CN108048572B - Application of reagent for detecting long-chain non-coding RNA PVT1 expression quantity in preparation of nasopharyngeal carcinoma prognostic reagent - Google Patents

Abstract

The invention discloses an application of a reagent for detecting the expression quantity of long-chain non-coding RNA PVT1 in preparation of a nasopharyngeal carcinoma prognostic reagent. Through telephone follow-up of 92 nasopharyngeal carcinoma patients, detailed inquiry of their first time, treatment condition, recurrence, other diseases, recurrence and death time, and registration of survival time and status, and survival analysis of PVT1 expression in nasopharyngeal carcinoma tissues and patient survival time and status, the average survival time of the patients with high expression of PVT1 was found to be significantly shorter than that of the patients with low or no expression of PVT 1. The PVT1 is a molecular marker related to the prognosis of nasopharyngeal carcinoma, the lncRNA is high in expression, and the prognosis of a patient is poor.

Description

Application of reagent for detecting long-chain non-coding RNA PVT1 expression quantity in preparation of nasopharyngeal carcinoma prognostic reagent

Technical Field

The invention belongs to the field of tumor molecular biology, and particularly relates to an application method of a reagent for detecting long-chain non-coding RNA PVT1 in preparation of a nasopharyngeal carcinoma prognostic reagent.

Background

The results of human genome Project and its subsequent Encyclopedia Project of DNA elements (ENCODE) study show that The protein-encoding gene sequence only accounts for 1-3% of The human genome sequence, while most of The transcribable sequences in The human genome are Long non-coding RNAs (lncRNAs). LncRNA is widely present in various organisms, and as the complexity of organisms increases, the proportion of LncRNA sequences in genomes increases accordingly, suggesting that LncRNA is of great significance in the process of biological evolution. With the continuous discovery of lncRNA and the gradual interpretation of the functions of lncRNA, scientists find that lncRNA is widely and actively involved in the functional regulation and control of different levels of life activities, and as a brand-new field, lncRNA becomes a new frontier and a hot spot in the international life science research field.

LncRNA can be used as signal (signal), induction (guide), decoy (decoy) or scaffold (scaffold) molecules of functional protein, etc., can regulate the expression of genes at multiple levels such as chromatin remodeling, gene transcription, translation and protein modification, etc., and plays an irreplaceable role in basic physiological processes including development, immunity, reproduction, etc., and more importantly, the expression and dysfunction of LncRNA are closely linked with various human diseases including malignant tumors. Therefore, the function of the lncRNA is deeply researched, the genetic information transmission mode and the expression regulation network mediated by the lncRNA are revealed, the structure and the function of a genome can be re-annotated and elucidated from the perspective except for protein coding genes, the essence and the rule of life activities are deeply discovered, the pathogenesis of various common human diseases including tumors is expected to be known from a new perspective, and new molecular markers and treatment targets are provided for the diagnosis and treatment of the diseases.

Nasopharyngeal carcinoma is a common high-incidence head and neck malignant tumor, cervical lymph node metastasis easily occurs, prognosis is poor, radiotherapy is a current main clinical treatment scheme for nasopharyngeal carcinoma, and part of nasopharyngeal carcinoma patients are insensitive to radiotherapy because cancer cells have Radioresistance (Radioresistance), so that the tumor cells cannot be completely killed by radiation, and the residual tumor cells finally recur and metastasize to cause death of the patients. Research shows that the occurrence and development of the tumor are multi-gene involved, multi-step and multi-stage complex processes, LncRNA may play an important role in the occurrence and development of nasopharyngeal carcinoma, and lncRNA may also be involved in the regulation and control of nasopharyngeal carcinoma cell reflex sensitivity. Recently, the expression profiles of lncRNA in nasopharyngeal carcinoma biopsy tissues and normal control samples are constructed by using lncRNA chips, some lncRNAs which are differentially expressed in nasopharyngeal carcinoma are screened from the expression profiles, and the expression of lncRNA PVT1 in the nasopharyngeal carcinoma is remarkably up-regulated through real-time fluorescent quantitative PCR verification of enlarged samples, which indicates that a detection preparation aiming at the lncRNA can be used for auxiliary diagnosis of the nasopharyngeal carcinoma. Subsequently, we further increased the samples, and detected the expression level of PVT1 by in situ hybridization (in situ hybridization) in 94 nasopharyngeal carcinoma paraffin archive specimens with clinical follow-up data, and found that patients with high expression of PVT1 are more likely to develop radiotherapeutic resistance, and their survival time is shorter than that of patients with low expression of lncRNA, so the detection preparation for lncRNA can also be used for the curative effect prediction and prognosis judgment of nasopharyngeal carcinoma.

By designing and synthesizing short-hairpin RNA (short-hairpin RNA, shRNAs) sequences of targeted PVT1, an RNA interference vector of targeted PVT1 is constructed and transfected into nasopharyngeal carcinoma cell strains, and the fact that the radiotherapy sensitivity of nasopharyngeal carcinoma cells can be obviously enhanced by the targeted interference of the expression of PVT1 is proved. The RNA interference vector of PVT1 is loaded on the polylysine modified silicon nano-particles to prepare the nano gene transporter, and the polylysine modified silicon nano-particles can protect the RNA interference vector of PVT1 from degradation by nuclease, prolong the action time and have higher transfection efficiency. Therefore, the lncRNA interference preparation can induce nasopharyngeal carcinoma cells to be more sensitive to radiotherapy by inhibiting the lncRNA expression in the nasopharyngeal carcinoma cells in a targeted manner, and can be used as a novel radiotherapy sensitizer for adjuvant therapy of nasopharyngeal carcinoma.

Disclosure of Invention

The invention aims to provide application of a reagent for detecting the expression quantity of long-chain non-coding RNA PVT1 in preparation of a nasopharyngeal carcinoma prognostic reagent, wherein the sequence of the long-chain non-coding RNA PVT1 is shown as SEQ NO: 1.

The reagent for detecting the expression quantity of the long-chain non-coding RNA PVT1 is used for detecting nasopharyngeal carcinoma patients.

