CN108048564B - New application of human GLT8D1 gene - Google Patents
New application of human GLT8D1 gene Download PDFInfo
- Publication number
- CN108048564B CN108048564B CN201810131431.XA CN201810131431A CN108048564B CN 108048564 B CN108048564 B CN 108048564B CN 201810131431 A CN201810131431 A CN 201810131431A CN 108048564 B CN108048564 B CN 108048564B
- Authority
- CN
- China
- Prior art keywords
- glt8d1
- gene
- human
- sequence
- schizophrenia
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a new application of human GLT8D1 gene, namely applying a human GLT8D1 gene expression level detection reagent in preparing a clinical diagnostic reagent for schizophrenia; and the low expression of the human GLT8D1 gene is applied to screening drugs for treating schizophrenia, and the experimental result shows that: GLT8D1 has a regulating effect on the proliferation, self-renewal and differentiation of neural stem cells in vitro; after the GLT8D1 gene is knocked down, the length, the number and the bifurcation number of the neurites of the neurons are obviously reduced compared with those of a control group; the knock-down of the GLT8D1 gene in neurons significantly altered the frequency of the mini excitatory postsynaptic current and the amplitude of the mini inhibitory postsynaptic current; this provides evidence that GLT8D1 is a risk gene for schizophrenia; the invention discloses that the GLT8D1 gene is a potential risk gene of schizophrenia for the first time, and provides a new biomarker for clinical diagnosis of schizophrenia.
Description
Technical Field
The invention relates to a new application of a gene, in particular to a new application of a human GLT8D1 gene.
Background
Schizophrenia is a serious mental disorder with a lifetime prevalence of between about 0.5 to 1% of people. It is usually slow or subacute in young and old, and is clinically manifested by positive symptoms (i.e. delusions and hallucinations), negative symptoms (i.e. apathy, impaired motivation, social withdrawal) and cognitive disorders (i.e. disordered thinking, impaired working memory and dysfunction in executive function), disorders related to multiple aspects of sensory perception, thinking, emotion and behavior, and uncoordinated mental activities. The patient is generally conscious and the intelligence is substantially normal. The course of disease is usually prolonged and repeated attacks, exacerbations or exacerbations occur. Schizophrenia is one of the most common mental diseases, and has high mortality rate and high long-term morbidity. The risk of suicide is high in schizophrenic patients, about 30% of whom attempt suicide and about 10% of whom die from suicide. Therefore, schizophrenia places a particularly large burden on government economy. The U.S. government spent approximately $ 627 million on schizophrenia patients during the year 2002 alone, including direct costs (such as outpatient, hospitalization, medication, and long-term care costs) and non-medical costs (such as law enforcement, reduced workplace productivity, and unemployment). Although the incidence of schizophrenia is high and poses a serious threat to global health, there is currently no effective treatment that can completely cure the disease. The main reason for this therapeutic arrest is that the cause of schizophrenia is not yet known. Although the understanding of the etiology is still unclear, the role of genetic factors, susceptibility factors of the individual psychology and adverse factors of the external social environment in the development of diseases has been well recognized. Whether genetic, predisposing or external adverse factors may act together through intrinsic biological factors to cause disease. The study on family, twin and recuperation control cases shows that schizophrenia has stronger genetic efficiency and the heritability is about 0.8. The results of existing studies show that schizophrenia accounts for the highest proportion of genetic factors in neuropsychiatric disorders, suggesting that genetic factors play a major role in the pathogenesis of schizophrenia. To elucidate the genetic basis of schizophrenia, researchers have conducted extensive genetic studies in various populations. Many candidate genes have been discovered through genetic linkage and association studies, but the heritability of schizophrenia has remained unclear to date.
Despite the great success of genome-associated studies (GWAS) in the study of schizophrenia, most of the schizophrenia risk variants discovered by GWAS are located in non-coding regions with no apparent subsequent function. Thus, the risk of how these susceptibility variations lead to schizophrenia remains largely unclear. To determine genes whose expression levels are affected by schizophrenia risk variation and to investigate the potential role of these genes in schizophrenia pathogenesis, we investigated co-expression patterns, spatio-temporal expression patterns, differential gene expression, relationship to human brain structure, and in vitro functional studies of candidate genes, etc. by integrating data from different levels, including genetic associations from large-scale GWAS (PGC2), brain eQTL, protein-protein interactions (PPI), schizophrenia patients and controls. Our combined analysis shows that the GLT8D1 gene may be a risk gene for schizophrenia.
Glycosyltransferases, which catalytically activate sugar chains in the body and attach them to different acceptor molecules, such as proteins, nucleic acids, oligosaccharides and lipids, are involved in the synthesis of sugar chains in active substances important in the body, such as glycoproteins and glycolipids, with high substrate specificity, and serve to transfer the monosaccharide moiety of the corresponding active donor (usually nucleoside diphosphate NDP-sugar) to sugars, proteins, lipids, nucleic acids, etc., to complete the glycosylation process of the latter and to perform its corresponding biological function. GLT8D1, glycosyltransferase 8 Domain 1, is a more complex glycosyltransferase than is common, with the increased C-terminal structure for recognition of unfolded protein (polypeptide) structures. It is present in most normal tissues of the human body, including brain tissue, where the function of GLT8D1 is unknown.
