag gagtgagagg 20
<210>7
<211>22
<212>DNA
<213> Artificial sequence (Artificial)
<400>7
ccccgtgaca cagtaaaata tc 22
<210>8
<211>22
<212>DNA
<213> Artificial sequence (Artificial)
<400>8
tgggtgtgag tagattatgt ag 22
Claims (4)
1. The application of a group of gene mutation sites in preparing a reagent or a kit for diagnosing chronic pancreatitis is characterized in that the gene mutation sites are as follows 6: c.101A > G and c.194+2T > C located on the SPINK1 gene, c.346C > T, c.365G > A and c.623G > C located on the PRSS1 gene, c.180C > T located on the CTRC gene.
2. The application of a group of gene mutation sites in preparation of a reagent or a kit for assessing and prognosing chronic pancreatitis is characterized in that the gene mutation sites are 6: c.101A > G and c.194+2T > C located on the SPINK1 gene, c.346C > T, c.365G > A and c.623G > C located on the PRSS1 gene, c.180C > T located on the CTRC gene.
3. A kit for detecting chronic pancreatitis or assessing the prognosis of chronic pancreatitis, comprising: (i) detecting an effective amount of a reagent for detecting 6 gene mutation sites; (ii) a substance selected from the group consisting of: a container, instructions for use, a positive control, a negative control, a buffer, an adjuvant or a solvent, a solution for suspending or immobilizing cells, a detectable label or label, a solution for facilitating hybridization of nucleic acids, a solution for lysing cells, or a solution for nucleic acid purification; the 6 gene mutation sites are as follows: c.101A > G and c.194+2T > C located on the SPINK1 gene, c.346C > T, c.365G > A and c.623G > C located on the PRSS1 gene, c.180C > T located on the CTRC gene.
4. The kit for detecting chronic pancreatitis or assessing the prognosis of chronic pancreatitis according to claim 3, wherein the kit further comprises instructions for using the kit, wherein the instructions describe how to use the kit to detect chronic pancreatitis, how to use the detection result to judge chronic pancreatitis, select treatment schemes and/or assess prognosis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711262768.6A CN108085381B (en) | 2017-12-04 | 2017-12-04 | Application of gene mutation sites in preparation of reagent or kit for diagnosing chronic pancreatitis and evaluating prognosis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711262768.6A CN108085381B (en) | 2017-12-04 | 2017-12-04 | Application of gene mutation sites in preparation of reagent or kit for diagnosing chronic pancreatitis and evaluating prognosis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108085381A CN108085381A (en) | 2018-05-29 |
| CN108085381B true CN108085381B (en) | 2020-08-07 |
Family
ID=62172567
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711262768.6A Active CN108085381B (en) | 2017-12-04 | 2017-12-04 | Application of gene mutation sites in preparation of reagent or kit for diagnosing chronic pancreatitis and evaluating prognosis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108085381B (en) |
-
2017
- 2017-12-04 CN CN201711262768.6A patent/CN108085381B/en active Active
Non-Patent Citations (8)
| Title |
|---|
| An Evaluation of Factors Associated With Pathogenic PRSS1, SPINK1, CTFR, and/or CTRC Genetic Variants in Patients With Idiopathic Pancreatitis.;Jalaly NY等;《Am J Gastroenterol.》;20170831;第112卷(第8期);1320-1329 * |
| Comprehensive screening for PRSS1, SPINK1, CFTR, CTRC and CLDN2 gene mutations in Chinese paediatric patients with idiopathic chronic pancreatitis: a cohort study.;Wang W等;《BMJ Open.》;20130903;第3卷(第9期);摘要和表2 * |
| PRSS1, SPINK1, CFTR, and CTRC Pathogenic Variants in Korean Patients With Idiopathic Pancreatitis;Sun-Mi Cho, M.D.等;《Ann Lab Med.》;20161130;第36卷(第6期);555-560 * |
| SPINK1基因突变与特发性慢性胰腺炎研究进展;王伟等;《国际内科学杂志》;20080331;第35卷(第3期);162-166 * |
| The contribution of the SPINK1 c.194 + 2T > C mutation to the clinical course of idiopathic chronic pancreatitis in Chinese patients;Chang Sun等;《Digestive and Liver Disease》;20131231;38-42 * |
| 多重PCR 检测慢性胰腺炎患者的PRSS1 、SPINK1 基因突变;王凤清等;《中国实验诊断学》;20080331;第12卷(第3期);371-373 * |
| 慢性胰腺炎遗传学研究进展;朱雨田等;《实用医院临床杂志》;20160131;第13卷(第1期);125-127 * |
| 糜蛋白酶C 在胰腺炎和胰腺癌发生发展中的作用;刘泽杰等;《临床肝胆病杂志》;20161130;第32卷(第11期);2222-2224 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108085381A (en) | 2018-05-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108753967B (en) | Gene set for liver cancer detection and panel detection design method thereof | |
| CN108315416A (en) | Primer, kit and the method for lung cancer gene mutation site are determined based on high throughput sequencing technologies | |
| CN108753954B (en) | Capture probe set of dementia-related gene, kit, library construction method and application | |
| EP3828273A1 (en) | Methylation modification-based tumor marker stamp-ep2 | |
| CN110484621B (en) | Early warning method for liver cancer | |
| US20160355887A1 (en) | Gene expression profiling for the diagnosis of prostate cancer | |
| JP2016015948A (en) | Method for acquiring information about lung cancer, and markers and kit for acquiring information about lung cancer | |
| CN108085381B (en) | Application of gene mutation sites in preparation of reagent or kit for diagnosing chronic pancreatitis and evaluating prognosis | |
| TWI567202B (en) | Method and kit for determination of alcohol metabolizing genes | |
| TW201300528A (en) | Method for hla-dqb1 genotyping and related primers thereof | |
| CN108342488B (en) | Kit for detecting gastric cancer | |
| CN209778899U (en) | kit for detecting R172K mutation of IDH2 gene | |
| CN113234822A (en) | Method for capturing genetic colorectal cancer genome target sequence | |
| CN106868128B (en) | Biomarker for auxiliary diagnosis of breast cancer and application thereof | |
| CN107312833B (en) | LSP primer and kit for detecting human BRCA1 gene mutation | |
| CN114369664B (en) | Marker for pancreatic cancer screening, probe composition and application thereof | |
| CN114540497B (en) | Marker for bladder cancer screening, probe composition and application thereof | |
| US20160340745A1 (en) | Gene expression profiling for the diagnosis of prostate cancer | |
| CN110144404B (en) | New mutation SNP site of breast cancer treatment gene TFR2 and application thereof | |
| WO2016106643A1 (en) | Primers for detecting related gene mutations of non-small-cell lung cancer medications and detection method | |
| CN114507734B (en) | Marker for thyroid cancer screening, probe composition and application thereof | |
| CN112831558B (en) | Early screening method and kit for Crohn disease susceptibility genes | |
| WO2024027796A1 (en) | Use of marker in diagnosing breast cancer or predicting breast cancer risks | |
| CN106636351A (en) | SNP marker related to breast cancer and its application | |
| CN109457019B (en) | KCNH2 gene SCD related SNP detection kit and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |