CN108048540B - Method for preparing fingerprint atlas database for detecting vibrio cholerae typing - Google Patents

Abstract

The invention discloses a preparation method of a vibrio cholerae fingerprint atlas database, which comprises the following steps: designing specific primers corresponding to the conserved sequences; performing multiplex amplification on the genomic DNA; purifying the multiple PCR products; detecting the purified product by a mass spectrometer to obtain characteristic nucleic acid fingerprint spectrums of different vibrio cholerae; and summarizing and sorting the nucleic acid fingerprint characteristic maps of different isolates obtained in the step through computer software to obtain the standard nucleic acid fingerprint characteristic map of the vibrio cholerae. Based on the method, a nucleic acid fingerprint database of common vibrio cholerae is established, and the classification of the vibrio cholerae in the fields of environmental sanitation, food safety detection, public place safety, import and export inspection and quarantine and the like can be identified so as to maintain the public health safety.

Description

Method for preparing fingerprint atlas database for detecting vibrio cholerae typing

Technical Field

The invention belongs to the field of molecular biology detection, and relates to a preparation method for rapidly identifying a vibrio cholerae fingerprint atlas database by using a time-of-flight mass spectrometry technology.

Background

Cholera is a virulent infectious disease with diarrhea as a main symptom caused by Vibrio cholerae (Vibrio cholerae), and is classified as a class a infectious disease in China. The cholera vibrio enters the digestive tract to reach the small intestine, and is adsorbed and rapidly propagated on the surface of the intestinal mucosa, and the generated cholera enterotoxin acts on the intestinal mucosa to cause the excessive secretion of intestinal juice. Severe cases show vomiting and diarrhea, leading to dehydration and metabolic acidosis, circulatory failure, and even shock and death. In addition to the need of strengthening the detection of Vibrio cholerae clinically, the typing and identification of Vibrio cholerae are also needed in the aspects of food safety (such as meat product processing and barbecue stores), environmental sanitation (such as logistics places of school institutions), import and export inspection and quarantine and public place safety to maintain public health and safety.

The research finds that the vibrio cholerae is a gram-negative bacterium and is divided into 139 serogroups, wherein the O1 group and the O139 group can cause cholera. The pathogenic factors of vibrio cholerae mainly comprise 3 CTX gene elements (wherein the CTX gene codes cholera enterotoxin), TCP pathogenic island (codes TCP pilus) and toxR (virulence regulating gene, genes for regulating and coding CT and TCP). Cholera enterotoxin (CT), also known as cholera toxin, is an exotoxin with strong antigenicity and has a fairly high conservation of the cholera toxin gene (ctx).

In order to prevent the occurrence and prevalence of cholera, measures are rapidly taken, the development and spread of epidemic situations are effectively controlled, and the rapid detection of vibrio cholerae is particularly important. For a long time, the identification of Vibrio cholerae adopts the traditional microbiological detection method, namely the morphological, physiological and biochemical characteristics and serological identification. Although the method has high accuracy, the required time is too long and can be finished within ten and several hours at the fastest speed, and the requirement of quick detection is difficult to adapt. The nucleic acid detection method based on the multiplex PCR has important significance for the early diagnosis of cholera and the discovery of infection sources. And the multiple PCR detection aims at multiple genes, and the false negative rate is lower than that of single PCR.

Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) technology is a mass spectrometry technology which is published and developed rapidly in the end of the 20 th century and the 80 th century. The mass analyzer is an ion drift tube (ion drift tube), ions generated by an ion source are firstly collected, the speed of all the ions in a collector is changed into 0, the ions enter a field-free drift tube after being accelerated by a pulse electric field and fly to an ion receiver at a constant speed, and the larger the mass of the ions is, the longer the time for the ions to reach the receiver is; the smaller the mass of the ions, the shorter the time it takes to reach the receiver. According to the principle, ions with different masses can be separated according to the mass-to-charge ratio, the molecular mass and the purity of biomacromolecules such as polypeptide, protein, nucleic acid, polysaccharide and the like can be accurately detected, and the method has the advantages of high accuracy, strong flexibility, large flux, short detection period and high cost performance.