The preparation is an in situ hybridization detection reagent or a PCR detection reagent.

Oligonucleotide probes for in situ hybridization detection of PVT1 expression:

PVT1 probe 1: 5'-GGTCGGACTAGAAAACCGGTCTTCCTCTAATTTT-3', respectively;

PVT1 probe 2: 5'-GAGACTGTAAAAACTTCTCAGGTCTTAGGA-3', respectively;

PVT1 probe 3: 5'-CTCATAAAACTCTAACCTCTTAATTCTCGGTCAG-3' are provided.

The positive control probe sequence is as follows:

GAPDH probe 1: 5'-CCACTTTACCAGAGTTAAAAGCAGCCCTGG-3', respectively;

GAPDH probe 2: 5'-CAGTAGAGGCAGGGATGATGTTCTGGAGAG-3', respectively;

GAPDH probe 3: 5'-GTCAGAGGAGACCACCTGGTGCTCAGTGTA-3' are provided.

The forward primer of the PCR detection reagent PVT1 is 5'-TGG CTG AGA GGG TTG AGA TC-3', and the reverse primer 5'-GCT GTA TGT GCC AAG GTC AC-3'.

The GAPDH forward primer used for control in the PCR detection reagents was 5'-ACCACAGTCCATGCCATCAC-3', reverse primer 5'-TCCACCACCCTGTTGCTGTA-3'.

The invention inquires about the first time, treatment condition, recurrence, death time and other conditions of 92 nasopharyngeal carcinoma patients in detail by telephone follow-up, registers survival time and state, and analyzes the expression of PVT1 in nasopharyngeal carcinoma tissues and the survival time and state of the patients, and finds that the average survival time of the patients with high expression of PVT1 is obviously shorter than that of the patients with low expression or no expression of PVT 1. The PVT1 is a molecular marker related to nasopharyngeal carcinoma prognosis, the lncRNA has high expression, the patient has poor prognosis, and the molecular marker has obvious clinical medical significance.

Drawings

FIG. 1 shows that the real-time fluorescent quantitative PCR technology verifies that the expression of lncRNA PVT1 in nasopharyngeal carcinoma and normal nasopharyngeal epithelium, and the expression of PVT1 in nasopharyngeal carcinoma (T) is obviously improved compared with the expression of PVT1 in normal nasopharyngeal epithelium (N).

FIG. 2 shows in situ hybridization detection of PVT1 expression in nasopharyngeal carcinoma and normal nasopharyngeal epithelium,

lower expression levels in normal nasopharyngeal epithelium (NPE) (high expression was detected in only 6 normal nasopharyngeal epithelial tissues, and low or no expression was detected in the remaining 27 cases), while high expression of PVT1 was detected in 63.8% of nasopharyngeal carcinomas (60 of 94 nasopharyngeal carcinoma tissues); p < 0.001.

FIG. 3 shows that the expression of PVT1 in nasopharyngeal carcinoma is correlated with the sensitivity of nasopharyngeal carcinoma to radiation therapy,

of the 92 nasopharyngeal carcinoma patients with clinical follow-up data, 44 were resistant to radiotherapy (i.e., insufficiently sensitive to radiotherapy), 48 were sensitive to radiotherapy (radioactive), and 60.4% of the patients in the radiotherapy-sensitive group (29) had low expression of PVT1 in the nasopharyngeal carcinoma tissues, while high expression of PVT1 was detected in only 11.4% (5) of the radiotherapy-resistant group; p < 0.001.

FIG. 4 shows the relationship between the expression of PVT1 in nasopharyngeal carcinoma and the prognosis of nasopharyngeal carcinoma,

the high expression of PVT1 in nasopharyngeal carcinoma is associated with a poor prognosis in patients with nasopharyngeal carcinoma, i.e., the overall survival time (left) and recurrence-free survival (right) for patients with high expression of PVT1 (high) is significantly lower than for patients with Low or no expression of PVT1 (Low).

FIG. 5 shows that the introduction of PVT1 interference vector into nasopharyngeal carcinoma cells can significantly inhibit the expression of PVT1 in nasopharyngeal carcinoma cells,

after introducing an interference vector (siPVT1) targeting PVT1 into nasopharyngeal carcinoma cell lines CNE2 and 5-8F, the expression condition of PVT1 in nasopharyngeal carcinoma cells is detected by a real-time fluorescence quantitative PCR method, and the expression of PVT1 is obviously inhibited. Negative Control (NC) was scramble interference vector.

FIG. 6 shows that after the interference vector introduced with PVT1 in nasopharyngeal carcinoma cells inhibits the expression of PVT1, the cells are more sensitive to radiation therapy,

after the interference vector (siPVT1) targeting PVT1 is introduced into nasopharyngeal carcinoma cell lines CNE2 and 5-8F to inhibit the expression of PVT1, the cells are respectively irradiated with 0, 2, 4, 6 and 8Gy of radiation, and then the cells are continuously cultured for 12 days, and a colony forming experiment shows that the colony forming number formed by CNE2 and 5-8F cells is obviously reduced after the expression of PVT1 is inhibited compared with that of a negative control (NC, cells transfected with scramble interference vector), which indicates that the cells are more sensitive to radiotherapy.

FIG. 7 shows that the introduction of interference vector PVT1 into nasopharyngeal carcinoma cells inhibits the expression of PVT1, the apoptosis is increased significantly,

the radiation irradiation induced tumor cell apoptosis is the main reason for killing tumor cells by radiotherapy, an interference vector targeting PVT1 is transferred into nasopharyngeal carcinoma cell lines CNE2 and 5-8F, after the expression of PVT1 is inhibited, the flow cytometry detects the apoptosis condition of the nasopharyngeal carcinoma cells, the proportion of the apoptotic cells is obviously increased after the nasopharyngeal carcinoma cells inhibiting the expression of PVT1 are irradiated by the radiation, and the effect of sensitizing the radiotherapy by inhibiting the expression of PVT1 is further proved.

