CN108060234A - The amplimer and amplification method of a kind of Tiger Shrike and Lanius schach Linnaeus cytochrome b gene - Google Patents
The amplimer and amplification method of a kind of Tiger Shrike and Lanius schach Linnaeus cytochrome b gene Download PDFInfo
- Publication number
- CN108060234A CN108060234A CN201711329657.2A CN201711329657A CN108060234A CN 108060234 A CN108060234 A CN 108060234A CN 201711329657 A CN201711329657 A CN 201711329657A CN 108060234 A CN108060234 A CN 108060234A
- Authority
- CN
- China
- Prior art keywords
- amplimer
- tiger
- lanius
- schach
- linnaeus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of Tiger Shrikes and the amplimer and amplification method of Lanius schach Linnaeus cytochrome b gene, belong to biological technical field, the amplimer includes the specific primer of the HWBLP R14 shown in the HWBLP F14 and SEQ ID No.2 shown in the SEQ ID No.1 containing 20 bases, SEQ ID No.1：CCTACTCCATCAAATATCTC；SEQ ID No.2：TTTGGTTTACAAGACCAATG, and using phenol, chloroform extraction method extraction DNA, finally expanded using the PCR reaction systems after optimization, the present invention has good species specificity using species specificity amplimer；3 ' ends of all primers avoid the introducing of A bases so as to substantially reduce the probability of non-specific amplification, the workload of a large amount of design primers and a large amount of consulting literatures are avoided, using the PCR amplification program after optimization：The amplification activity of archaeal dna polymerase is given full play to, efficiently and stably Tiger Shrike and Lanius schach Linnaeus cytochrome b gene are expanded, pcr amplification product is used directly for being sequenced, and significantly reduces the work load of operator.
Description
Technical field
The invention belongs to biological technical fields, are related to gene magnification primer and amplification method technical field, and in particular to one
The amplimer and amplification method of kind Tiger Shrike and Lanius schach Linnaeus cytochrome b gene.
Background technology
Tiger Shrike and Lanius schach Linnaeus belong to Passeriformes Laniidae butcher bird category on taxology.Passerine Birds are in Aves
A maximum monoid, mainly using pest as food, origin and Evolvement in relation to the monoid are always the concern of birds educational circles
Focal issue.Molecular systematics has very big advantage in terms of various biological group origins and evolution is solved, and many has
The problem of dispute, can be solved by Molecular tools.It is however, also very thin with the relevant molecular biology research of Passerine Birds
Weak, these all affect the solution of the monoid systematics problem.For Matrix attachment region, birds mitochondrial genomes into
There is following advantage during row Phylogenetic Analysis：Molecular weight is small, sequence in the gene is close, stringent matrilinear inheritance, inorganization are special
Property and evolutionary rate it is fast etc., therefore, mitochondrial DNA is widely used as molecular labeling grinding for birds Phylogenetic Relationships
Study carefully.The existing enough variant sites of cytochrome b gene are guarded enough for studying Population Level.One smaller gene
Segment can be included out of kind to inter-species or even to the evolutionary genetics information section, had in phyletic evolution and sort research fine
Applicability, molecular information can be provided for the research of Tiger Shrike and Lanius schach Linnaeus.
Round pcr, that is, polymerase chain reaction technology is a kind of molecular biosciences that specific DNA fragmentation is expanded for amplification
Technology, it is considered as the special DNA replication dna of in vitro, and the maximum feature of PCR is that micro DNA can be significantly increased.
It is widely used to the every field of molecular biology.PCR skills are used as disclosed in Chinese patent publication No. CN105861665A
The amplification that art carries out avian flu virus gene, and the gene of amplification is tested, the method, which has, takes small, easy and section
About cost the advantages of, but successfully PCR amplification needs the accurate control of many factors, and amplification situation is not only by amplification target sequence
The influence of row DNA profiling, it is also related with amplification system and condition, it is right including dNTP concentration, primer concentration, the variation of template amount etc.
Amplification generates.It is new so as to largely design and synthesize at present due to not known about to species background knowledge during research
Primer, causes to expand that of high cost, expanding effect is poor, labor intensive.