In recent years, mass spectrometry has been developed to detect nucleic acids and proteins, wherein the theoretical basis of the application of mass spectrometry to the field of nucleic acid detection is that there is a mass difference between four nucleotides, which are the basic units constituting the DNA of genetic material, such as 271.2Da, 247.2Da, 287.2Da, 327.1Da (wherein ddTMP is modified) in the order of molecular weight of ddAMP, ddCMP, ddGMP, ddTMP, and the minimum molecular weight difference between them is 16Da, which can be completely resolved by mass spectrometry. Many types of DNA changes, such as base mutations or Polymorphic Sites (SNPs), insertions/deletions (indels), methylation sites, gene quantification, and Copy Number Variation (CNV), can be detected using mass spectrometry.

There are some publications that classify and identify microorganisms using mass spectrometry, for example, chinese patent application CN102337223A, "penicillium chrysogenum antifungal protein Pc-Arctin and its preparation method", disclosing a MALDI-TOF identification method for detecting penicillium chrysogenum antifungal protein Pc-Arctin, in which penicillium chrysogenum a096 spores are picked from a plate and inoculated into SGY liquid medium for culture, crude protein solution obtained by pretreatment is separated and purified on a chromatographic column, and separated and purified on a carboxymethyl cation exchange chromatographic column, each eluted component is collected, each component is subjected to centrifugal ultrafiltration and concentrated to a desired volume, paecilomyces variotii is used as a sensitive test indicator, antifungal active components are tracked, and the purity of the protein is judged by the determined active components; a single band on the SDS-PAGE electrophoresis image is cut, and MALDI-TOF identification is carried out. The method is only suitable for specific microorganisms, needs a multiple protein purification process, and finally identifies the characteristic protein Pc-Arctin by MALDI-TOF, has complicated process and narrow application range, and cannot realize the purpose of classifying bacteria or microorganisms by mass spectrometry.

Chinese patent application 201110154723, "MALDI TOF MS assisted identification Listeria monocytogenes" and 201110154469, "MALDI TOF MS assisted identification Vibrio cholerae" disclose a method for assisted identification of bacteria by MALDI TOF MS technology, comprising: pretreating the bacterial culture, collecting MALDI TOF MS spectra of all bacterial strain samples, preparing bacterial standard spectra according to software, detecting and collecting the spectra of the bacteria to be detected by using the same method, comparing the two spectra, and judging according to matching scores. Because the method uses conventional treatment (through absolute ethyl alcohol, formic acid and acetonitrile treatment, and is assisted with centrifugation, and finally supernatant is sucked for detection), although the characteristic map of the bacteria can be characterized to a certain extent, the obtained map is essentially the map set of the various molecules because the object to be detected contains protein, lipid, lipopolysaccharide, lipooligosaccharide, DNA, polypeptide and other molecules which can be ionized, the information amount of the map which needs to be treated and compared is overlarge, and the characteristic of the map is low because the molecules to be detected are overlarge, so that the method is only suitable for a specific bacteria and cannot be popularized to other large-scale bacteria detection.

Chinese patent application 201210272533.6, entitled method for establishing helicobacter pylori nucleic acid fingerprint and its product, discloses a method for rapidly identifying helicobacter pylori based on mass spectrum technology, which comprises the steps of PCR amplification, SAP enzyme digestion, transcription and nuclease digestion, purification, mass spectrometer detection and the like. The method utilizes a time-of-flight mass spectrometry technology to detect nucleic acid fragments with different molecular weights and abundances and form a spectrogram. However, in this method, after the nucleic acid fragment is amplified by PCR, SAP enzyme digestion, transcription and nuclease digestion are required, and only the change of a single base can be recognized, and a long-fragment DNA having a characteristic sequence cannot be detected.