Disclosure of Invention
The invention aims to provide a new application of a human GLT8D1 gene, namely, a human GLT8D1 gene expression level detection reagent is applied to the preparation of a clinical diagnostic reagent for schizophrenia; the human GLT8D1 gene is used for schizophrenia related gene and is applied to schizophrenia detection, and the human GLT8D1 gene expression level detection reagent is a reagent for detecting low expression level of the human GLT8D1 gene, namely, the low expression level of the human GLT8D1 gene is used as a sign for diagnosing schizophrenia.
The human GLT8D1 gene expression level can be detected by designing a primer sequence of mRNA of human GLT8D1 by using a human GLT8D1 gene sequence and detecting the mRNA level of human GLT8D1 by a real-time quantitative PCR method; the primer sequence of the mRNA is as follows:
SEQ ID NO:1︰CGGAATGGAAACGACAGAAT；
SEQ ID NO:2︰GCGGACATTCCACATAGGAT。
aiming at the condition of low expression of GLT8D1 related to schizophrenia, the invention also aims to apply the low expression of the human GLT8D1 gene in screening drugs for treating schizophrenia.
Aiming at the phenotype of low expression of GLT8D1 in schizophrenia patients, the action target of neural stem cells in schizophrenia is an RNA interference action target.
The RNA interference target is selected from the following nucleotide sequences:
SEQ ID NO:3︰GATGATGATGTCATTGTACAA；
SEQ ID NO:4︰ACACACTATGTGGGAAGGTAA。
cloning shRNA sequence for inhibiting GLT8D1 gene expression into a lentiviral vector to obtain RNA interference lentivirus, and using the RNA interference lentivirus as a screening cell line for screening schizophrenia treatment drugs after infecting neural stem cells; the sequence for expressing shRNA comprises two inverted repeat sequences of target GLT8D1 gene coding DNA, and the middle of the inverted repeat sequences is separated by a stem-loop sequence; wherein, the two inverted repeat sequences are shRNA target sequences of the GLT8D1 gene and complementary sequences thereof respectively.
The sequence of the sense strand of the sequence for expressing the shRNA is shown as SEQ ID NO. 5, and the sequence of the antisense strand is shown as SEQ ID NO. 6; or the sequence of the sense strand is shown as SEQ ID NO. 7 and the sequence of the antisense strand is shown as SEQ ID NO. 8.
Forward oligo: GLT8D1 FO1（SEQ ID NO:5）
CCGGGATGATGATGTCATTGTACAACTCGAGTTGTACAATGACATCATCATCTTTTTG；
Reverse oligo: GLT8D1 RO1（SEQ ID NO:6）
AATTCAAAAAGATGATGATGTCATTGTACAACTCGAGTTGTACAATGACATCATCATC；
Or
Forward oligo: GLT8D1 FO2（SEQ ID NO:7）
CCGGACACACTATGTGGGAAGGTAACTCGAGTTACCTTCCCACATAGTGTGTTTTTTG；
Reverse oligo: GLT8D1 RO2（SEQ ID NO:8）
AATTCAAAAAACACACTATGTGGGAAGGTAACTCGAGTTACCTTCCCACATAGTGTGT；
We found that the human GLT8D1 gene is a risk gene for schizophrenia by integrating data from different levels, including genetic associations from large-scale GWAS (PGC2), brain eQTL, protein-protein interactions (PPI), co-expression patterns, spatio-temporal expression patterns, differential gene expression, relationship to human brain structure, etc., of schizophrenic patients and controls. Therefore, we found the sequence of human GLT8D1 from NCBI database, and the nucleotide sequence of human GLT8D1 gene is shown in genebank under the accession number ID: 76485, position 31001347..31012441 of Chromosome 14, NM-029626.2 of mRNA sequence, and 1719 of CDS region sequence.
We transfected shRNAs targeting GLT8D1 into Neural Stem Cells (NSCs) and observed their proliferative, self-renewing and differentiative capacity. We first evaluated the knockdown efficiency of the designed shRNA, and the real-time quantitative PCR and immunoblotting results showed that shRNAs reduced GLT8D1mRNA expression and protein expression, with a significant difference compared to the control (P < 0.05). Interestingly, the proliferation rate (the number of BrdU positive NSCs) of the GLT8D1 gene-knocked-down neural stem cells is also remarkably higher than that of a control group, and the expression mode of stem dryness-related genes of the GLT8D1 gene-knocked-down neural stem cells is analyzed, and the marker genes are found to be uniformly up-regulated after the GLT8D1 is knocked down; these results indicate that GLT8D1 plays an important regulatory role in the proliferation and growth of NSCs.
To verify the effect of GLT8D1 on neural stem cell differentiation, we performed experiments on neural stem cell differentiation, and found that TUJ1 (labeled differentiation early neurons), MAP2 (labeled mature neurons), GFAP (glial cell marker), and O in the GLT8D 1-knockdown group compared to the control group4The expression levels of (oligodendrocyte marker of) positive cells, and critical mrnas that regulate neural stem cell differentiation, such as NeuroD1, GFAP, oligo1 and oligo2, were significantly decreased, indicating that neural stem cells were impaired in their ability to differentiate. Further detecting related indexes of the GLT8D1 knock-down group neurons, the number, the length and the bifurcation number of the neurons are obviously reduced compared with those of the control group. These data indicate that GLT8D1 plays an important role in neural development by regulating the proliferation and differentiation of neural stem cells. GLT8D1 was first shown to play a positive role in the nervous system by regulating proliferation, self-renewal and differentiation of neural stem cells.