Detailed Description

The invention is further illustrated by the following detailed description, but is not to be construed as being limited thereto.

Example 1 real-time fluorescent quantitative PCR assay demonstrating that PVT1 is up-regulated in nasopharyngeal carcinoma

1. The material and the method are as follows:

32 normal nasopharyngeal epithelial tissues and 61 nasopharyngeal carcinoma tissues were collected, total RNA was extracted, 2. mu.g of RNA was reverse-transcribed into cDNA, and real-time fluorescent quantitative PCR was performed. The forward primer of PVT1 is 5'-TGG CTG AGA GGG TTG AGA TC-3' as shown in SEQ NO. 2, and the reverse primer 5'-GCT GTA TGT GCC AAG GTC AC-3' is shown in SEQ NO. 3.

The GAPDH forward primer used for the control was 5'-ACCACAGTCCATGCCATCAC-3' as shown in SEQ NO. 4 and the reverse primer 5'-TCCACCACCCTGTTGCTGTA-3' as shown in SEQ NO. 5.

Real-time fluorescent quantitative PCR reaction system

Real-time fluorescent quantitative PCR reaction step

After the reaction is finished, an amplification curve and a melting curve of the real-time fluorescence quantitative PCR are confirmed, and the expression intensity of each gene is normalized according to a CT value (threshold cycle values) and an internal reference Gene (GAPDH), and then a group t-test is adopted to calculate a P value.

2. Results

PVT1 was not expressed or very low expressed in normal control tissue, while P <0.001 was highly expressed in nasopharyngeal carcinoma tissue (FIG. 1)

Example 2 in situ hybridization assay to find the expression of PVT1 in nasopharyngeal carcinoma and its correlation with patient prognosis and sensitivity to radiation therapy

1. Material method

1.1 design and Synthesis of hybridization probes

In order to detect the expression of PVT1 by in situ hybridization, we designed 3 in each of two sets of oligonucleotide probes for detecting the expression of PVT1 and positive control by in situ hybridization.

Oligonucleotide probes for in situ hybridization detection of PVT1 expression:

PVT1 probe 1: 5'-GGTCGGACTAGAAAACCGGTCTTCCTCTAATTTT-3' is shown in SEQ NO. 6,

PVT1 probe 2: 5'-GAGACTGTAAAAACTTCTCAGGTCTTAGGA-3' is shown in SEQ NO. 7,

PVT1 probe 3: 5'-CTCATAAAACTCTAACCTCTTAATTCTCGGTCAG-3' is shown in SEQ NO. 8.

Positive control probe (detection housekeeping gene GAPDH):

GAPDH probe 1: 5'-CCACTTTACCAGAGTTAAAAGCAGCCCTGG-3', as shown in SEQ NO:9,

GAPDH probe 2: 5'-CAGTAGAGGCAGGGATGATGTTCTGGAGAG-3', as shown in SEQ NO:10,

GAPDH probe 3: 5'-GTCAGAGGAGACCACCTGGTGCTCAGTGTA-3', as shown in SEQ NO: 11.

The designed gene-specific oligonucleotide probe sequences are synthesized by a chemical synthesis method.

1.2 oligonucleotide Probe labeling kit and in situ hybridization detection reagent

Digoxin oligonucleotide Tailing reagent (Dig oligonucleotide Tailing Kit 2)^ndGeneration, Roche corporation), Anti-Digoxigenin-POD (Anti-Digoxigenin-POD, Fabfragments, Roche corporation), TSA signal amplification system (TSA) for enhancing in situ expression detection signals^TMBiotin System, NEL700 kit, PerkinElmer company), DAB staining kit (Beijing Zhongshan company), 20 Xsodium citrate Buffer solution (SSC), Dextran sulfate (Dextran sulfate), Deionized Formamide (Deionized Formamide), polyadenylic acid (polyadenylic acid, Poly A), polydeoxyadenylic acid (polydeoxyadenylic acid, Poly dA), denatured and sheared frog sperm DNA (denatured and sheared sperm DNA, ssDNA), yeast transport RNA (yeast-RNA, tRNA), Dithiothreitol (DTT), 50 Xdants Buffer solution (Denhardts's Buffer), phosphate Buffer solution (Buffer), pepsin K, bovine serum albumin (Tris), Triethanolamine (TEA), TNB Buffer (0.1M-HCl, 7.5, 0.15.5, 0.5% pH 1.5, 0.5% Na-5 CL, 0.5% Na-5, 0.5% HCl, 0.05% Na-20M-5, 0.05% HCl, blocking reagent (Blocking reagent agent, Roche).

1.3 other major reagents and materials

Absolute ethyl alcohol, 90% alcohol, 70% alcohol, 50% alcohol, turpentine, double distilled water, PBS buffer solution (pH7.2-7.4, NaCl 137mmol/L, KCl 2.7mmol/L, Na₂HPO₄4.3mmol/L，KH₂PO₄1.4 mmol/L); 3% of firstAn alcohol-hydrogen peroxide solution (prepared from 80% methanol and 30% hydrogen peroxide); 0.01mol/L citrate buffer (citrate buffer, CB, pH6.0 + -0.1, 9ml of 0.1M citric acid solution and 41ml of 0.1M sodium citrate solution are added to 450ml of distilled water for temporary configuration and then the pH value of the working solution is corrected); 0.1% trypsin; hematoxylin; 1% hydrochloric acid alcohol (1ml concentrated hydrochloric acid +99ml 70% alcohol); mounting glue (PTS Cure Mount II); special cover glass (480 is multiplied by 240 mm)²) Customized to Zhengzhou glass instrument factories. Leica low melting point (58 ℃) paraffin, domestic beeswax, absolute alcohol, xylene, 10% neutral paraformaldehyde (0.01mol/L, pH7.4, prepared from DEPC double distilled water and PBS buffer), hematoxylin, eosin, neutral mounting gum, a cover slip and a glass slide. 1.4 labeling of probes

The 3-labeling DIG Olignucleutide Kit is used for carrying out oligonucleotide probe labeling, and the reaction system is as follows.