In addition, based on MALDI-TOF MS, several nucleic acid detection methods such as hME and iPLEX method by Agena in the United states, GOOD assay method by Bruker in Germany, and RFMP method by GeneMatrix in Korea have been developed. In order to improve the resolution of mass spectrometers, the detection of target sites tends to detect oligonucleotide fragments with smaller molecular weights, for example, RFMP method detects oligonucleotide fragments of about 2000-4000 Da by restriction enzyme cleavage of multiplex PCR products containing Single Nucleotide Polymorphism (SNP) sites, and GOOD assay method detects oligonucleotide fragments containing SNP sites by Phosphodiesterase (PDE) cleavage into small fragments of about 1000-2000 Da. However, the above methods inevitably have problems of complicated operation, long time consumption, and the like.

In addition, Sampath et al ([ J ]. PLoS One, 2007, 2(5): e489) in the U.S. A reports a technique combining RT-PCR and electrospray chromatography (reverse transcription PCR/electrophoresis-ionization mass spectrometry, RT-PCR/ESI-MS). The method can rapidly detect 92 influenza isolates of mammals and poultry, deduce 30 different H and N viruses (including 29 AIV H5N1 isolates), and has the accuracy as high as 97 percent, and the time is as short as several hours. Meanwhile, the technology can detect virus samples infected mixedly and can be used for large-scale detection of various subtypes of viruses and new variant strains of unknown nucleic acid sequence viruses. However, the mass spectrometer required by the technology is expensive and is currently limited to use in a few research institutions.

Chinese patent application 200880121570, title of the invention "method and biomarker for diagnosing and monitoring psychiatric disorders" reports that nearly a hundred species of biological peptides related to psychiatric disorders, including influenza virus, can be detected by MALDI-TOF mass spectrometry. However, this method simply summarizes the various possible techniques, neither reporting specific protocols nor specific targets of influenza viruses, and thus it is difficult to teach researchers to detect influenza viruses by MALDI-TOF mass spectrometry.

Therefore, there is a need for a new method for identifying and analyzing Vibrio cholerae to achieve a rapid, accurate, inexpensive, and convenient classification result. The invention combines multiple PCR with flight time mass spectrum technology, multiple PCR products can be directly subjected to mass spectrum detection after being purified, the probability of multitubular pollution increase is overcome, the operation is simplified, the detection time is shortened, the specificity is strong, the detection sensitivity is far higher than that of the traditional bacteria separation culture and serological identification, and the invention is suitable for the detection of large-batch samples and has wide clinical application prospect.

Disclosure of Invention

The principle of the invention is as follows: the basic unit of genetic material DNA, namely the mass difference among four nucleotides, generates fragments with different molecular weights and abundances after multiple PCR is carried out on a plurality of fragments on the genomic DNA of the vibrio cholerae, and can generate nucleic acid fingerprints by mass spectrometry detection, and different nucleic acid fingerprints are generated by the difference of the genomic DNA of different serotypes of the vibrio cholerae. After the database is established, the experimental result is compared with the vibrio cholerae standard map information in the database, and then the identification, the typing, the classification and the like of the vibrio cholerae can be completed. The method has the advantages of strong specificity, high sensitivity, low cost, simple operation, less time consumption and the like.

One of the principles of the present invention is that there is a slight difference in nucleotide composition of genes, i.e., there is a difference in quality between four nucleotides, due to differences in genomic DNA between different serotypes of vibrio cholerae. Therefore, MALDI-TOF mass spectrum and multiplex PCR are combined, and after a target amplification product is obtained by optimizing a multiplex PCR system, MALDI-TOF MS detection can be directly carried out on the amplification product. More specifically, the method specifically amplifies a plurality of oligonucleotide fragments with different sizes by utilizing multiplex PCR, utilizes different nucleic acid fingerprint spectrums generated by the different oligonucleotide fragments in the mass spectrum typing process, establishes a database, and compares an experimental result with the vibrio cholerae standard spectrum information in the database to finish the identification, typing, classification and the like of the vibrio cholerae. The method has the advantages of strong specificity, high sensitivity, low cost, simple operation, less time consumption and the like.