While the knock-down of GLT8D1 in neurons significantly changed the frequency of microstimulative postsynaptic current (mEPSC) and the amplitude of microstatic postsynaptic current (mlpc), suggesting that the involvement of GLT8D1 is required for normal synaptic transmission, suggesting that GLT8D1 has an important role in dendritic growth and synaptic transmission; GLT8D1 was first identified as a potential risk gene for schizophrenia.
In summary, the experimental results show that: GLT8D1 has a regulating effect on the proliferation, self-renewal and differentiation of neural stem cells in vitro; after the GLT8D1 gene is knocked down, the length, the number and the bifurcation number of the neurites of the neurons are obviously reduced compared with those of a control group; GLT8D1 was first shown to play a positive role in the nervous system by regulating proliferation, self-renewal and differentiation of neural stem cells. We have also found that: knock-down of GLT8D1 in neurons significantly changes the frequency of the mini excitatory post-synaptic current (mepscs) and the amplitude of the mini inhibitory post-synaptic current (mlpsc). Suggesting that normal synaptic transmission requires the involvement of GLT8D 1. Since the eSNPs of GLT8D1 are also associated with cognitive function, GLT8D1 may have an effect on cognitive function by modulating synaptic transmission. These results indicate that GLT8D1 plays an important role in regulating neurite development and in regulating synaptic transmission, providing evidence that GLT8D1 is a risk gene for schizophrenia. The invention discloses that the GLT8D1 gene is a potential risk gene of schizophrenia for the first time, and provides a new biomarker for clinical diagnosis of schizophrenia.
The invention defines the relevance of the expression of GLT8D1 and schizophrenia; and establishes a cell strain which can be used for screening the schizophrenia treatment drug and has greater application value and prospect.
Drawings
FIG. 1 shows that human GLT8D1 is significantly less expressed in hippocampal region of schizophrenic patients than in normal population; panel a is the hippocampus, panel b is the prefrontal cortex, and panel c is the striatum.
FIG. 2 is a schematic diagram showing the identification of GLT8D1 knockdown stable transformants; graph a is the result of real-time quantitative PCR, and graph b is the result of protein detection;
FIG. 3 is a graph showing the results of promoting proliferation of neural stem cells after knocking down human GLT8D 1; panel a is the result of immunofluorescence staining, and panel b is the quantitative result of immunofluorescence in panel a;
FIG. 4 is a schematic diagram showing the results of the expression of markers related to dryness promotion of neural stem cells after human GLT8D1 is knocked down; the expression of Klf4 (a), Sox2(b), Nanog (c) and nestin (d) was detected;
FIG. 5 is a graph showing the results of inhibition of neural stem cell differentiation after human GLT8D1 knockdown; panel a shows the results of Tuj1 (early differentiation neuron marker) immunofluorescence, and panel b shows the quantitative results of immunofluorescence in panel a; panel c shows the immunofluorescence results of O4 (oligodendrocyte marker), and panel d shows the quantitative results of the immunofluorescence in panel c; the e-diagram shows the result of GFAP (astrocyte marker) immunofluorescence, and the f-diagram shows the quantitative result of immunofluorescence in the e-diagram;
FIG. 6 is a schematic diagram of the detection of mRNA level of a marker related to the inhibition of neural stem cell differentiation after the knock-down of human GLT8D 1; mRNA levels of Neurod1 (a), Gfap (b), Oligo1 (c) and Oligo2(d) were measured;
FIG. 7 is a schematic diagram showing the results of the inhibition of neural stem cell differentiation into neurons after human GLT8D1 knockdown; graph a shows the immunofluorescence results of MAP2 (late differentiation neuron marker), and graph b shows the quantitative results of the immunofluorescence in graph a. The c picture is an enlarged view of the immunofluorescence result of MAP2, and the d, e and f pictures are quantitative results of the number (d), the length (e) and the bifurcation (f) of the immunofluorescence neuron dendrites in the c picture respectively;
FIG. 8 is a graph showing the effect on postsynaptic current following knockdown of human GLT8D 1; a is a graph of frequency and amplitude of micro excitatory postsynaptic current (mepscs) and quantitative results; b is a frequency and amplitude diagram and quantitative results of a miniature inhibitory postsynaptic current (mIPSC);
FIG. 9 is a schematic view showing a process for discovering that the human GLT8D1 gene is a risk gene of schizophrenia;
FIG. 10 shows the expression of human GLT8D1 with human GLT8D1 primer.
Detailed Description
The present invention is further illustrated in detail by the following examples, but the scope of the present invention is not limited to the above-described contents, and the methods in the examples are conventional methods unless otherwise specified, and reagents used therein are conventional commercially available reagents or reagents prepared by conventional methods unless otherwise specified.
Example 1: to determine the risk that changes in gene expression might confer schizophrenia, we systematically integrated the data of the quantitative trait locus (eQTL) of brain expression of the gene-associated signals in GWAS (PGC2) of schizophrenia, which was the largest to date, using a Bayesian statistical framework (sherlock); we identified 10 potential genes susceptible to schizophrenia, the expression of which may lead to schizophrenia. To further screen the most likely candidate genes, we performed comprehensive analyses including spatio-temporal expression pattern analysis, protein-protein interaction (PPI) analysis, co-expression analysis, differential expression analysis, etc.; we validated our findings using independent brain eQTL data and comprehensive analysis method (SMR); the specific process is shown in fig. 9, the results after comprehensive analysis are shown in fig. 1, and the expression of human GLT8D1 in the hippocampal region of schizophrenic patients is significantly lower than that of the normal population.