The content of the invention
According to more than the deficiencies in the prior art, the technical problems to be solved by the invention are that proposition is a kind of special using species
The primer of property, using the PCR amplification program after optimization accurately and rapidly to Tiger Shrike and Lanius schach Linnaeus cytochrome b gene
It is expanded, in order to solve the above-mentioned technical problem, the technical solution adopted by the present invention is：
A kind of Tiger Shrike and Lanius schach Linnaeus cytochrome b gene amplimer, the Tiger Shrike and Lanius schach Linnaeus are thin
Born of the same parents' pigment b gene amplimer includes HWBLP-F14 the and SEQ ID No.2 shown in the SEQ ID No.1 containing 20 bases
The specific primer of shown HWBLP-R14, wherein,
SEQ ID No.1：CCTACTCCATCAAATATCTC；
SEQ ID No.2：TTTGGTTTACAAGACCAATG.
Preferably, the amplimer is synthesized by general Biosystems Inc Anhui factory and concentration is 5 μm of ol.
A kind of method of amplimer amplification Tiger Shrike and Lanius schach Linnaeus cytochrome b gene, is as follows：
1) sample is drawn materials：The muscle of Tiger Shrike and Lanius schach Linnaeus is taken, respectively number K0322 and K0359；
2) gene is extracted：Total gene extraction is carried out using phenol, chloroform extraction method, by the muscle groups of number K0322 and K0359
It knits to shred and be placed in the EP pipes of sterilizing, and DNA extracting solutions and RNaseA are added in EP pipes, shake up the water-bath at 37 DEG C of temperature
1h；Proteinase K is added, is shaken up and is placed in 50 DEG C of water-baths and is digested completely to muscle；It is cooled to room temperature and adds in isometric saturated phenol,
It sways to water phase and phenol and mixes into emulsion；It centrifuges, upper strata aqueous phase is taken to repeat phenol extraction 1-2 times；To the molten of phenol extraction
Isometric chloroform isoamyl alcohol is added in liquid, sways uniformly, centrifuges, upper strata aqueous phase is then repeated into chloroform recovery operation 1
Upper strata aqueous phase is taken after secondary again and adds in the absolute ethyl alcohol of NaAC and 2 times of volume precooling of 1/5 volume, room temperature jog is placed in -20 DEG C
3h is freezed in refrigerator-freezer；15min is then centrifuged for, after supernatant, the rinsing of Xun Huan ethyl alcohol, centrifugation 15min are operated 2 times, air-dry centrifugation
Object adds in 1 × TE dissolving DNAs to centrifugation object, lysate is placed in -40 DEG C of refrigerator-freezers and is stored, and DNA lysates is taken to carry out agar
Sugared gel electrophoresis；
3) PCR amplification：Dream-taq buffer, amplimer are added in EP pipes, dNTPMix, Dream-Taq enzyme, are carried
DNA, dimethyl sulfoxide (DMSO) and the distilled water taken, then in 94 DEG C of pre-degeneration 3min；Then carry out 36 cycle, the cycling including：
94 DEG C of denaturation 30s, annealing and extension；72 DEG C of extension 8min are finally remake, Tiger Shrike amplified band number is H, Lanius schach Linnaeus
Amplified band Z is detected into row agarose gel electrophoresis, amplified production and corresponding amplimer is sequenced.
Preferably, the PCR amplification is the dosage of Dream-taq buffer on the basis of the PCR amplification system of 50 μ L
It is 5 μ L for 5 μ L, dNTPMix dosages, the dosage of every amplimer is respectively 4.4 μ L, and the dosage of the DNA of extraction is 4 μ L, and two
The dosage of methyl sulfoxide is that 1 μ L, Dream-Taq enzyme dosage is 0.25 μ L.
Preferably, the annealing temperature is 55 DEG C, annealing time 30s.
Preferably, the elongating temperature is 72 DEG C, extension of time 70s.
Compared with prior art, beneficial effects of the present invention：
1. the amplimer that the present invention uses has good species specificity；3 ' ends of all primers avoid A
The introducing of base is so as to substantially reducing the probability of non-specific amplification.