100pmol oligonucleotide+ddH₂O＝9μl(control:control oligonucleutide 5μl+ddH₂O 4μl)

Mix well and centrifuge slightly. The reaction was carried out in a water bath at 37 ℃ for 30min, and stopped by adding 2. mu.l of EDTA (0.2M, pH 8.0).

1.5 purification after labeling of oligonucleotide probes

In order to increase the purity of the labeled probe, the labeled probe needs to be purified, and the specific operations are as follows:

1) probe reaction mixture (22. mu.l) + 2.5. mu.l 4M LiCl + 75. mu.l 100% cold ethanol (-20 ℃).

2) Precipitating at-70 deg.C for 60min, or-20 deg.C for 2 h.

3) Centrifuge at 13.000Xg for 15min at 4 ℃.

4) The supernatant was discarded and washed with 50. mu.l of ice-cold 70% (V/V) ethanol.

5) Centrifuge at 13.000Xg 4 ℃ for 5 min.

6) The supernatant was discarded and dried under vacuum at 4 ℃.

7) The probe was reconstituted with sterile double distilled water.

1.6 in situ hybridization detection of expression of PVT1 in archived paraffin sections

Pretreatment of paraffin section hybridization

1) The paraffin sections preserved at 4 ℃ are placed in a baking oven at 58 ℃ for 30min, and the paraffin on the surface is melted.

2) The xylenes were dewaxed for 3X5min in sequence.

3) Stepwise alcohol washing, 100% alcohol 2 × 2min → 95% alcohol 1 × 5min → 70% alcohol 1 × 5min → 50% alcohol 1 × 5min → DEPC water washing 2 × 3min → DEPC-PBS washing 2 × 5 min.

4) Mu.l pepsin K (10. mu.g/ml) was added dropwise to the sections and digested at 37 ℃ for 20 min.

5) The sections were washed in PBS (0.1M PBS +2mg/ml glutamic acid) for 1min and the reaction was stopped.

6) Slicing into 0.2N HCl, reacting at 37 deg.C for 20-30min to increase tissue permeability.

7) Sections were fixed with 4% paraformaldehyde (0.1M in PBS) for 10min at room temperature.

8) To increase the intensity of positive hybridization of the tissue, the sections were treated with acetyl. The sections were taken in 0.25% acetic anhydride Buffer I (0.1M triethanolamine) at room temperature for 10 min.

9) Wash 2X 5min in 1M PBS.

Prehybridization and hybridization

Pre-hybridization: pre-hybridization solution stored at-20 ℃ is incubated at 37 ℃ for 60min, the dosage of the pre-hybridization solution is 50 mu l, the parafilm covered slice is pre-hybridized for 2 hours in a wet box at 37 ℃. (the prehybridization solution components included 2XSSC, 10% dextran sulfate, 1 XDenhardt's solution, 50mM phospate Buffer (pH 7.0), 50mM DTT, 250. mu.l, 100. mu.g/ml poly A, 5. mu.g/ml poly dA, 250. mu.g/ml yeast-RNA, 500. mu.g/ml ssDNA, 47% Deionized formamide).

1) The parafilm was removed, the prehybridization solution was spun off, and the sections were placed in 2XSSC for 5 min.

2) And (3) hybridization reaction: hybridization was carried out at 37 ℃ overnight (18-20 h). Mu.l of hybridization solution was added to each section and covered with parafilm. Adding corresponding probes into the pre-hybridization solution to obtain a hybridization solution. The hybridization solution is prepared during pre-hybridization, and is placed at 37 ℃ for incubation, so that the probes are fully dissolved in the hybridization solution, a plurality of oligonucleotide probes are mixed in the experiment, and the probe hybridization solution is prepared according to the concentration of 500ng/ml of each probe. The concentration of the labeled probe of the digoxin tailing labeling kit is calculated according to the following steps: the concentration of each probe is compared according to the color development of the probe during the detection reaction when the probe is positively quantified, and the concentration of the labeled probe is comprehensively calculated according to two standards of the theoretical probe yield of 900ng of the naked probe labeling reaction with 100pmol of 30 basic groups.

3) After hybridization, the sections were washed, immersed in 2XSSC for 10min, and the parafilm was removed. Washed sequentially in a shaker with shaking, 2XSSC (0.5% SDS), 2X 15min → 0.25 XSSC (0.5% SDS), 2X 15 min.

Post-hybridization chromogenic detection reaction

1) Detecting a digoxin probe and mRNA binding complex by adopting Anti-Digoxigenin-POD; the TSA amplification system enhances a positive signal of in-situ hybridization reaction chromogenic reaction, and DAB chromogenic reaction is carried out.

2) The sections were transferred to TNT buffer for 3X5 min.

3) TNB blocking buffer, 300. mu.l/TMAs, was added dropwise at room temperature for 30 min.

4) Excess blocking agent was aspirated, and Anti-Digoxigenin-POD (TBS + 0.1% Triton X-100+ 1% blocking agent) diluted 1:100 was allowed to stand at room temperature for 4 hours.

5) TNT Buffer (0.1M Tris-CL, pH7.5, 0.15M NaCL, 0.05% Tween 20) wash, 3X5 min.

6) The signal amplification reagent Biotinyl Tyamid, 300. mu.l/TMAs, (Biotinyl Tyramid stock solution: biotinyl tyramide was dissolved in 0.2ml DMSO, Biotinyl tyramide working solution: 1 XDilute, 1:50 Biotinyl Tyramid stock), 10 minutes at room temperature.

7) TNT wash, 3X5 min.

8) The sections were added dropwise with SA-HRP (streptavidin-horseradish peroxidase), 300. mu.l/TMAs, at room temperature for 30 min.

9) TNT wash, 3X5 min.

10) Distilled water for washing, 1 × 1 min.

11) DAB color development, and color development reaction is controlled under a microscope.

12) The hematoxylin is counterstained by the hematoxylin,

13) dehydrating with alcohol step, slicing and drying.

14) And (4) dropwise adding a mounting adhesive, covering a cover glass with a corresponding specification, and crosslinking and slicing for 1min under an ultraviolet lamp.