Example 2: isolation and culture of mouse neural stem cells
Neural stem cells were isolated from embryonic stage 14-day-old fetal rat brain tissue and cultured in serum-free growth medium (DMEM/F12) containing 20ng/mL of Epidermal Growth Factor (EGF), 20ng/mL of fibroblast growth factor (BFGF), 1% of penicillin/streptavidin, 1XN2, 1XB27 and 10. mu.g/mL of heparin.
Example 3: establishment of Steady transgenic knockdown cell lines
Cloning shRNA sequence for inhibiting GLT8D1 gene expression into a lentiviral vector to obtain RNA interference lentivirus, and using the RNA interference lentivirus as a screening cell line for screening schizophrenia treatment drugs after infecting neural stem cells; the sequence for expressing shRNA comprises two inverted repeat sequences of target GLT8D1 gene coding DNA, and the middle of the inverted repeat sequences is separated by a stem-loop sequence; wherein, the two inverted repeat sequences are shRNA target sequences of the GLT8D1 gene and complementary sequences thereof respectively.
The sequence of the sense strand of the sequence for expressing the shRNA is shown as SEQ ID NO. 5, and the sequence of the antisense strand is shown as SEQ ID NO. 6; or the sequence of the sense strand is shown as SEQ ID NO. 7 and the sequence of the antisense strand is shown as SEQ ID NO. 8.
Forward oligo: GLT8D1 FO1（SEQ ID NO:5）
CCGGGATGATGATGTCATTGTACAACTCGAGTTGTACAATGACATCATCATCTTTTTG；
Reverse oligo: GLT8D1 RO1（SEQ ID NO:6）
AATTCAAAAAGATGATGATGTCATTGTACAACTCGAGTTGTACAATGACATCATCATC；
Or
Forward oligo: GLT8D1 FO2（SEQ ID NO:7）
CCGGACACACTATGTGGGAAGGTAACTCGAGTTACCTTCCCACATAGTGTGTTTTTTG；
Reverse oligo: GLT8D1 RO2（SEQ ID NO:8）
AATTCAAAAAACACACTATGTGGGAAGGTAACTCGAGTTACCTTCCCACATAGTGTGT；
We constructed interfering RNA (shRNAs) aiming at GLT8D1 by using pLKO.1 vector and carried out sequence verification on the interfering RNA (shRNAs). The length of the target sequence is 21 bp: GLT8D1-shRNA # 1, GATGATGATGTCATTGTACAA; GLT8D1-shRNA # 2, ACACACTATGTGGGAAGGTAA; the control shRNA sequences were: GCACTACCAGAGCTAACTCAG, respectively; packaging lentivirus by transfection according to instructions; 72h after viral infection, NSCs were treated with puromycin (1. mu.g/mL) and selected for NSCs that stably expressed the indicator shRNA.
Example 4: real-time quantitative PCR detection of knock-out efficiency
1. Total RNA extraction from cells
(1) When the growth state of the neural stem cells is good, removing the supernatant, washing the serum with PBS, adding 1mL of Trizol, standing for 5 minutes to ensure that the Trizol can fully crack the cells, blowing the cells off from a culture dish, transferring the liquid into a centrifugal tube, and repeatedly blowing until no obvious large-block precipitate exists; standing at room temperature for 5 min;
(2) the 4 ℃ centrifuge is opened in advance, 12,000g is centrifuged for 5min, and the supernatant is transferred to a new 1.5mL centrifuge tube;
(3) adding 200 μ L chloroform, shaking with a vortex apparatus, centrifuging at 12,000g for 15min in a 4 deg.C centrifuge, and separating the liquid into three layers;
(4) sucking the upper aqueous phase (paying attention not to touch the middle protein layer), and transferring into a new centrifuge tube of RNAase free;
(5) adding isopropanol with the same volume, gently turning upside down for 5 times, and standing at room temperature for 10 min;
(6) centrifuging at 12,000rpm at 4 deg.C for 10min to obtain white precipitate;
(7) discarding the supernatant, adding 1mL of 75% ethanol treated by DEPC, and reversing the mixture from top to bottom for several times to wash and precipitate; 7500g, centrifuging for 5 minutes, discarding the supernatant and keeping the precipitate;
(8) drying RNA at room temperature for 10min, and adding RNase-free water for dissolving;
(9) OD was measured to determine the concentration and quality of RNA, which was then stored at-80 ℃.
2. Reverse Transcription Reaction (RT)
Mu.g of the RNA extracted above was reverse transcribed using TAKARA kit as follows: removing genome DNA, preparing a reaction mixed solution on ice according to the following components, subpackaging the reaction mixed solution into each reaction tube, and finally adding an RNA sample; mixing gently, and reacting at 42 deg.C for 2min (or 5min at room temperature);
after the reaction, the sample is placed on ice, mixed Mix is prepared according to the following table, and then 10 mu L of mixed Mix is subpackaged into each reaction tube;
and (3) carrying out reverse transcription reaction immediately after soft and uniform mixing: 15min at 37 ℃, 5s at 85 ℃ and 4 ℃.
3、 qPCR
Three replicate wells were set for each sample, formulated as follows:
mixing the above components, adding into each hole of a 96-well plate, sealing membrane, centrifuging to collect liquid at the bottom of the tube; the PCR reaction was performed according to the following conditions, with the thermal cycling parameters as follows: at 50 ℃ for 2 min; at 95 ℃ for 2 min; at 95 ℃ for 10 min; 95 ℃, 15 s, 60 ℃ for 1 min, 40X.