2. the PCR amplification program after present invention optimization：The amplification activity of archaeal dna polymerase is given full play to, it is efficiently and stably right
Tiger Shrike and Lanius schach Linnaeus cytochrome b gene are expanded, and pcr amplification product is used directly for being sequenced, and mitigates significantly
The work load of operator.
3. the present invention is using using species specificity amplimer, avoiding a large amount of design primers and a large amount of consulting literatures
Workload.
Description of the drawings
Fig. 1 is PCR amplification histogram in embodiment.
1-3, Tiger Shrike (H) cytochrome b gene PCR amplification band, 4-6, Lanius schach Linnaeus (Z) cytochrome b gene
PCR amplification band.
Specific embodiment
It below by the description to embodiment, is described in further detail, to help those skilled in the art to this hair
Bright inventive concept, technical solution have more complete, accurate and deep understanding.
Current embodiment require that illustrating, amplimer is synthesized by general biosystem (Anhui) Co., Ltd and primer is dense
It spends for 5 μm of ol, the dNTPMix used is the commercially available product of TIANGEN Biotech (Beijing) Co., Ltd., Dream-taq and its buffering
Agent is the commercially available product of match Mo Feishier companies, remaining used chemical reagent is conventional commercial analytical reagents.
A kind of Tiger Shrike and Lanius schach Linnaeus cytochrome b gene amplimer, the Tiger Shrike and Lanius schach Linnaeus are thin
Born of the same parents' pigment b gene amplimer includes HWBLP-F14 the and SEQ ID No.2 shown in the SEQ ID No.1 containing 20 bases
The specific primer of shown HWBLP-R14, wherein,
SEQ ID No.1：CCTACTCCATCAAATATCTC；
SEQ ID No.2：TTTGGTTTACAAGACCAATG.
A kind of method that Tiger Shrike and Lanius schach Linnaeus cytochrome b gene are expanded using above-mentioned amplimer is specific to walk
It is rapid as follows：
1) sample is drawn materials：The muscle of Tiger Shrike and Lanius schach Linnaeus is taken, respectively number K0322 and K0359；Such as following table：
| Number | Species | Sample type |
| K0322 | Tiger Shrike | Muscle |
| K0359 | Lanius schach Linnaeus | Muscle |
2) gene is extracted：Using phenol, chloroform extraction method, the musculature sample that about 50mg numbers are K0322, K0359 is taken,
It shreds the EP pipes for being placed on sterilized 2.0mL, the DNA extracting solutions and 4 μ L 20mg/mL of 1mL is added in EP pipes
RNaseA (ribalgilase) shakes up and is placed in 37 DEG C of water-baths after water-bath 1h；EP pipes are taken out, add in the egg of 5 μ L20mg/mL
White enzyme K, shakes up and is placed on water-bath about 2.5h in 50 DEG C of water-baths, until muscle digests completely, is during which shaken up and down every 10min
It is even；EP pipes are taken out, after being cooled to room temperature, add in isometric saturated phenol, are gently shaken up up and down 7 minutes until water phase and phenol phase
It is mixed into emulsion；Then 15min is centrifuged at 10000r/min, 10 DEG C, takes out upper strata aqueous phase into another 20mLEP pipes；Weight
Multiple phenol extraction step 2 time；Isometric chloroform isoamyl alcohol is added in into the solution of phenol extraction, gently shakes up about 7min up and down,
10000r/min centrifuges 15min at 10 DEG C, takes out upper strata aqueous phase into the EP pipes of another 2.0mL；Isometric chlorine is added in again
Imitative isoamyl alcohol simultaneously gently shakes up about 7min up and down, and 15min is centrifuged at 10000r/min, 10 DEG C, upper strata aqueous phase is taken out and dispenses