The second principle of the invention is that in the optimization process of the multiplex PCR system, the complete sequence of the target nucleic acid is analyzed, a conservative sequence design primer is selected for multiplex PCR amplification, the primer is improved aiming at the PCR amplification result, and finally a primer sequence effective for specific amplification is selected; in order to distinguish PCR products with similar sizes, tag sequences which do not influence PCR amplification are introduced into primers; and purifying the multiple PCR product and then directly performing MALDI-TOF MS analysis, thereby successfully realizing the rapid detection of the target nucleic acid.

Accordingly, it is a first object of the present invention to provide a primer set for identifying multiplex PCR products for typing Vibrio cholerae, wherein the primer set comprises,

the primers are SEQ ID NO.1 and SEQ ID NO.2 of the specific primer for amplifying the ctxA fragment of the vibrio cholerae, and the mass spectrum peak value of an amplification product is 22115 Da;

SEQ ID NO.3 and SEQ ID NO.4 of the primers specific to the ctxB fragment of the amplified Vibrio cholerae, the mass spectrum peak of the amplified product is 30010 Da;

SEQ ID NO.5 and SEQ ID NO.6 of the primers specific to the amplification of the ompW fragment of Vibrio cholerae, the mass spectrum peak of the amplification product is 34874 Da.

In any of the above embodiments, where the primer combination may optionally include a tag sequence, the size of the multiplex PCR product can be easily distinguished by MALDI-TOF MS. In a specific embodiment, the tag sequence is ACGTTGGATG.

The second purpose of the invention is to provide a mass spectrum kit for identifying the multiplex PCR products of the vibrio cholerae typing by the mass spectrometry (MALDI-TOF MS), wherein the kit comprises the specific primer combination for amplifying the viruses and a mass spectrum special spotting matrix.

In one embodiment, the composition of the spotting matrix is 3-HPA: DHC: formic acid 4: 2: 1.

In another embodiment, the primers are SEQ ID No.1 and SEQ ID No.2 of the specific primers amplifying the ctxA fragment of Vibrio cholerae, and the mass spectrum peak of the amplified product is 22115 Da;

SEQ ID NO.3 and SEQ ID NO.4 of the primers specific to the ctxB fragment of the amplified Vibrio cholerae, the mass spectrum peak of the amplified product is 30010 Da;

SEQ ID NO.5 and SEQ ID NO.6 of the primers specific to the amplification of the ompW fragment of Vibrio cholerae, the mass spectrum peak of the amplification product is 34874 Da.

In any of the above embodiments, where the primer combination may optionally include a tag sequence, the size of the multiplex PCR product can be easily distinguished by MALDI-TOF MS. In a specific embodiment, the tag sequence is ACGTTGGATG.

In any one of the above embodiments, 30. mu.l of the reaction system for PCR amplification contains:

in a preferred embodiment, the concentration of each primer pair is controlled to be between 10 and 20. mu.M.

In another preferred embodiment, wherein the PCR amplification reaction procedure is: pre-denaturation at 94-95 deg.C for 5 min; denaturation at 94-95 deg.C for 30s, annealing at 55-60 deg.C for 30s, and extension at 72-75 deg.C for 40-60s, and performing 35-45 cycles; then, extension was carried out at 72-75 ℃ for 5 min.

In any of the above embodiments, the kit further comprises a mass spectrometry specific microarray chip, a mass spectrometry internal standard, and a mass spectrometry external standard.

In one embodiment, the kit further comprises software for comparative analysis of the nucleic acid fingerprint profile of the isolated strain. In a preferred embodiment, the software is the BioExplore software developed by the inventors, having copyright number Soft literature 136879, accession number 2009SR 10700.