1.7 results determination and Standard

Observing under a low-power microscope and a high-power microscope respectively, and firstly, observing the positioning of a positive expression signal of target RNA in an observation target cell: located in the nucleus, cytoplasm or cell membrane.

And then carrying out comprehensive scoring by respectively using two standards of the strength of the positive signal of the RNA expression part and the number of the positive expressed cells, wherein the judgment standard is as follows: (1) judging according to the staining intensity of the positive cells: a. the cells were not stained, score 0; b. staining the cells to light brown as weak positive, and scoring 1; c. cells stained brown with no background staining, or cells stained dark brown with light brown background as medium positive, scoring 2 points; d. cells stained dark brown and strongly positive with no background staining, scored 3. (2) Scoring by positive cell expression number: a. no positive cell expression, score 0; b. the number of positive expression cells is less than or equal to 25 percent, and the score is 1; c.25% < number of positive cells < 50%, score 2; d. the number of positive expression cells is more than or equal to 50%, and 3 points are taken.

In order to reduce subjective factors of scoring results as much as possible, two pathology experts respectively judge and score according to one of the standards, and then the two scores are multiplied, wherein the result is that ① 0 scores are finally counted as 0 and considered as negative expression, ② 1 scores and 2 scores are finally counted as 1 and considered as weak positive expression, ③ 3 scores and 4 scores are finally counted as 2 and considered as medium positive expression, and ④ 6 scores to 9 scores are finally counted as 3 and considered as strong positive expression.

1.8 analytical and statistical software

Statistical analysis is carried out on the experimental results by using SPSS13.0 statistical software, and Chi is used for pairwise comparison²test or Fisherexact test, and the correlation analysis adopts a Spearmen correlation method; if P is less than 0.05, the difference is statistically significant. The survival curve analysis adopts Kaplan-Meier method and log-rank test; multivariate analysis miningUsing a Cox' sporadic hazards model; if P is less than 0.05, the difference is statistically significant.

2 results

2.1 expression of PVT1 in nasopharyngeal carcinoma was significantly higher than that in normal control tissue and correlated with sensitivity to radiotherapy

PVT1 was highly expressed in 63.8% of nasopharyngeal carcinoma tissues (60/94 cases) and only in 18.2% (6 cases out of 33 normal tissue samples) of normal nasopharyngeal epithelial tissues (FIG. 2), with a clear statistical difference (P < 0.001). Of the 94 patients with nasopharyngeal carcinoma, 92 patients had clinical follow-up data, 44 patients were Radioresistant (i.e., not sufficiently sensitive to radiotherapy), 48 patients were Radiosensitive (Radiosensitive), 60.4% of the patients in the Radiosensitive group (29) had low expression of PVT1 in the nasopharyngeal carcinoma tissues, and high expression of PVT1 was detected in only 11.4% (5) of the Radioresistant group; p < 0.001. (FIG. 3)

2.2 the prognosis of patients with nasopharyngeal carcinoma with high PVT1 expression is poor

We performed phone follow-up on 92 patients with nasopharyngeal carcinoma, asked their first time, treatment status, presence or absence of recurrence, presence or absence of other diseases, recurrence and death time, etc., and registered survival time and status, and analyzed the expression of PVT1 in nasopharyngeal carcinoma tissue and survival time and status of the patients, and found that the mean survival time of the patients with high expression of PVT1 was significantly shorter than that of the patients with low or no expression of PVT1 (FIG. 4). The PVT1 is a molecular marker related to the prognosis of nasopharyngeal carcinoma, the lncRNA is high in expression, and the prognosis of a patient is poor.

Example 3 construction of shRNA vectors to interfere with expression of PVT1

1. Material method

1.1 reagents and kits

Restriction enzymes Hind III, Bgl II, EcoR I and Cla I, T4DNA ligase and the like were purchased from Takara;

TRIZOL^TMReagent(Invitrogen)；

plasmid extraction kit (# D6943-01, OMEGA);

gel recovery kit (# M5212, OMEGA);

reverse transcription kit (# a3500, Promega);

antibiotic G418 (Ameresc).

1.2 design of shRNA

Firstly, inputting a PVT1 sequence into Block-It RNAi designer software of Invitrogen company, searching the best target of shRNA of the lncRNA, and selecting 3 optimal corresponding target sequences as follows:

shRNA-1: GGACTTGAGAACTGTCCTTA is shown in SEQ NO. 12,

shRNA-2: GCTTCTCCTGTTGCTGCTAGT is shown in SEQ NO. 13,

shRNA-3: GCTCCACCCAGAAGCAATTCA is shown in SEQ NO. 14,

the widely used Scamble sequence without any target in the human genome was used as a negative control and the sequence was as follows:

scramble: 5'-GACACGCGACTTGTACCAC-3' is shown in SEQ NO. 15.

Aiming at the 3 lncRNA target sequences and the Scramble sequence, according to the instructions of pSUPER vector of OligoEngine company, oligonucleotide single strand capable of forming hairpin structure and reverse complementary sequence thereof are designed, and after annealing, DNA double strand with restriction enzyme cutting sites BglII and HindIII cohesive ends at two ends can be formed. Specifically, the sequences of oligonucleotides to be synthesized and the DNA double strands formed by pairing and annealing the oligonucleotides are as follows:

shRNA-1：

as shown in SEQ NO 16 and 17,

shRNA-2：

as shown in SEQ NO 18 and 19,

shRNA-3：

as shown in SEQ NO 20 and 21,

Scramble

shown as SEQ NO 22 and 23.

After annealing of the two complementary paired DNAs, the restriction enzyme Bgl II cohesive ends are on the left and HindIII cohesive ends are on the right.

1.3 shRNA vector construction

Chemically synthesizing 8 single-stranded oligo sequences corresponding to the above 4 shRNAs, dissolving the synthesized oligos to 20. mu.M with an oligonalingbuffer, and mixing 10. mu.l of each complementary single strand. The oligo mixture was then heated in a PCR instrument at 95 ℃ for 5 minutes and then naturally cooled to room temperature to form double-stranded oligo fragments.

The pSUPER plasmid was double digested with Bgl II and Hind III to recover a 3.1kb vector fragment, the annealed DNA from the cohesive ends and the digested vector were mixed at a mass ratio of 3:1, and ligated with T4 ligase at 16 ℃ overnight. Transforming E.coil competence, selecting a transformant, performing colony PCR and sequencing identification, performing enzyme digestion on the constructed pSUPER plasmid by ClaI and EcoRI, performing 2% agarose DNA gel electrophoresis, taking blank pSUPER as blank control, judging a positive clone with the target fragment inserted, and performing sequencing verification on the positive clone to interfere the expression of the intracellular PVT 1.

1.4 cell culture and transfection

Nasopharyngeal carcinoma cell lines CNE2 and 5-8F were purchased from cell center of university of Central and south China, RPMI 1640 medium and fetal bovine serum for cell culture, and trypsin for digestion of cells were all produced by Gibco, USA.

The nasopharyngeal carcinoma cell lines CNE2 and 5-8F with good growth status are expressed as 2 × 10⁵The cells/well were seeded in 6-well plates, and the 6-well plates were placed at 37 ℃ with 5% CO₂In an incubator, the transfection of the shRNA expression vector can be started when the cultured cells grow to 50-70% of the density; the transfection procedure was as follows:

adding 3 μ l lipofectamine 2000 into sterile EP tube, mixing and standing in 100 μ l serum-free culture medium for 5 min;

adding the constructed shRNA expression vector into 100 mul of serum-free culture medium; then, the mixture is mildly and uniformly mixed with 100 mul of serum-free culture medium containing lipofectamine, and the mixture is kept still for 30 minutes at room temperature, so that the DNA and the liposome form a complex;

washing the cells 3 times with D-Hank's solution;

adding 800 μ l of serum-free medium (without antibiotics) into the mixture, gently mixing, and adding into 1 well of 6-well plate;

place 6 well plate in CO₂The cells were cultured in an incubator at 37 ℃ for 6 hours, then the supernatant was discarded, and the cells were cultured for another 48 hours by adding complete medium.

1.5 real-time quantitative PCR detection of shRNA interference effect on lncRNA expression:

total RNA is extracted from nasopharyngeal carcinoma cells transfected by various shRNA vectors, 2 mu g of RNA is reversely transcribed into cDNA, and then real-time fluorescence quantitative PCR is carried out. PVT1 primers were 5'-TGG CTG AGA GGG TTG AGA TC-3', and 5'-GCTGTA TGTGCC AAG GTC AC-3'.

GAPDH primers used for the control were 5'-ACCACAGTCCATGCCATCAC-3' and 5'-TCCACCACCCTGTTGCTGTA-3',

real-time fluorescent quantitative PCR reaction system

Real-time fluorescent quantitative PCR reaction step

After the reaction is finished, an amplification curve and a melting curve of the real-time fluorescence quantitative PCR are confirmed, and the expression intensity of each gene is normalized according to a CT value (threshold cycle values) and an internal reference Gene (GAPDH), and then a group t-test is adopted to calculate a P value. 2. Results

After the three shRNA vectors transfect nasopharyngeal carcinoma cells CNE2 and 5-8F, the expression level of PVT1 in the nasopharyngeal carcinoma cells can be remarkably reduced (figure 5).

Example 4 preparation of nanoparticles loaded with shRNA interference vectors to inhibit expression of PVT1 in nasopharyngeal carcinoma cells

1. Material method

1.1 preparation of polylysine-coated silicon nanoparticles

The polylysine coated silicon nanoparticles are synthesized by applying OP 10/cyclohexane/ammonia microemulsion self-assembly technology to silicon nanoparticles (SiNP), and are prepared by utilizing the surface energy of the silicon nanoparticles and the ionic electrostatic action; the nano-particles can be prepared by the following method:

1) mixing OP-10, cyclohexane and ammonia water, stirring uniformly at room temperature, adding Tetraethoxysilane (TEOS), continuously stirring until polymerization is completed, adding acetone with the same volume, performing ultrasonic dispersion, centrifuging, washing with double distilled water for three times, centrifuging, collecting precipitate, drying at 80 ℃, and grinding to obtain silicon nanoparticles (SiNP). Wherein H₂O and OP-10 and H₂The molar ratio of O to TEOS is 2-10, the concentration of ammonia water is 1.6-28%, and the molar concentration of TEOS in cyclohexane is 0.1-3 mol/L.

2) Suspending SiNP in 0.1-10 mg/ml solution in 0.6M NaCO₃In the solution, carrying out ultrasonic dispersion, centrifuging, removing supernatant, then re-suspending the precipitate in PBS (pH 7.4) according to 0.1-10 mg/mL, carrying out ultrasonic dispersion, adding polylysine (the final concentration is 4-15 nmol/mL), fully mixing uniformly, and mixing and shaking at room temperature; centrifuging, discarding the supernatant, and suspending the precipitate in double distilled water to obtain the polylysine modified silicon nanoparticles. The final concentration of polylysine is 4-15 nmol/mL.

1) Ultrasonically dispersing the modified silicon nanoparticles, mixing the modified silicon nanoparticles with the RNA interference carrier targeting PVT1 in the embodiment 3 according to the mass ratio of 5-30: 1, and standing at room temperature to combine the modified silicon nanoparticles.

1.2 cell culture and transfection

The nasopharyngeal carcinoma cells with good growth state 5-8F, HK2 and HNE2 are arranged according to the ratio of 2x 10⁵The cells/well were seeded in 6-well plates, and the 6-well plates were placed at 37 ℃ with 5% CO₂In the incubator, the transfection of the PVT1 eukaryotic expression vector can be started when the cultured cells grow to 50-70% of the density; the transfection procedure was as follows:

adding 100 mul of prepared polylysine modified silicon nanoparticle suspension carrying PVT1 eukaryotic expression plasmid into a sterile EP tube, and gently and uniformly mixing with 100 mul of serum-free culture medium; washing the cells 3 times with D-Hank's solution; adding 800 μ l of serum-free medium (without antibiotics) into the mixture, gently mixing, and adding into 1 well of 6-well plate; place 6 well plate in CO₂The cells were incubated at 37 ℃ for 6 hours in an incubator, and then the supernatant was discarded and the cells were further incubated overnight with complete medium. Polylysine-modified silicon nanoparticles carrying a Scramble sequence were used as experimental controls.

1.3 radiotherapy sensitivity experiment 1-clonogenic

The effect of inhibiting PVT1 expression on the sensitivity of nasopharyngeal carcinoma to radiation therapy was confirmed by colony cloning. Nasopharyngeal carcinoma cells transfected with PVT1shRNA interference vector or control vector (scrambles) were inoculated in 6-well plates, irradiated with 0, 2, 4, 6, 8Gy of radiation, respectively, and then placed in an incubator for further 12 days, the medium was poured off, viable cells were stained with 0.5% crystal violet, photographed under a microscope, and the colony formation was observed and counted.

1.4 radiotherapy sensitivity experiment 2-detection of apoptosis

The induction of tumor cell apoptosis by radiation irradiation is the main reason for killing tumor cells by radiotherapy. Nasopharyngeal carcinoma cells transfected with PVT1shRNA interference vector or control vector (scrambles) are inoculated in a 6-well plate, after the cells are attached to the wall, 0 (equivalent to blank control) or 6Gy radiation irradiation is respectively given, the cells are digested after 48 hours, a fluorescent dye in an apoptosis detection kit (purchased from BD company) is used for co-incubation with the cells, and then the detection is carried out by a flow cytometer, and the apoptosis conditions of each group of cells are analyzed.

2. Results

2.1 introduction of interference vector of PVT1 into nasopharyngeal carcinoma cells to inhibit PVT1 makes the cells more sensitive to radiation

Clone formation experiments confirmed that the number of clones that survived and grew into cells after being irradiated with the same dose of radiation after the expression of PVT1 was inhibited by the transfer of an interference vector targeting PVT1 in the nasopharyngeal carcinoma cell lines CNE2 and 5-8F, indicating that the cells were more sensitive to radiation (FIG. 6).

2.2 introduction of interference vector of PVT1 into nasopharyngeal carcinoma cells to inhibit expression of PVT1, increase apoptosis ratio

After the nasopharyngeal carcinoma cell lines CNE2 and 5-8F are transferred into the interference vector targeting PVT1, the expression of PVT1 is inhibited, and the proportion of apoptotic cells is obviously increased (figure 7).

Sequence listing

<110> university of south-middle school

<120> application of reagent for detecting long-chain non-coding RNA PVT1 expression quantity in preparation of nasopharyngeal carcinoma prognostic reagent

<160>23

<170>SIPOSequenceListing 1.0

<210>1

<211>1957

<212>RNA

<213> Intelligent (Homo sapiens)

<400>1

cuccgggcag agcgcgugug gcggccgagc acaugggccc gcgggccggg cgggcucggg 60

gcggccggga cgaggagggg cgacgacgag cugcgagcaa agaugugccc cgggaccccc 120

ggcaccuucc aguggauuuc cuugcggaaa ggauguuggc ggucccugug accuguggag 180

acacggccag aucugcccuc cagccugauc uuuuggccag aaggagauua aaaagaugcc 240

ccucaagaug gcugugccug ucagcugcau ggagcuucgu ucaaguauuu ucugagccug 300

auggauuuac agugaucuuc aguggucugg ggaauaacgc ugguggaacc augcacugga 360

augacacacg cccggcacau uucaggauac uaaaaguggu uuuaagggag gcuguggcug 420

aaugccucau ggauucuuac agcuuggaug uccauggggg acgaaggacu gcagcuggcu 480

gagaggguug agaucucugu uuacuuagau cucugccaac uuccuuuggg ucucccuaug 540

gaauguaaga ccccgacucu uccuggugaa gcaucugaug cacguuccau ccggcgcuca 600

gcugggcuug agcugaccau acucccugga gccuucuccc gaggugcgcg ggugaccuug 660

gcacauacag ccaucaugau gguacuuuaa guggaggcug aaucaucucc ccuuugagcu 720

gcuuggcacg uggcucccuu gguguucccc uuuuacugcc aggacacuga gauuuggaga 780

gagucucacu cuguggucca ggcugaagua caguggcaug aucccagguc acugcaaccc 840

ccaccucccg gguucaagug auccuccugc cucagccucc cgaguagcug guauuacagg 900

cgugugccac aaagccuggc uaaguuuugu auuuuuagua gagacggggu uucaccaugu 960

uggccagguu ggucucgaac uccugaccuc aagugaucca cucacuuugg ccuuucaacg 1020

ugcugggauu acaggcgaga gucaccgcac ccggacgacu cugacauuuu ugaagagucc 1080

agaauccugu uacaccuggg auuuaggcac uuucaaucug aaaaaauaca uauccuuuca 1140

gcacucugga cggacuugag aacuguccuu acgugaccua aagcuggagu auuuugagau 1200

uggagaauua agagccaguc uuggugcucu guguucaccu gguucaucug aggagcugca 1260

ucuacccugc ccaugccaua gauccugccc uguuugcuuc uccuguugcu gcuaguggac 1320

augagaagga cagaauaacg ggcucccaga uucacaagcc ccaccaagag gaucacccca 1380

ggaacgcuug gaggcugagg aguucacuga ggcuacugca ucuugagacu caggaugaag 1440

acccagcuug gggcugucaa agaggccuga agaggcagaa caccccagag gagccugggg 1500

ccaccaccca gcaucacugu gggaaaacgg cagcaggaaa uguccucucg ccugcgugcu 1560

ccaccucggu ccacgccuuc ccuccuucug gaagccuugc cugaccacug gccugccccu 1620

ucuaugggaa ucacuacuga ccuugcagcu uauuauagac uuauauguuu uuugcauguc 1680

ugacacccau gacuccaccu ggaccuuaug gcuccaccca gaagcaauuc agcccaacag 1740

gaggacagcu ucaacccauu acgauuucau cucugcccca accacucagc agcaagcacc 1800

uguuaccugu ccacccccac cccuuccccc aaacugccuu ugaaaaaucc cuaaccuaug 1860

agcuuugaau aagaugagua cgaacuucau cgcccacgug gcguggccgg ccucgugucu 1920

auuaaauucu uuuucuacua aaaaaaaaaa aaaaaaa 1957

<210>2

<211>20

<212>DNA

<213> Unknown (Unknown)