Into the EP pipes of 2 1.5mL；Then the 3mol/LNaAC (sodium acetate) of 1/5 volume and the nothing of 2 times of volume precoolings are added in EP pipes
Water-ethanol, room temperature jog EP pipes are placed in freezing 3h in -20 DEG C of refrigerator-freezers；EP pipes, in 12000r/min, 4 DEG C are taken out from refrigerator-freezer
Lower centrifugation 15min, and remove supernatant；Then add 500 μ L concentration, 75% ethyl alcohol rinsing, at 12000r/min, 4 DEG C from
Heart 15min, and remove supernatant；The rinsing of 500 μ L concentration, 75% ethyl alcohol is added, 15min is centrifuged at 12000r/min, 4 DEG C,
And air-dry centrifugation object after removing supernatant；1 × TE dissolving DNAs of 100 μ L are added in centrifugation object, lysate is placed in -40 DEG C of ice
It is stored in cabinet, and takes 2 μ LDNA lysates into row agarose gel electrophoresis；
3) PCR amplification：On the basis of the PCR amplification system of 50 μ L, 5 μ L of Dream-taq buffer are added in into EP pipes,
Amplimer each 4.4 μ L, the dNTPMix of 5 μ L, the DNA of the extraction of the Dream-Taq enzymes of 0.25 μ L and 1 μ L, the dimethyl of 1 μ L
Sulfoxide, and be with distilled water polishing to 50 μ L, PCR reaction conditions：94 DEG C of pre-degeneration 3min；Then 36 Xun Huans are carried out, this is followed
Ring includes：94 DEG C of denaturation 30s, 30s and 72 DEG C of extension 70s of 55 DEG C of annealing；Finally remake 72 DEG C of extension 8min, Tiger Shrike amplification
Band number is H, Lanius schach Linnaeus amplified band Z, is detected into row agarose gel electrophoresis, and the DNA cloning of each animal respectively repeats 3
It is secondary, and DNA solution is taken to be detected into row agarose gel electrophoresis, send amplified production and corresponding amplimer to raw work bioengineering
(Shanghai) limited company is sequenced, the result is shown in Figure 1 of sequencing, expands segment number, latin name and the sequence of species
Length such as following table.
| Segment | Species | Latin name | Sequence length |
| H | Tiger Shrike | Lanius tigrinus | 1120bp |
| Z | Lanius schach Linnaeus | Lanius schach | 1120bp |
The present invention is exemplarily described above in conjunction with specific embodiment, it is clear that the present invention implements and from upper
State the limitation of mode, if employ the inventive concept and technical scheme of the present invention progress various unsubstantialities improvement or
It is not improved by the present invention design and technical solution directly apply to other occasions, protection scope of the present invention it
It is interior.Protection scope of the present invention should be determined by the scope of protection defined in the claims.
Sequence table
<110>Anhui Normal University
<120>A kind of Tiger Shrike and Lanius schach Linnaeus cytochrome b gene amplimer and amplification method
<130> 1
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> HWBLP-F14
<400> 1
tttggtttac aagaccaatg 20
<210> 2
<211> 20
<212> DNA
<213> HWBLP-R14
<400> 2
tttggtttac aagaccaatg 20
Claims (6)
1. a kind of Tiger Shrike and Lanius schach Linnaeus cytochrome b gene amplimer, which is characterized in that the Tiger Shrike and palm fibre
Carrying on the back butcher bird cytochrome b gene amplimer includes the HWBLP-F14 and SEQ shown in the SEQ ID No.1 containing 20 bases
The specific primer of HWBLP-R14 shown in ID No.2, wherein,
SEQ ID No.1：CCTACTCCATCAAATATCTC；
SEQ ID No.2：TTTGGTTTACAAGACCAATG.
2. Tiger Shrike according to claim 1 and Lanius schach Linnaeus cytochrome b gene amplimer, which is characterized in that
The amplimer is synthesized by general Biosystems Inc Anhui factory and concentration is 5 μm of ol.