The third object of the present invention is to provide a method for identifying the type of Vibrio cholerae, comprising the steps of

Performing multiplex PCR amplification on the characteristic segment of the vibrio cholerae to be detected by using a specific primer combination;

purifying the multiple PCR products through an adsorption column;

spotting the purified multiplex PCR product on a matrix crystal, and detecting the size of the fragment of the multiplex PCR product by mass spectrometry;

comparing the mass spectrum result with a vibrio cholerae fingerprint spectrum library to determine the specific type of the vibrio cholerae to be detected;

wherein the content of the first and second substances,

the primers are SEQ ID NO.1 and SEQ ID NO.2 of the specific primer for amplifying the ctxA fragment of the vibrio cholerae, and the mass spectrum peak value of an amplification product is 22115 Da;

SEQ ID NO.3 and SEQ ID NO.4 of the primers specific to the ctxB fragment of the amplified Vibrio cholerae, the mass spectrum peak of the amplified product is 30010 Da;

SEQ ID NO.5 and SEQ ID NO.6 of the primers specific to the amplification of the ompW fragment of Vibrio cholerae, the mass spectrum peak of the amplification product is 34874 Da.

In any of the above embodiments, the vibrio cholerae is group O1 and/or group O139.

In any one of the above embodiments, 30. mu.l of the reaction system for PCR amplification contains:

in a preferred embodiment, the concentration of each primer pair is controlled to be between 10 and 20. mu.M.

In another preferred embodiment, wherein the PCR amplification reaction procedure is: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 30s, 45 cycles, and final extension at 72 ℃ for 5 min.

In any of the above embodiments, wherein the spotting matrix used in the MALDI-TOF MS assay contains formic acid. In a specific embodiment, the composition of the spotting matrix used in the MALDI-TOF MS assay is 3-HPA: DHC: formic acid 4: 2: 1.

In any of the above embodiments, the method can be applied for non-diagnostic purposes and is widely used for identifying the type of vibrio cholerae in the fields of environmental sanitation, food safety detection, public place safety, import and export inspection and quarantine, and the like, so as to maintain public health safety.

The fourth purpose of the invention is to provide a preparation method of vibrio cholerae fingerprint atlas database used as the multiplex PCR product for identifying the type of vibrio cholerae by mass spectrum, which comprises the following steps:

(1) synthesizing a plasmid of a DNA fragment conserved sequence of the vibrio cholerae, and designing a corresponding specific primer;

wherein the conserved sequences are respectively selected from a ctxA fragment (SEQ ID NO.7), a ctxB fragment (SEQ ID NO.8) and an ompW fragment (SEQ ID NO.9) of vibrio cholerae DNA, and specific primer sequences of the fragments are respectively selected from: SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO. 6;

(2) performing multiplex amplification on the genomic DNA by using the primer combination in the step (1);

(3) detecting the PCR product, and checking the PCR amplification quality;

(4) purifying the multiple PCR products by using a DNA adsorption column;

(5) the purified product and the matrix form a crystallization mixture, and the crystallization mixture is spotted on a chip;

(6) detecting by a mass spectrometer to obtain characteristic nucleic acid fingerprint spectrums of different vibrio cholerae;

(7) and (4) summarizing and sorting the nucleic acid fingerprint characteristic maps of different isolates obtained in the step (6) through computer software to obtain the standard nucleic acid fingerprint characteristic map of the vibrio cholerae.

In one embodiment, the bacterial nucleic acid sequence amplified by the PCR reaction includes, but is not limited to, a region on the Vibrio cholerae DNA genome.

In a specific embodiment, the solid support of the DNA adsorption column includes, but is not limited to, gel, resin, silica gel, magnetic beads, glass powder, glass beads, and the like. In one embodiment, the matrix is a composite matrix containing acidic components including, but not limited to, formic acid, acetic acid, and citric acid. In another specific embodiment, the chip is a microarray chip dedicated to time-of-flight mass spectrometry, and the material thereof includes, but is not limited to, stainless steel, diamond, monocrystalline silicon, and quartz crystal.

In a specific embodiment, the mass spectrometer is a MALDI TOF MS mass spectrometer.

In any of the above embodiments, the Vibrio cholerae includes, but is not limited to, the group O1 and the group O139.

In one embodiment, the software is the BioExplore software developed by the inventors, having copyright number Soft literary registration No. 136879, registration No. 2009SR 10700.

Technical effects

1. The invention is based on the mass spectrometric detection technology, and the lower limit of the detection on the existence of the vibrio cholerae by using the scheme can be far beyond other technical schemes due to the high sensitivity of the mass spectrometric detection.

2. The mass spectrometric detection can be carried out after the purification of the nucleic acid amplification product, compared with the prior art, the whole process is completed only within hours, the operation is simple and convenient, the sensitivity is high, the specificity is strong, the result is accurate, and the flux is high.

3. The detection implemented by the invention is completed in the same PCR system, so that the DNA of the sample and various reagents in the PCR amplification system, particularly the using amount of Taq are saved, the detection cost is greatly reduced, and the kit can be widely applied to the clinical rapid diagnosis of various infectious diseases.

4. For different samples, the invention can compare the nucleic acid fingerprint generated by the samples with the spectrum of the vibrio cholerae standard strain in the database, and can judge whether the strain is a vibrio cholerae isolate or not through bioinformatics analysis.

5. The scheme can be used for rapidly and accurately classifying and identifying the vibrio cholerae, can be used for clinical examination and the like, and avoids delaying the illness state due to untimely diagnosis in clinic.

6. The invention can be used for identifying the vibrio cholerae types in the fields of environmental sanitation, public places and the like so as to maintain public health safety.

7. The database of the invention is open, can continuously supplement new isolates, continuously perfect and expand the database so as to more accurately complete the identification of the vibrio cholerae.

8. In conclusion, the invention can be used for detecting long-fragment DNA with characteristic sequences instead of recognizing the change of a single base, so that the mass spectrum detection of macromolecular nucleic acid samples is possible. Meanwhile, the method overcomes the probability of increasing pollution of multiple tubes, simplifies the operation, can detect multiple samples simultaneously, shortens the detection time, maintains the detection sensitivity and specificity, and has higher clinical application prospect.

Drawings

FIG. 1: multina electrophoresis band of Vibrio cholerae nucleic acid fragment multiplex PCR product.

FIG. 2: MALDI-TOF MS detection spectrum of vibrio cholerae nucleic acid fragment multiplex PCR product.

Detailed Description

In order to further understand the technical features of the present invention, the present invention is described in detail with reference to the specific embodiments below. The embodiments are given by way of illustration only and not by way of limitation, and the scope of the invention should be determined by that of the claims which follow and that of insubstantial modifications made by those skilled in the art based on the teachings of the invention.

Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

Example 1: establishing a vibrio cholerae nucleic acid fingerprint.

1. Sequence matching

By searching NCBI database, the conserved sequence of Vibrio cholerae DNA is selected from ctxA fragment, > KX584736.1Vibrio cholerae strain R-18588 cholerae toxin A-subbunit, and the sequence is SEQ ID NO. 7:

GATATTACAGTAACTTAGATATTGCTCCAGCAGCAGATGGTTATGGATTGGCAG GTTTCCCTCCGGAGCATAGAGCTTGGAGGGAAGAGCCGTGGATTCATCATGCACCGCC GGGTTGTGGGAATGCTCCAAGATCATCGATGAGTAATACTTGCGATGAAAAAACCCA；

ctxB fragment, > kx584736.1viro cholerae strain R-18588cholera toxin B-subbunit, the sequence of which is SEQ ID No. 8:

TCACAAAAAAAAGCGATTGAAAGGATGAAGGATACCCTGAGGATTGCATATC TTACTGAAGCTAAAGTCGAAAAGTTATGTGTATGGAATAATAAAACGCCTCATGCGATT GCCGCAATTAGTATGGCAAATTAAGATATAAAAAAGCCCACCTCAGTGGGCTTTTTTGT G；

ompW fragment, > KJ722608.1Vibrio cholerae O1strain N16961OmpW (ompW) gene, complete cds, the sequence of which is SEQ ID NO. 9:

TTCTACCTCTGGTGGTGAGTTAGGTAGCCTTGGTGATATTGGTGAAACAAAACATT TGCCACCTACCTTTATGGTCCAATACTACTTTGGTGAAGCTAATTCGACTTTCCGTCCAT ATGTTGGTGCGGGTTTGAATTACACCACTTTCTTTGATGAAAGCTTTAATGGTACG

2. primer design

3 pairs of specific primers are designed for vibrio cholerae, and are all synthesized by Shanghai Jieli bioengineering GmbH:

numbering	Primer (5'→ 3')
		SEQ ID No：1	ACGTTGGATGATAGAGCTTGGAGGGAAGAG
SEQ ID No：2	ACGTTGGATGGATGATCTTGGAGCATTCCC
		SEQ ID No：3	ACGTTGGATGCATGAGGCGTTTTATTATTCC
SEQ ID No：4	ACGTTGGATGAGCGATTGAAAGGATGAAGG
		SEQ ID No：5	ACGTTGGATGGGACGGAAAGTCGAATTAGC
SEQ ID No：6	ACGTTGGATGTACCTCTGGTGGTGAGTTAG

3. And (3) PCR amplification:

(1) and (3) PCR reaction system:

(2) and (3) amplification reaction program: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 30s, 45 cycles, and final extension at 72 ℃ for 5 min.

4. Multina electrophoretic detection: the PCR product was detected by using the Multina electrophoresis apparatus of Shimadzu, and three bands of 128bp, 129bp and 137bp were amplified to show the success of the amplification (FIG. 1).

5. And (3) purifying a multiplex PCR product: (1) according to the DNA Binding Buffer: PCR product ═ 5: 1, adding Binding Buffer into the PCR product and mixing uniformly; (2) transferring the mixed solution to an adsorption column, placing the adsorption column in a collecting tube, centrifuging for 30s at 10,000g, and discarding the waste liquid; (3) add 200. mu.L of DNA Wash Buffer to the adsorption column, centrifuge at 10,000g for 30s, repeat the Wash 1 time; (4) add ddH of more than or equal to 6 mu L₂Placing the product in an adsorption column at room temperature for 1min, transferring the product to a new 1.5mL centrifuge tube, and centrifuging the product for 30s at 10,000g to obtain a purified product.

6. Chip spotting: (1) taking a special micro-array chip for the time-of-flight mass spectrum by using tweezers, and lightly placing the chip on a target holder; (2) sequentially spotting samples according to the sequence of the samples, wherein each sample is 0.5-1.0 mu L; (3) drying at room temperature (10-15min) or heating with heater.

7. Mass spectrum detection: the peak signals were detected using a Clin-ToF II (MALDI-TOF principle) mass spectrometer, see FIG. 2.

8. The detection results were analyzed using a time-of-flight mass spectrometry signal processing system (MALDI MS).

As shown in FIG. 2 and the analysis results, the mass spectrum detected characteristic peaks at 22115Da, 30010Da and 34874Da, respectively characterizing the ctxA fragment, ctxB fragment and ompW fragment of the amplified Vibrio cholerae. The three characteristic peaks have smooth base lines, large abundance, high signal-to-noise ratio, high separation degree between adjacent signal peaks, obviously improved atlas quality, capability of providing more information and contribution to improving the accuracy and the repeatability of an identification result.

Sequence listing

<110> Beijing resolute Xinbo Chuang Biotech Co., Ltd

<120> method for preparing fingerprint atlas database for detecting vibrio cholerae typing

<140> 2018100037714

<141> 2018-01-03

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 30

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 1

acgttggatg atagagcttg gagggaagag 30

<210> 2

<211> 30

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 2

acgttggatg gatgatcttg gagcattccc 30

<210> 3

<211> 31

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 3

acgttggatg catgaggcgt tttattattc c 31

<210> 4

<211> 30

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 4

acgttggatg agcgattgaa aggatgaagg 30

<210> 5

<211> 30

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 5

acgttggatg ggacggaaag tcgaattagc 30

<210> 6

<211> 30

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 6

acgttggatg tacctctggt ggtgagttag 30

<210> 7

<211> 169

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 7

gatattacag taacttagat attgctccag cagcagatgg ttatggattg gcaggtttcc 60

ctccggagca tagagcttgg agggaagagc cgtggattca tcatgcaccg ccgggttgtg 120

ggaatgctcc aagatcatcg atgagtaata cttgcgatga aaaaaccca 169

<210> 8

<211> 172

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 8

tcacaaaaaa aagcgattga aaggatgaag gataccctga ggattgcata tcttactgaa 60

gctaaagtcg aaaagttatg tgtatggaat aataaaacgc ctcatgcgat tgccgcaatt 120

agtatggcaa attaagatat aaaaaagccc acctcagtgg gcttttttgg tg 172

<210> 9

<211> 172

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 9

ttctacctct ggtggtgagt taggtagcct tggtgatatt ggtgaaacaa aacatttgcc 60

acctaccttt atggtccaat actactttgg tgaagctaat tcgactttcc gtccatatgt 120

tggtgcgggt ttgaattaca ccactttctt tgatgaaagc tttaatggta cg 172

Claims (8)

1. A preparation method of vibrio cholerae fingerprint atlas database used for identifying multiplex PCR products of vibrio cholerae types by mass spectrum comprises the following steps:

(1) synthesizing a plasmid of a DNA fragment conserved sequence of the vibrio cholerae, and designing a corresponding specific primer;

wherein the conserved sequence is respectively selected from the ctxA fragment of vibrio cholerae DNA shown in SEQ ID NO.7, the ctxB fragment shown in SEQ ID NO.8 and the ompW fragment shown in SEQ ID NO.9, and the specific primer pair sequences of the fragments are respectively selected from: SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO. 6;

(2) performing multiplex amplification on the genomic DNA by using the primer combination in the step (1);

(3) detecting the PCR product, and checking the PCR amplification quality;

(4) purifying the multiple PCR products by using a DNA adsorption column;

(5) the purified product and the matrix form a crystallization mixture, and the crystallization mixture is spotted on a chip;

(6) detecting by a mass spectrometer to obtain characteristic nucleic acid fingerprint spectrums of different vibrio cholerae;

(7) and (4) summarizing and sorting the nucleic acid fingerprint characteristic maps of different isolates obtained in the step (6) through computer software to obtain the standard nucleic acid fingerprint characteristic map of the vibrio cholerae.

2. The method of claim 1, wherein the nucleic acid sequence of the bacterium amplified by the PCR reaction comprises a region on the DNA genome of Vibrio cholerae.

3. The method of claim 1 or 2, wherein the solid support of the DNA adsorption column comprises gel, resin, silica gel, magnetic beads, glass frit, or glass beads.

4. The method of claim 3, wherein the matrix is a composite matrix containing acidic components including formic acid, acetic acid, and citric acid.

5. The method of claim 1 or 2, wherein the chip is a time-of-flight mass spectrometry specific microarray chip made of a material including stainless steel, diamond, single crystal silicon, quartz crystal.

6. The method of claim 5, wherein the mass spectrometer is a MALDI TOF MS mass spectrometer.

7. The method of claim 6, wherein said Vibrio cholerae comprises group O1 and group O139.

8. The method of claim 7, wherein the software is BioExplore software having copyright number Soft literary Density No. 136879, accession No. 2009SR 10700.

Images