<400>2

tggctgagag ggttgagatc 20

<210>3

<211>20

<212>DNA

<213> Unknown (Unknown)

<400>3

gctgtatgtg ccaaggtcac 20

<210>4

<211>20

<212>DNA

<213> Unknown (Unknown)

<400>4

accacagtcc atgccatcac 20

<210>5

<211>20

<212>DNA

<213> Unknown (Unknown)

<400>5

tccaccaccc tgttgctgta 20

<210>6

<211>34

<212>DNA

<213> Unknown (Unknown)

<400>6

ggtcggacta gaaaaccggt cttcctctaa tttt 34

<210>7

<211>30

<212>DNA

<213> Unknown (Unknown)

<400>7

gagactgtaa aaacttctca ggtcttagga 30

<210>8

<211>34

<212>DNA

<213> Unknown (Unknown)

<400>8

ctcataaaac tctaacctct taattctcgg tcag 34

<210>9

<211>30

<212>DNA

<213> Unknown (Unknown)

<400>9

ccactttacc agagttaaaa gcagccctgg 30

<210>10

<211>30

<212>DNA

<213> Unknown (Unknown)

<400>10

cagtagaggc agggatgatg ttctggagag 30

<210>11

<211>30

<212>DNA

<213> Unknown (Unknown)

<400>11

gtcagaggag accacctggt gctcagtgta 30

<210>12

<211>20

<212>DNA

<213> Unknown (Unknown)

<400>12

ggacttgaga actgtcctta 20

<210>13

<211>21

<212>DNA

<213> Unknown (Unknown)

<400>13

gcttctcctg ttgctgctag t 21

<210>14

<211>21

<212>DNA

<213> Unknown (Unknown)

<400>14

gctccaccca gaagcaattc a 21

<210>15

<211>19

<212>DNA

<213> Unknown (Unknown)

<400>15

gacacgcgac ttgtaccac 19

<210>16

<211>63

<212>DNA

<213> Unknown (Unknown)

<400>16

gatccccgga cttgagaact gtccttattc aagagagtaa ggacagttct caagtccttt 60

tta 63

<210>17

<211>64

<212>DNA

<213> Unknown (Unknown)

<400>17

gggcctgaac tcttgacagg aatgaagttc tctcattcct gtcaagagtt caggaaaaat 60

tcga 64

<210>18

<211>64

<212>DNA

<213> Unknown (Unknown)

<400>18

gatccccgct tctcctgttg ctgctagttt caagagaact agcagcaaca ggagaagctt 60

ttta 64

<210>19

<211>64

<212>DNA

<213> Unknown (Unknown)

<400>19

gggcgaagag gacaacgacg atcaaagttc tcttgatcgt cgttgtcctc ttcgaaaaat 60

tcga 64

<210>20

<211>64

<212>DNA

<213> Unknown (Unknown)

<400>20

gatccccgct ccacccagaa gcaattcatt caagagatga attgcttctg ggtggagctt 60

ttta 64

<210>21

<211>64

<212>DNA

<213> Unknown (Unknown)

<400>21

gggcgaggtg ggtcttcgtt aagtaagttc tctacttaac gaagacccac ctcgaaaaat 60

tcga 64

<210>22

<211>60

<212>DNA

<213> Unknown (Unknown)

<400>22

gatccccgac acgcgacttg taccacttca agagagtggt acaagtcgcg tgtcttttta 60

<210>23

<211>60

<212>DNA

<213> Unknown (Unknown)

<400>23

gggctgtgcg ctgaacatgg tgaagttctc tcaccatgtt cagcgcacag aaaaattcga 60

Claims (6)

1. The application of the reagent for detecting the expression quantity of the long-chain non-coding RNA PVT1 in the preparation of nasopharyngeal carcinoma prognostic reagents is disclosed, wherein the sequence of the long-chain non-coding RNA PVT1 is shown in SEQ NO: 1.

2. The use of claim 1, wherein the reagent for detecting the expression level of the long non-coding RNA PVT1 is an in situ hybridization detection reagent or a PCR detection reagent.

3. Use according to claim 2, characterized in that the oligonucleotide probes for detecting the expression of PVT1 by in situ hybridization:

PVT1 probe 1:

5’-GGTCGGACTAGAAAACCGGTCTTCCTCTAATTTT-3’；

PVT1 probe 2:

5’-GAGACTGTAAAAACTTCTCAGGTCTTAGGA-3’；

PVT1 probe 3:

5’-CTCATAAAACTCTAACCTCTTAATTCTCGGTCAG-3’。

4. the use of claim 2, wherein the positive control probe has the following sequence: GAPDH probe 1:

5 '-CCACTTTACCAGAGTTAAAAGCAGCCCTGG-3 '；

GAPDH probe 2:

5 '-CAGTAGAGGCAGGGATGATGTTCTGGAGAG-3 '；

GAPDH probe 3:

5 '-GTCAGAGGAGACCACCTGGTGCTCAGTGTA-3 '。

5. the use of claim 2, wherein the forward primer of PVT1 in the PCR assay reagent is 5'-TGGCTGAGAGGG TTG AGA TC-3' and the reverse primer is 5'-GCT GTATGTGCCAAGGTCAC-3'.

6. The use of claim 2, wherein the GAPDH forward primer used as a control in the PCR detection reagent is 5'-ACCACAGTCCATGCCATCAC-3' and the reverse primer is 5'-TCCACCACCCTGTTGCTGTA-3'.

Images