It is 3. a kind of using any amplimer amplification Tiger Shrikes of claim 1-2 and Lanius schach Linnaeus cytochrome b base
The method of cause, which is characterized in that be as follows：
1) sample is drawn materials：The muscle of Tiger Shrike and Lanius schach Linnaeus is taken, respectively number K0322 and K0359；
2) gene is extracted：Total gene extraction is carried out using phenol, chloroform extraction method, the musculature of number K0322 and K0359 are cut
In the broken EP pipes for being placed on sterilizing, and DNA extracting solutions and RNaseA are added in EP pipes, shake up the water-bath 1h at 37 DEG C of temperature；Again
Proteinase K is added in, is shaken up and is placed in 50 DEG C of water-baths and is digested completely to muscle；It is cooled to room temperature and adds in isometric saturated phenol, sway
Emulsion is mixed into water phase and phenol；It centrifuges, upper strata aqueous phase is taken to repeat phenol extraction 1-2 times；Into the solution of phenol extraction
Isometric chloroform isoamyl alcohol is added in, sways uniformly, centrifuges, after then upper strata aqueous phase repetition chloroform recovery is operated 1 time
Upper strata aqueous phase is taken again and adds in the absolute ethyl alcohol of NaAC and 2 times of volume precooling of 1/5 volume, and room temperature jog is placed in -20 DEG C of refrigerator-freezers
Middle freezing 3h；15min is then centrifuged for, after supernatant, the rinsing of Xun Huan ethyl alcohol, centrifugation 15min are operated 2 times, air-dry centrifugation object, to
It centrifuges object and adds in 1 × TE dissolving DNAs, lysate is placed in -40 DEG C of refrigerator-freezers and is stored, and DNA lysates is taken to carry out agarose and are coagulated
Gel electrophoresis；
3) PCR amplification：To EP pipes add in Dream-taq buffer, amplimer, dNTPMix, Dream-Taq enzyme, extraction
DNA, dimethyl sulfoxide (DMSO) and distilled water, then in 94 DEG C of pre-degeneration 3min；Then carry out 36 cycle, the cycling including：94℃
It is denatured 30s, annealing and extension；72 DEG C of extension 8min are finally remake, Tiger Shrike amplified band number is H, and Lanius schach Linnaeus expands
Band Z is detected into row agarose gel electrophoresis, amplified production and corresponding amplimer is sequenced.
4. the method for amplimer amplification Tiger Shrike according to claim 3 and Lanius schach Linnaeus cytochrome b gene,
It being characterized in that, the PCR amplification is on the basis of the PCR amplification system of 50 μ L, and the dosage of Dream-taq buffer is 5 μ L,
DNTPMix dosages are 5 μ L, and the dosage of amplimer is respectively 4.4 μ L, and the dosage of the DNA of extraction is 4 μ L, dimethyl sulfoxide (DMSO)
Dosage is that 1 μ L, Dream-Taq enzyme dosage is 0.25 μ L.
5. the method for amplimer amplification Tiger Shrike according to claim 3 and Lanius schach Linnaeus cytochrome b gene,
It is characterized in that, the annealing temperature is 55 DEG C, annealing time 30s.
6. the method for amplimer amplification Tiger Shrike according to claim 3 and Lanius schach Linnaeus cytochrome b gene,
It is characterized in that, the elongating temperature is 72 DEG C, extension of time 70s.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711329657.2A CN108060234A (en) | 2017-12-13 | 2017-12-13 | The amplimer and amplification method of a kind of Tiger Shrike and Lanius schach Linnaeus cytochrome b gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711329657.2A CN108060234A (en) | 2017-12-13 | 2017-12-13 | The amplimer and amplification method of a kind of Tiger Shrike and Lanius schach Linnaeus cytochrome b gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108060234A true CN108060234A (en) | 2018-05-22 |
Family
ID=62138533
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711329657.2A Pending CN108060234A (en) | 2017-12-13 | 2017-12-13 | The amplimer and amplification method of a kind of Tiger Shrike and Lanius schach Linnaeus cytochrome b gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108060234A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE19629166C2 (en) * | 1995-08-22 | 1997-09-18 | Ztb Zentrum Technologietransfe | Analytical method for determining the origin of various materials of biological origin using at least one primer |