The primers used are shown in the following table:
among them, GAPDH was used as an internal control.
The results are shown in FIG. 2a, FIG. 4, FIG. 6; the mRNA level of GLT8D1 in the GLT8D1 knockdown cell line was significantly reduced (fig. 2 a), the markers associated with neural stem cell sternness were significantly increased (fig. 4), and the markers associated with neural stem cell differentiation were significantly reduced (fig. 6).
Simultaneously, the mRNA level of GLT8D1 is detected in a human brain cell line, and the primers of SEQ ID NO. 1 and SEQ ID NO. 2 are proved to be practical and effective; the results are shown in FIG. 10.
Example 5: protein immunoblotting (Western Blot) for detecting expression of GLT8D1 protein
1. WB (Western blot) detection
1.1 extraction of Total protein from neural Stem cells
Removing a supernatant culture medium of the neural stem cells treated according to a specific experiment, and washing the neural stem cells for 1 time by using PBS (phosphate buffer solution); adding corresponding cell lysis solution according to the amount of cell precipitation, and repeatedly freezing and thawing for 2 times; centrifuging at 12000 rpm for 10min at 4 deg.C, collecting supernatant, and discarding precipitate for subsequent experiment.
1.2 protein concentration detection and denaturation treatment
The protein concentration detection kit is a Biyuntian BCA protein concentration determination kit (enhanced type), and the cargo number is as follows: P0010S; the method comprises the following steps:
adding the standard substance into standard substance wells of a 96-well plate according to 0, 1, 2, 4, 8, 12, 16 and 20 muL, and adding the standard substance diluent to make up to 20 muL so that the concentrations of the standard substance are 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4 and 0.5 mg/mL respectively; adding an appropriate volume of protein sample to the sample wells of a 96-well plate; adding 200 mu L of BCA working solution into each hole, and standing at 37 ℃ for 20 min; measuring absorbance of A562 wavelength by using a microplate reader; the protein concentration of the sample was calculated from the standard curve and the sample volume used.
Taking a proper amount of protein sample, adding 5 times of loading buffer solution, and placing in a metal dry heat instrument at 100 ℃ for boiling for 5 min; taking out, cooling, subpackaging, and storing at-80 deg.C or directly performing SDS-PAGE (polyacrylamide gel) electrophoresis.
1.3 SDS-polyacrylamide gel electrophoresis
(1) Cleaning a glass plate for preparing gel by electrophoresis, drying and fixing on a gel preparation frame; preparing 8-12% of separation gel with different concentrations according to the requirements, adding the concentrated gel according to the formula after the gel is fully solidified, and inserting the gel into a sample groove comb; after the gel is solidified, taking out the gel, pulling out the comb, and cleaning the surface gel with distilled water; fixing the glass plate and the gel on an electrophoresis frame, and adding Tris-glycine electrophoresis buffer solution to ensure that the electrophoresis buffer solution is about 0.5 cm above the short glass plate; adding 30-50 μ g of protein into each well, performing electrophoresis at 80V for running out concentrated gel, and performing electrophoresis at 120V; placing the film transferring frame in the film transferring liquid, placing a sponge pad above the black surface, and placing a piece of filter paper above the sponge pad, wherein the black plastic plate is downward and white; gently taking the gel off the electrophoresis glass plate, putting the gel on filter paper, putting the PVDF film above the gel, putting the filter paper, putting a sponge pad above the filter paper, firmly fixing the black plastic plate and the white plastic plate, and putting the black plastic plate and the white plastic plate into the pre-cooled membrane conversion buffer solution; under the ice-bath condition, the film is rotated for 3 h at 83V voltage; putting the PVDF membrane into TBST containing 5% skimmed milk powder, slowly shaking on a shaking table, and sealing at room temperature for 2 h; adding primary antibody diluted by TBST containing 5% skimmed milk powder, and incubating Rabbit anti-GLT8D1 (1:500, Absin abs128289a) at 4 deg.C under slow shaking overnight; washing membrane with TBST for 10min × 3 times; adding HRP-labeled secondary antibody (anti-rabbit 1:2000 dilution), and incubating for 2h at room temperature; washing membrane with TBST for 10min × 3 times; ECL reagent is added under the condition of keeping out of the light, and the PVDF membrane is transferred to a luminous plate for photographing after developing.
The results are shown in fig. 2b, expression of GLT8D1 protein in knockdown cell lines; cell lysates were assayed for expression of GLT8D1 and GAPDH, respectively, as controls; the experimental result shows that compared with the control cell, the expression of GLT8D1 protein in the knockdown stable transfer cell is obviously reduced.
Example 6: BrdU incorporation experiments
When the neural stem cells stably knocking down GLT8D1 grow to 80% coverage, removing supernatant, washing serum with PBS, digesting with 0.05% pancreatin 1mL for 5 minutes, terminating the culture medium, blowing to obtain single cell suspension, counting with a Countstar cell counter, and counting according to 500 uL 5 × 10 per well4The total amount of cells (c) was seeded in 8-well plates and placed at 37 ℃ in 5% CO2Carbon dioxide incubator overnight, after 24 hoursAdding BrdU (final concentration is 10 mu M) to incubate in an incubator, taking out the incubator after 20min, removing the culture medium, and rinsing the incubator once with PBS; fixing with 200 μ L of 4% Paraformaldehyde (PFA), washing with PBS once after 20min, adding 200 μ L of 2N HCl-0.5% TrionX-100, incubating at room temperature, adding 1M NaHCO after 30 min3Rinsed once and then discarded, rinsed twice with 200 μ L PBS +0.1% tween 20, after removal of residual liquid 200 μ L of 10% normal goat serum (NGS, diluted with PBS +0.1% tween 20) was added, shaken for 1 hour at room temperature, BrdU primary antibody with PBS +0.1% tween 20 + NGS (final concentration of 5%), according to the antibody specification of 1:1000, each well of 200 u L, 4 degrees C were incubated overnight, each well of 200 u L PBS +0.1% tween 20 washing three times, each 10 minutes, the secondary antibody CY 3-coat anti mouse (genus according to primary antibody) was then diluted with the primary antibody diluent, adding DAPI at a ratio of 1:500 and 1:100, shaking at room temperature for 2 hr, add 200. mu.L PBS +0.1% tween 20 per well and wash three times for 10min each, and place in PBS + NaN.3At medium temperature, the cells were stored at 4 ℃ and photographed and counted by a fluorescence microscope. The proliferation level of the cells was quantified in a double-blind manner using Image J software and t-test. P<0.001
The results showed that incorporation of BrdU in the stably transfected GLT8D1 knockdown cell line was significantly increased compared to the control (see FIGS. 3a, b).
Example 7: non-directional differentiation experiment of GLT8D1 knockdown neural stem cells
The cells were fixed after culturing for 72 hours in a differentiation medium, i.e., DMEM/F12 containing 1% penicillin/streptavidin, supplemented with 1XN-2 (Gibco), 1XB27(Gibco) and 10. mu.g/mL heparin (10. mu.g/mL). Immunocytochemical staining was as described previously. Blocking the cells with PBS containing 5% parts of normal goat serum and 0.1% Tween-20 for 30 min, and mixing with Tuj1 (1: 1000, Sigma, T8578), GFAP (1: 1000, DAKO, Z0334), O, respectively4(1：1000，R&D system, MAB1326), MAP2 (1: 1000, Millibus, AB 5622). Incubated with goat anti-mouse antibody or goat anti-rabbit Cy3 antibody (1:500, Abclonal) and then stained with the fluorescent nuclear dye 4 ', 6-dimidano-2' -phenylcycloindole dihydrochloride (DAPI, Sigma, D3571). ImageJ software for Tuj1 and GFAP、O4MAP2 cell number was quantified and statistically analyzed by t-test. Dendritic length, number and dendritic complexity (bifurcations) were measured using Image-pro plus 6.0 analysis. 60 neurons of the control group and the experimental group were measured, respectively; all experiments were performed in triplicate, with at least three replicates per group. Data are presented as mean ± SEM. When the P value is less than 0.05, the difference is statistically significant. P<0.05, **p<0.01,***p<0.001,t-test；
From the experimental results, the neural stem cell differentiation capacity of the stably transformed cell strain with the knocked-down GLT8D1 is obviously reduced compared with that of the cells in the control group. The differentiation into neurons (FIG. 5a, b; FIG. 7a, b), glial cells (FIG. 5e, f) or oligodendrocytes (FIG. 5c, d) was less than that of the control cells. The number of neurites (FIG. 7c, d), length (FIG. 7c, e) and complexity (FIG. 7c, f) of the differentiated neuronal cells were also significantly lower than those of the control cells.
Example 8:
we recorded the electrophysiology of neurons, primary hippocampal neurons from neonatal mice within 0-24 h. Calcium phosphate method was used to transfect DIV (in vitro culture) 10 generation cells, each 8mm diameter, 0.5. mu.g plasmid (GFP-pLKO.1 shRNA) and 0.992. mu.l 2M CaCl in 48 well plates2Mixing, pre-mixed DNA/CaCl2The solution was added to 8. mu.l of 2 × HBS. DNA/CaCl2The HBS mixture was incubated at room temperature for 30 min, added to the cultured hippocampal neurons, and incubated in the incubator for 30 min (5% CO)2At 37 ℃ C. Before electrophysiological recording, 10 mM MgCl was used2The neuron culture solution is washed for 15min and cultured for 4 days. Whole cell patch clamp recordings were as described previously. With a solution containing 145 mM KCl, 1 mM MgCl2、5 mM NaCl、5 mM EGTA、0.3 mM Na2A solution of GTP, 4 mM MgATP, 5 mM QX-314 and 10 mM HEPES was filled into the pipette. Neurons were cultured in a medium containing 4 mM KCl, 150 mM NaCl, 2 mM CaCl2、1 mM MgCl 210 mM HEPES and 10 mM glucose. Signals were amplified and collected using multiclad 700B and pCLAMP 10.0(Molecular Devices, Sunnyvale, CA, USA). Using ClampData were analyzed by fit 9.02(Molecular Devices, Sunnyvale, Calif., USA), Igor 4.0(Wavemetrics, Portland, US) and GraphPad Prism 5(GraphPad Software, La Jolla, Calif., USA). P<0.05, **p<0.01,***p<0.001,t-test。
The results are shown in fig. 8, from which it is seen that the frequency of the mini excitatory postsynaptic current (mEPSC) and the magnitude of the mini inhibitory postsynaptic current (mlpc) are significantly increased after knockdown of GLT8D1 compared to the control group.