| US20030143534A1 (en) * | 2001-02-14 | 2003-07-31 | Usha Goswami | Probes for myctophid fish and a method for developing the same |
| CN1505684A (en) * | 2001-03-28 | 2004-06-16 | 科学与工业研究会 | Universal primers for wildlife identification |
| CN104611327A (en) * | 2014-12-29 | 2015-05-13 | 江苏省家禽科学研究所 | Amplification and sequencing method of chicken mtDNA Cytb gene complete sequence and special primer |
-
2017
- 2017-12-13 CN CN201711329657.2A patent/CN108060234A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE19629166C2 (en) * | 1995-08-22 | 1997-09-18 | Ztb Zentrum Technologietransfe | Analytical method for determining the origin of various materials of biological origin using at least one primer |
| US20030143534A1 (en) * | 2001-02-14 | 2003-07-31 | Usha Goswami | Probes for myctophid fish and a method for developing the same |
| CN1505684A (en) * | 2001-03-28 | 2004-06-16 | 科学与工业研究会 | Universal primers for wildlife identification |
| CN104611327A (en) * | 2014-12-29 | 2015-05-13 | 江苏省家禽科学研究所 | Amplification and sequencing method of chicken mtDNA Cytb gene complete sequence and special primer |
Non-Patent Citations (4)
| Title |
|---|
| YANG,D.C.等: "《GenBank》", 21 July 2016 * |
| 梁刚: "雀形目15种鸟类CoI和Cyt b基因序列比较及伯劳属的系统发育", 《中国优秀硕士学位论文全文数据库》 * |
| 梁刚等: "基于Cyt b基因的雀形目15种鸟类", 《西安文理学学报》 * |
| 马玉等: "雀形目38种鸟类线粒体cytb的引物设计及PCR优化", 《林业科技》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ames et al. | The use of mitochondrial cytochrome oxidase I gene (COI) to differentiate two UK blowfly species–Calliphora vicina and Calliphora vomitoria | |
| Jax et al. | Avian transcriptomics: opportunities and challenges | |
| CN104017891B (en) | Application of septin1 gene to detection of nosema bombycis | |
| CN108611424A (en) | Cyprinid fish mitochondrial genome complete sequence amplimer and amplification method | |
| WO2012155577A1 (en) | Method for separating and purifying rna from biomaterial | |
| CN104017890A (en) | Application of EB1 gene to detection of nosema bombycis | |
| CN109355395B (en) | Multiplex PCR detection method for three fluke metacercaria in freshwater fish and primers for detection | |
| Pisal et al. | Detection of mycoplasma contamination directly from culture supernatant using polymerase chain reaction | |
| CN106399483A (en) | RNA interference feeding method for apolygus lucorum and application of feeding method in gene screening | |
| Techera et al. | Origin, spreading and genetic variability of chicken anaemia virus | |
| Liu et al. | Mycelial compatibility group and genetic variation of sunflower Sclerotinia sclerotiorum in Northeast China | |
| WO2016065982A1 (en) | Lamp detection primers for silkworm egg microsporidium and applications of the primers | |
| CN111690777B (en) | Specific primer, kit and method for RT-RPA detection of citrus leaf mottle virus | |
| CN104372078B (en) | The HDA primer of C.perfringens and application process thereof in a kind of food | |
| CN108060234A (en) | The amplimer and amplification method of a kind of Tiger Shrike and Lanius schach Linnaeus cytochrome b gene | |
| CN104498593B (en) | Identify or auxiliary identify storage bean weevil primer to and test kit | |
| Diz et al. | RNA-seq data from mature male gonads of marine mussels Mytilus edulis and M. galloprovincialis | |
| Ranjan et al. | Vp5 gene based molecular characterization of bluetongue virus 9 from South India | |
| Feng et al. | Identification of core genes affecting IMF deposition in bovine | |
| CN104630203A (en) | Method for preparing insect intestinal flora DNA (Deoxyribonucleic Acid) | |
| Jiang et al. | Identification and comparative profiling of gonadal microRNAs in the adult pigeon (Columba livia) | |
| CN104032015B (en) | The fluorescent quantificationally PCR detecting kit of sheep Fasciola hepatica and application | |
| CN110551799A (en) | Kit for detecting components of mouse origin and fox origin in food and application thereof | |
| CN111719020A (en) | Kit, primer and probe for detecting bovine rotavirus | |
| Shimada et al. | Use of S1 nuclease in deep sequencing for detection of double-stranded RNA viruses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180522 |
|
| RJ01 | Rejection of invention patent application after publication |