Sequence listing
<110> Kunming animal research institute of Chinese academy of sciences
New application of <120> human GLT8D1 gene
<160> 28
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence (Artificial)
<400> 1
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence (Artificial)
<400> 2
gcggacattc cacataggat 20
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence (Artificial)
<400> 3
gatgatgatg tcattgtaca a 21
<210> 4
<211> 21
<212> DNA
<213> Artificial sequence (Artificial)
<400> 4
acacactatg tgggaaggta a 21
<210> 5
<211> 58
<212> DNA
<213> Artificial sequence (Artificial)
<400> 5
ccgggatgat gatgtcattg tacaactcga gttgtacaat gacatcatca tctttttg 58
<210> 6
<211> 58
<212> DNA
<213> Artificial sequence (Artificial)
<400> 6
aattcaaaaa gatgatgatg tcattgtaca actcgagttg tacaatgaca tcatcatc 58
<210> 7
<211> 58
<212> DNA
<213> Artificial sequence (Artificial)
<400> 7
ccggacacac tatgtgggaa ggtaactcga gttaccttcc cacatagtgt gttttttg 58
<210> 8
<211> 58
<212> DNA
<213> Artificial sequence (Artificial)
<400> 8
aattcaaaaa acacactatg tgggaaggta actcgagtta ccttcccaca tagtgtgt 58
<210> 9
<211> 19
<212> DNA
<213> Artificial sequence (Artificial)
<400> 9
cacagatgca accgatgca 19
<210> 10
<211> 18
<212> DNA
<213> Artificial sequence (Artificial)
<400> 10
ggtgccctgc tgcgagta 18
<210> 11
<211> 22
<212> DNA
<213> Artificial sequence (Artificial)
<400> 11
cacacaggcg agaaacctta cc 22
<210> 12
<211> 16
<212> DNA
<213> Artificial sequence (Artificial)
<400> 12
cggagcgggc gaattt 16
<210> 13
<211> 20
<212> DNA
<213> Artificial sequence (Artificial)
<400> 13
<210> 14
<211> 21
<212> DNA
<213> Artificial sequence (Artificial)
<400> 14
tgctgagccc ttctgaatca g 21
<210> 15
<211> 20
<212> DNA
<213> Artificial sequence (Artificial)
<400> 15
ccagagctgg actggaactc 20
<210> 16
<211> 20
<212> DNA
<213> Artificial sequence (Artificial)
<400> 16
<210> 17
<211> 20
<212> DNA
<213> Artificial sequence (Artificial)
<400> 17
<210> 18
<211> 20
<212> DNA
<213> Artificial sequence (Artificial)
<400> 18
<210> 19
<211> 20
<212> DNA
<213> Artificial sequence (Artificial)
<400> 19
<210> 20
<211> 20
<212> DNA
<213> Artificial sequence (Artificial)
<400> 20
<210> 21
<211> 20
<212> DNA
<213> Artificial sequence (Artificial)
<400> 21
ctggtgtcta gtcgcccatc 20
<210> 22
<211> 20
<212> DNA
<213> Artificial sequence (Artificial)
<400> 22
<210> 23
<211> 20
<212> DNA
<213> Artificial sequence (Artificial)
<400> 23
<210> 24
<211> 20
<212> DNA
<213> Artificial sequence (Artificial)
<400> 24
<210> 25
<211> 20
<212> DNA
<213> Artificial sequence (Artificial)
<400> 25
<210> 26
<211> 20
<212> DNA
<213> Artificial sequence (Artificial)
<400> 26
<210> 27
<211> 26
<212> DNA
<213> Artificial sequence (Artificial)
<400> 27
ctcaactaca tggtctacat gttcca 26
<210> 28
<211> 20
<212> DNA
<213> Artificial sequence (Artificial)
<400> 28
Claims (5)
1. Application of human GLT8D1 gene expression level detection reagent in preparation of schizophrenia clinical diagnosis reagent.
2. Use according to claim 1, characterized in that: the reagent for detecting the expression level of human GLT8D1 gene is a reagent for detecting the low expression level of human GLT8D1 gene.
3. Use according to claim 2, characterized in that: the detection of the expression level of the human GLT8D1 gene comprises the steps of designing a primer sequence of mRNA of human GLT8D1 by utilizing a human GLT8D1 gene sequence, and detecting the level of the mRNA of human GLT8D1 by a real-time quantitative PCR method; the primer sequence of the mRNA is as follows:
SEQ ID NO:1︰CGGAATGGAAACGACAGAAT；
SEQ ID NO:2︰GCGGACATTCCACATAGGAT。
4. a method for screening a drug for treating schizophrenia with the low expression of GLT8D1 gene as a screening target, which comprises the steps of: cloning shRNA sequence for inhibiting GLT8D1 gene expression into a lentiviral vector to obtain RNA interference lentivirus, and using the RNA interference lentivirus as a screening cell line for screening schizophrenia treatment drugs after infecting neural stem cells; the sequence for expressing shRNA comprises two inverted repeat sequences of target GLT8D1 gene coding DNA, and the middle of the inverted repeat sequences is separated by a stem-loop sequence; wherein, the two inverted repeat sequences are shRNA target sequences of GLT8D1 gene and complementary sequences thereof respectively; the shRNA target nucleotide sequence of the GLT8D1 gene is selected from the following nucleotide sequences:
SEQ ID NO:3︰GATGATGATGTCATTGTACAA；
SEQ ID NO:4︰ACACACTATGTGGGAAGGTAA。
5. use according to claim 4, characterized in that: the sequence of the sense strand of the sequence for expressing the shRNA is shown as SEQ ID NO. 5, and the sequence of the antisense strand is shown as SEQ ID NO. 6; or the sequence of the sense strand is shown as SEQ ID NO. 7, and the sequence of the antisense strand is shown as SEQ ID NO. 8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810131431.XA CN108048564B (en) | 2018-02-09 | 2018-02-09 | New application of human GLT8D1 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810131431.XA CN108048564B (en) | 2018-02-09 | 2018-02-09 | New application of human GLT8D1 gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108048564A CN108048564A (en) | 2018-05-18 |
| CN108048564B true CN108048564B (en) | 2021-03-05 |
Family
ID=62125154
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810131431.XA Active CN108048564B (en) | 2018-02-09 | 2018-02-09 | New application of human GLT8D1 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108048564B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111529690B (en) * | 2020-06-17 | 2023-03-31 | 中国科学院昆明动物研究所 | New application of human CD133 protein 1-108 peptide fragment |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103502473A (en) * | 2011-03-01 | 2014-01-08 | 耶鲁大学 | Predicting gastroenteropancreatic neuroendocrine neoplasms (GEP-NENs) |
| CN107208132A (en) * | 2014-09-15 | 2017-09-26 | 克里夫顿生命科学有限责任公司 | Composition, method and kit for diagnosing stomach and intestine pancreas neuroendocrine tumors |
-
2018
- 2018-02-09 CN CN201810131431.XA patent/CN108048564B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103502473A (en) * | 2011-03-01 | 2014-01-08 | 耶鲁大学 | Predicting gastroenteropancreatic neuroendocrine neoplasms (GEP-NENs) |
| CN107208132A (en) * | 2014-09-15 | 2017-09-26 | 克里夫顿生命科学有限责任公司 | Composition, method and kit for diagnosing stomach and intestine pancreas neuroendocrine tumors |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108048564A (en) | 2018-05-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Huang et al. | Uncovering the functional link between SHANK3 deletions and deficiency in neurodevelopment using iPSC-derived human neurons | |
| Sun et al. | c-Jun NH2-terminal kinase (JNK)-interacting protein-3 (JIP3) regulates neuronal axon elongation in a kinesin-and JNK-dependent manner | |
| Kawauchi et al. | Extra‐cell cycle regulatory functions of cyclin‐dependent kinases (CDK) and CDK inhibitor proteins contribute to brain development and neurological disorders | |
| McGowan et al. | hsa-let-7c miRNA regulates synaptic and neuronal function in human neurons | |
| Villanueva-Paz et al. | Pathophysiological characterization of MERRF patient-specific induced neurons generated by direct reprogramming | |
| Perera et al. | Defective neuronogenesis in the absence of Dlx5 | |
| Li et al. | Deficiency of TRPM2 leads to embryonic neurogenesis defects in hyperthermia | |
| Yang et al. | Mir505–3p regulates axonal development via inhibiting the autophagy pathway by targeting Atg12 | |
| Deng et al. | Let-7f promotes the differentiation of neural stem cells in rats | |
| Xue et al. | BDNF promotes neuronal survival after neonatal hypoxic-ischemic encephalopathy by up-regulating Stx1b and suppressing VDAC1 | |
| Jia et al. | Effects on Autophagy of Moxibustion at Governor Vessel Acupoints in APP/PS1double‐Transgenic Alzheimer’s Disease Mice through the lncRNA Six3os1/miR‐511‐3p/AKT3 Molecular Axis | |
| CN108048564B (en) | New application of human GLT8D1 gene | |
| Li et al. | CRISPRi-based screens in iAssembloids to elucidate neuron-glia interactions | |
| WO2017219062A1 (en) | Methods for differentiating cells into cells with a muller cell phenotype, cells produced by the methods, and methods for using the cells | |
| Pulcrano et al. | miR-218 promotes dopaminergic differentiation and controls neuron excitability and neurotransmitter release through the regulation of a synaptic-related genes network | |
| Lin et al. | Loss-of-function mutation in human Oxidation Resistance gene 1 disrupts the spatial-temporal regulation of histone arginine methylation in early brain development | |
| Czerminski | Modeling down syndrome neurodevelopment with dosage compensation | |
| Moissidis | Molecular mechanisms regulating the maturation of cortical interneurons | |
| Van Gulden | Molecular Diversity in Human Pluripotent Stem Cell Derived Astrocyte Progenitors and Their Association with Subtypes of Glioblastoma | |
| 김민정 | Studies on de novo DSCAM mutation from autism spectrum disorder patient using neurons induced from iPSC | |
| Wang | Neuronal Conversion of Human Glioblastoma Cells by Single Neuronal Transcription Factor | |
| Han | Proneural Genes; Old Players with New Functions in Controlling Neocortical Neural Progenitor Cell Behaviour | |
| Hamze et al. | Altered NRG1/ErbB4 signaling and cholesterol metabolism dysregulation are key pathomechanisms in VRK1-related motor neuropathies and motor neuron diseases | |
| Ferreira | Direct Conversion of Human Skin Fibroblasts into induced Neurons: A Model to Study Age-Related Synaptic Dysfunctions | |
| Honorato Ribeiro et al. | A human-specific, concerted repression of microcephaly genes contributes to radiation-induced growth defects in forebrain organoids |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |