CN108048405A - Stablize cell model for expressing human endogenous INav and its preparation method and application - Google Patents

Stablize cell model for expressing human endogenous INav and its preparation method and application Download PDF

Info

Publication number
CN108048405A
CN108048405A CN201810099687.7A CN201810099687A CN108048405A CN 108048405 A CN108048405 A CN 108048405A CN 201810099687 A CN201810099687 A CN 201810099687A CN 108048405 A CN108048405 A CN 108048405A
Authority
CN
China
Prior art keywords
scn5a
dcas9
inav
cell
human endogenous
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201810099687.7A
Other languages
Chinese (zh)
Inventor
陈义汉
徐亮
高斯韵
唐秋雨
石蕊
黄家乐
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai East Hospital
Original Assignee
Shanghai East Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai East Hospital filed Critical Shanghai East Hospital
Publication of CN108048405A publication Critical patent/CN108048405A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2503/00—Use of cells in diagnostics
    • C12N2503/02—Drug screening
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Abstract

The present invention provides the cell model of the human endogenous INav of stable expression a kind of, using a host cell, the guiding RNA containing dCas9 VP64 fusion proteins and SCN5A in host cell；The sequence of dCas9 VP64 fusion proteins is as shown in SEQ ID NO.1, and the sequence of the guiding RNA of SCN5A is as shown in SEQ ID NO.2.Additionally provide the preparation method of above-mentioned cell model, dCas9 VP64 fusion proteins and SCN5A gRNA are building up on carrier respectively, are then packaged into virus respectively, by above-mentioned virus infection host cell, last screening positive clone is to get the stable cell model for expressing human endogenous INav.The present invention increases its expression in SCN5A promoter region transcriptional activation endogenous people's SCN5A genes, plays channel function, and many facilities are brought to carry out external medicament high flux screening.

Description

Stablize cell model for expressing human endogenous INav and its preparation method and application
Technical field
The invention belongs to bioengineering fields, are related to a kind of cell model, and specifically a kind of stable expression people is endogenous The cell model and its method for building up of property INav and application.
Background technology
Ion channel is the duct albumen on cell membrane, is the basis of bio-electricity of cell.Sodium-ion channel is widely present in In excitable cell, the excitability and normal physiological function of cell are maintained.The sodium channel (INav) of voltage-dependent is primarily present In on the cell membrane of heart muscle, ventricular muscles and uncommon pumping system, participating in the depolarising of 0 phase of action potential and 2 phase plateaus, cell is determined Excitability and conductibility.The α subunits of SCN5A gene code INav passages, gene mutation can cause INav dysfunctions, be Cause the major reason of a variety of malignant arrhythmias and the target spot of exploitation treatment antiarrhythmic medicament, therefore further investigate INav channel characteristics, pharmacological property and its regulation mechanism will likely provide new thread for the prevention of such arrhythmia cordis.
The positive ion channel clone of electro physiology method screening and carry out drug screening, be detection ion channel whether Cell surface expression and the standard method functioned.The ionic current through ion channel is recorded come anti-using patch clamp technique The molecule activity of ion channel on cell membrane is reflected, can be good at studying the effect of cell surface ion channel, be widely used in The screening of medical compounds.HEK293 cells are derived from the cell line of human embryonic kidney cells, and transfection efficiency is high, and cell space is big, extensively The general research applied to cellular electrophysiologicalsensor.
The high flux screening that drug is carried out currently with Humanized cell has the following problems：1) the tissue samples source of people Difficulty, individual difference are big；2) external source ion channel gene is surely gone in human archeocyte system, lacks the variable sheer shape of channel gene Formula, may be inconsistent with the control methods of endogenous gene；3) the channel current degree of variation formed is high, can not carry out high-throughput sieve Choosing.Therefore, it is necessary to establish the human endogenous cell model of stabilization in vitro expression, the stability and high efficiency screening of power-assisted drug.
The content of the invention
For above-mentioned technical problem of the prior art, the present invention provides a kind of the thin of stable human endogenous INav of expression Born of the same parents' model and its method for building up and application, this stable cell model and its method for building up for expressing human endogenous INav The technical issues of Humanized cell of the prior art can not carry out the high flux screening of drug is solved with application.
It is described using a host cell the present invention provides a kind of cell model of the stable human endogenous INav of expression Host cell in the guiding RNA containing dCas9-VP64 fusion proteins and SCN5A；The dCas9-VP64 fusion proteins Sequence is as shown in SEQ ID NO.1, and the sequence of the guiding RNA of the SCN5A is as shown in SEQ ID NO.2.
Further, the host cell is HEK293 cells.
The present invention also provides a kind of preparation method of the cell model of the stable human endogenous INav of expression, by dCas9- VP64 fusion proteins and SCN5A-gRNA are building up on carrier respectively, are then packaged into virus respectively, and above-mentioned virus is infected Host cell, last screening positive clone express the cell model of human endogenous INav to get stablizing.
Further, by dCas9-VP64 fusion protein constructions to pLVX-Puro carriers, pLVX-dCas9- is obtained SCN5A-gRNA is building up on pLVX-shRNA2 carriers by VP64-Puro carriers, obtains pLVX-SCN5A-gRNA- Tri- plasmids of pLVX-dCas9-VP64-Puro and psPAX2 and pMD2.G are total to by Zsgreen1 carriers with three plasmid packaging systems It subcontracts and dresses up virus, with three plasmid packaging systems by pLVX-SCN5A-gRNA-Zsgreen1 and tri- matter of psPAX2 and pMD2.G Grain corotation is packaged into virus, and two above-mentioned viruses are infected host cell simultaneously, and last screening positive clone is to get stablizing table The cell model of intelligent's endogenous INav.Further, the cell model of described a kind of stable human endogenous INav of expression Preparation method includes：
1) dCas9-VP64 is inserted into XhoI the and EcoR I of pLVX-Puro carriers by full genome synthesis dCas9-VP64 Between；
2) screen and synthesize effective SCN5A-gRNA segments, SCN5A-gRNA segments are inserted into pLVX-shRNA2；3) Carrier after step 1) and step 2) insertion is packaged into slow virus respectively；
4) HEK293 cells are infected respectively using slow virus, filter out positive colony with puromycin and green fluorescence, obtain The cell model for expressing human endogenous INav must be stablized.
The present invention also provides a kind of above-mentioned stable cell model for expressing human endogenous INav, high throughput is sieved in vitro Select the application in drug.
Specifically, the drug includes the drug for the treatment of arrhythmia cordis.
The present invention provides a kind of cell models of the stable human endogenous INav of expression, it is conducive to the stability and high efficiency of drug Screening.The present invention's stablizes the cell model for expressing human endogenous INav, using HEK293 cells as host cell, includes The guiding RNA of dCas9-VP64 fusion proteins and SCN5A (guide RNA, gRNA).
The present invention by by the effect plasmid dCas9-VP64 of transcriptional activation and specificity guiding plasmid SCN5A-gRNA It is transfected into jointly in HEK293 cells, in SCN5A promoter region transcriptional activation endogenous people's SCN5A genes, increases its expression, Channel function is played, has been successfully established the HEK293 cell models of stabilization in vitro expression SCN5A, to carry out external medicament high flux Screening brings many facilities.
The present invention is compared with prior art, and technological progress is significant.The present invention establishes steady turn using HEK293 cells Cell model has been successfully established the Screening Platform of Humanized cell, is screened closer to clinical medicine.The present invention passes through foundation DCas9-VP64 fusion proteins stablize expression in HEK293 cells, to introduce other specificity guiding RNA, establish other ions The endogenous expression of passage provides the foundation.The present invention can be screened fast and efficiently by detecting Zsgreen1 green fluorescences It expresses passage and has the positive colony of channel function, more targeted clone's " candidate " is provided for electro physiology experiment, so as to Save substantial amounts of time and manpower.The present invention can generate a variety of people by transcriptional activation endogenous people's SCN5A genes The transcript variant of SCN5A genes can preferably simulate the gene transcript pattern in Humanized cell.
Description of the drawings
Fig. 1 is the structure and the mode of action of dCas9-VP64 carriers and SCN5A-gRNA carriers.
Fig. 2 is the expression of SCN5A mRNA after dCas9-VP64/SCN5A-gRNA corotation.
Fig. 3 is the expression of other ion channels after dCas9-VP64/SCN5A-gRNA corotation.
Fig. 4 is the expression of the mRNA spliceosomes of endogenous SCN5A in HEK293 cells.
Fig. 5 is that dCas9-VP64 surely turns expression in HEK293 cells.
Fig. 6 is the primary current figure for the INav1.5 that manual patch-clamp is recorded on HEK293 cells.
Fig. 7 is the current-voltage relation curve for the INav1.5 passages that manual Patch-clamp techniques arrive.
Specific embodiment
There is more specific understanding for technology contents, feature and effect to the present invention, in conjunction with embodiment illustrated, in detail It states as follows：
1 plamid vector construction of embodiment (as shown in Figure 1)
1.dCas9-VP64 vector constructions
(1) full genome synthesis dCas9-VP64 (as shown in SEQ ID NO.1) is connected to pLVX- using restructuring enzyme process Between Xho I and the EcoR I of Puro carriers；The primer of use is as follows：
Forward：
ctaccggactcagatctcgagatgaaaaggccggcggcc
Reverse：
gtaccgtcgactgcagaattctcacagcatgtccaggtcga
(2) in the reaction system of 50 μ l, 37 DEG C, with Xho I and EcoR I double digestion carrier pLVX-Puro, it is pure to run glue Change.
(3) in the reaction system of 20 μ l, 37 DEG C, with homologous recombination enzyme (II One Step Cloning Kit, Vazyme) dCas9-VP64 is connected on carrier pLVX-Puro.
(4) connection product is transformed into DH5 α competent bacterias, is evenly coated in the LB (Luria- containing ampicillin Bertani) on culture medium flat plate, after 37 DEG C of culture 14h, choose monoclonal and carry out bacterium colony PCR：The reaction system of 20 μ l, 94 DEG C of changes Property, 58 DEG C of annealing, 72 DEG C of extensions, 30 Xun Huans；Identification, and positive colony is sequenced.
2.SCN5A-gRNA vector constructions
(1) effective gRNA segments are synthesized (as shown in SEQ ID NO.2)
Using human U_6 promoter expression cassette, wherein, the sequence of U6 promoters is：
tttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaa cacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgtt ttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaagga cga
The sequence of SCN5A gRNA is：ccaagccccaggccgaaccc
The sequence of gRNA scaffold is (trans-activating CRISPR RNA, tracrRNA sequence)：
gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct ttttt
The sequence in EcoRI sites is：gaattc
It is connected to using restructuring enzyme process in pLVX-shRNA2 carriers, the primer of use is as follows：
Forward：
tcttgtggaaaggacgaaacaccgccaagccccaggccgaaccc
Reverse：
tactattaataactagaattcaaaaaagcaccgactcggtg
(2) in the reaction system of 50 μ l, 37 DEG C, with BamH I and EcoR I double digestion carrier pLVX-shRNA2, glue is run Purifying.
(3) in the reaction system of 20 μ l, 37 DEG C, with homologous recombination enzyme (II One Step Cloning Kit, Vazyme) SCN5A-gRNA is connected on carrier pLVX-shRNA2.
(4) connection product is transformed into DH5 α competent bacterias, is evenly coated in the LB culture mediums containing ampicillin and is put down On plate, after 37 DEG C of 14h, to choose monoclonal and carry out bacterium colony PCR, the reaction system of 20 μ l, 94 DEG C of denaturation, 58 DEG C of annealing, 72 DEG C extend, 30 Xun Huans；Identification, and positive colony is sequenced.
3. effective SCN5A-gRNA's determines
(1) cell culture：By HEK293 cells with 1 × 105The density of cells/ml is passed in the culture dish of 6-well, With the DMEM culture solutions containing 10%FBS (hyclone), 37 DEG C, 5%CO2Overnight incubation in incubator makes its growth to 70%- It is spare during 90% degree of converging.
(2) 3000 liposome transfection (Lipofectamine of Lipofectamine are usedTM3000, Thermo Fisher),
By 3 kinds of SCN5A-gRNA plasmids of structure respectively with dCas9-VP64 corotation in HEK293 cells：By 5 μ l's Lipofectamine 3000 is added in the EP pipes of the Opti-MEM (GIBCO companies, the U.S.) containing 100 μ l, and gently mixing, dilute It releases spare；
By two plasmids：DCas9-VP64 (0.8 μ g) and SCN5A-gRNA (1.6 μ g), adds in the Opti- containing 100 μ l In the EP pipes of MEM, the P3000 of 5 μ l is added in mixed liquor, gently mixing；Aforesaid liquid is mixed, is stored at room temperature incubation 20min；Above-mentioned mixed liquor is slowly dropped into the cell of the DMEM culture mediums containing 1.5ml 10%FBS.It is replaced after 8~12h The new DMEM culture solutions containing 10%FBS.
(3) cell lysis extracts total serum IgE after transfecting 48h, takes 1500ng RNA in 37 DEG C of 15min, the PCR conditions of 85 DEG C of 5s Subinverse is transcribed into cDNA, and 4 DEG C spare.
(4) real-time fluorescence quantitative PCR is analyzed：In 384 orifice plates, 5 μ 2 × SYBR of l Green are added on ice MasterMix (SYBRGreen I andAssay, TOYOBO), the 1 above-mentioned cDNA of μ l, add in 2 μ l upstream and downstream primers mixing Liquid (0.4 μM of final concentration), with dd H2O polishings are to 10 μ l.95 DEG C of unwindings, 60 DEG C of annealing, 40 Xun Huans.
(5) the mRNA contents (table 1) of primer SCN5A-total primer detections SCN5A are used.
SCN5A-Guide RNA sequences used in table 1.
It is detected by qPCR, obtains most effective SCN5A-gRNA sequences (as shown in Figure 2).
4.dCas9-VP64/SCN5A-gRNA plasmids corotation activation endogenous SCN5A gene specifics determine；
(1) each ion channel primer (table 2) is designed.
Rt-PCR primers used in table 2.
(2) most effective SCN5A-gRNA sequences in Fig. 2 are selected, with dCas9-VP64 corotation HEK293 cells (LipofectamineTM3000, Thermo Fisher).Total serum IgE and reverse transcription are extracted into cDNA；With real-time fluorescence quantitative PCR Detect the expression quantity of above-mentioned each ion channel in cDNA.The results show that in addition to SCN5A, the expression quantity of remaining each ion channel is equal Without significantly raised (Fig. 3).
5.dCas9-VP64/SCN5A-gRNA plasmids corotation generates a variety of SCN5A spliceosomes
(1) most effective SCN5A-gRNA sequences in Fig. 2 are selected, with dCas9-VP64 corotation HEK293 cells (Lipofectamine 3000, ThermoFisher).Total serum IgE and reverse transcription are extracted into cDNA.
(2) primer (table 2) of each section of spliceosome of SCN5A is designed.
(3) real-time fluorescence quantitative PCR：With the effective SCN5A-gRNA sequences of the primer detection of above-mentioned SCN5A spliceosomes with The cDNA samples of dCas9-VP64 corotation, and compared with Normal Human Heart's tissue cDNA sample, find the table of a variety of spliceosomes (Fig. 4) is raised up to amount.
(4) sample of real-time fluorescence quantitative PCR, 1.5% nucleic acid gel electrophoresis verification the above results (Fig. 4) are taken.
2 slow virus of embodiment is packed and cell line structure
1. slow virus is packed：
Virus packaging is using three plasmid packaging system of slow virus, by slow virus packaging plasmid psPAX2, pMD2.G and slow disease Poisonous carrier pLVX-dCas9-VP64-Puro/pLVX-SCN5A-gRNA-Zsgreen1 is formed.
(1) purifying of plasmid：
By pLVX-dCas9-VP64-Puro, pLVX-SCN5A-gRNA-Zsgreen1 and slow virus packaging plasmid psPAX2 It is transformed into respectively in Efficiency Competent Cells with 4 plasmids such as pMD2.G, 37 DEG C of incubator culture 16h after coated plate.Choose single bacterium Shake culture 8h in the test tube of the culture solutions of LB containing 5ml is fallen within, after identification, 200 μ l bacterium solutions of inoculation are in the culture solutions of LB containing 250ml Shake culture 12h in conical flask, when OD600 values reach 0.6, in strict accordance with MACHEREY-NAGEL companies kit (NucleoBond Xtra Midi, 50preps) step plasmid purification.
(2) virus packaging
A) cell culture：By 293T cells with 1 × 105The density of cells/ml is passed in the culture dish of 100mm, with containing The DMEM culture solutions of 10%FBS, 37 DEG C, 5%CO2Overnight incubation in incubator, it is standby when making its growth to more than 80% degree of converging With.
B) pack：By 3 plasmid pLVX-dCas9-VP64-Puro (20 μ g), psPAX2 (10 μ g), pMD2.G (5 μ g) and 500 μ l serum-frees are uniformly mixed without dual anti-DMEM in 1.5ml EP pipes, the static 5min of room temperature.500 μ l plasmids are mixed molten Liquid is added in 500 μ l liposome mixed liquors, and is gently mixed uniformly, is incubated at room temperature 20min.Final mixed liquor is added to 8ml Serum-free is uniformly mixed without in dual anti-DMEM culture solutions, is then added in the Tissue Culture Dish that cell confluency degree is 80% (100mm culture dishes), 37 DEG C, 5%CO26h is cultivated in incubator, 1ml sera incubations is added in and stays overnight.Remove culture solution within second day, Change 10% serum, 1% dual anti-DMEM culture solutions into, 48h collects virus.The supernatant 3500r/min of collection is centrifuged into 10min, Cell fragment is removed, after 0.45 μm of filter filtering, then by supernatant with 4 DEG C of centrifugation 2h of 26000rpm, then with the PBS weights of 100 μ l Outstanding, -80 DEG C of freezen protectives after packing, slow virus dCas9-VP64 structures are completed.Likewise, using the above method, slow virus is used Three plasmid packaging systems are by three plasmid pLVX-SCN5A-gRNA-Zsgreen1 (20 μ g), psPAX2 (10 μ g), pMD2.G (5 μ G) carrier package successfully builds SCN5A-gRNA viruses into slow virus.2. cell line is built
(1) day before transfection counts, HEK293 cell dissociations with 3 × 105The quantity of cells/well spreads 6 orifice plates, with DMEM+10%FBS overnight incubations.
(2) the dCas9-VP64 slow virus of completion has been built in 2 step 1 of Example (2), has been added in MOI 100 HEK293 cells, 37 DEG C are incubated overnight.
(3) cell is carried out to change liquid after transfecting 12h, after transfecting 48h, by cell dissociation, is fully transferred to 100mm cultures Ware with DMEM+10%FBS medium cultures, adds in puromycin (Puro) and is screened.
(4) amplification cultivation obtains the HEK293 cell lines (HEK293- for stablizing expression dCas9-VP64 fusion proteins DCas9-VP64 cells), to introduce other specificity guiding RNA, the endogenous expression for establishing other genes provides the foundation.
(5) the SCN5A-gRNA slow virus of completion has been built in 2 step 1 of Example (2), has been added in and stablized with MOI 100 The HEK293 cells (HEK293-dCas9-VP64 cells) of dCas9-VP64 fusion proteins are expressed, 37 DEG C are incubated overnight.
(6) cell is carried out to change liquid after transfecting 12h, after transfecting 48h, by cell dissociation, is fully transferred to 100mm cultures With DMEM+10%FBS medium cultures, the cell line of high enhanced green fluorescent protein is sorted by flow cytometry for ware.
3.Western Blot verify cell line
(1) cell culture：The dCas9-VP64 stable cell strains of completion will be built in 2 step 2 of above-described embodiment (5) (HEK293-dCas9-VP64 cells) is with 1 × 105The density of cells/ml is passed in the culture dish of 100mm, with containing 10% The DMEM culture solutions of FBS, 37 DEG C, 5%CO2Overnight incubation in incubator, it is spare when making its growth to 70%-90% degree of converging.
(2) protein extraction：The DMEM culture solutions containing 10%FBS are blotted, PBS is washed twice；By culture dish be placed on ice, to Add in ware contain PI (Roche) RIPA (in) (green skies biology) cracking 250 μ l of mixed liquor, with spatula scrape it is all carefully Born of the same parents are transferred to fully shaking in 1.5ml EP pipes, stand 15min on ice；4 DEG C of centrifugation 15min of 13000g, draw supernatant transposition In another 1.5ml EP pipes.
(3) BCA methods survey protein concentration (the green skies)：According to BCA determination of protein concentration kit configuration protein determination liquid and Standard items, each sample repeat to be averaged three times, and light absorption value is read with microplate reader.Albumen is formulated according to the light absorption value of standard items Concentration/light absorption value standard curve calculates the protein concentration of each sample successively.
(4) using each 50 μ g albumen of loading hole as standard, according to the protein concentration of measure, add in appropriate sample-loading buffer and match somebody with somebody It is flat.95 DEG C of albuminous degeneration 5min.
(5) protein electrophoresis：To pre-prepared colloid (NuPAGETM10%Bis-Tris Protein Gels, 1.5mm, 10-well, Invitrogen sample and albumen Marker are carefully added into), with 120V voltage 70min electrophoresis.
(6) transferring film：After electrophoresis, gel is taken out.Preprepared filter paper two is taken to open, wetting is spare；Pvdf membrane 1 , methanol impregnates activation；Gel, film and filter paper with the order of filter paper-film-gel-filter paper are stacked, inserted in transferring film slot, Constant pressure 100V transferring films 90min.
(7) close：After transferring film, pvdf membrane is taken out, it is spare with 4%BSA closings 40min.
(8) primary antibody anti-Cas9 (1 is used respectively:1000) (26758-1-AP, Proteintech) and anti-GAPDH (1: 1000) (60004-1-Ig, Proteintech) applies bath, and 4 DEG C overnight.
(9) next day, recycle primary antibody, with secondary antibody Anti-Rabbit and Anti-Mouse (DyLight 800-Labeled, KPL after) applying bath 40min, exposed with Odyssey visualizers.At 170KD, it is seen that line1 and line3 has apparent band, because And it verifies line1 and line3 cell lines and builds successfully (see Fig. 5).
3 cell line functional verification of embodiment
Electro physiology detects
Electro physiology detection is obtained steady using the method for manual whole-cell patch-clamp using the method in 2 step 2 of embodiment Surely dCas9-VP64 fusion proteins and the HEK293 cell lines of SCN5A-gRNA are expressed, is carried out at room temperature.Laboratory apparatus uses HEKA PATCHMASTER whole-cell patch-clamp recording techniques record the voltage-activated Nav1.5 passages of above-mentioned cell.The vitreous electricity of drawing Liquid in pole filling electrode, cell incubation is in electrode external solution, about 22 DEG C of temperature, and electrode, which enters the resistance value after liquid, should reach 2-8M Ω. Wherein, extracellular fluid includes (mmol/l) NaCl 135, choline chloride 110, KCl 5.4, CaCl21.8, MgCl21, NaH2PO4 0.33, HEPES 10, Glucose 10 (NaOH tune pH7.2).Intracellular fluid includes (mmol/l) CsCl 120, CaCl21, MgCl25, Na2ATP5, EGTA 11, HEPES 10, Glucose 11 (CsOH tune pH7.3).Cell completes sealing-in Resistance value stabilization afterwards should reach more than G Ω.The cell Clamping voltages that valtage-gated Na passages use is -120mV, from -100mV ~+60mV increases 10mV, time 40ms, record current (Fig. 6) per minor tick, and makes I-V curve (Fig. 7).
It is tested by electro physiology, obtains the HEK293 cells that can generate Nav current signals, it was demonstrated that activation endogenous SCN5A Functional NaV electric currents can be generated.
Sequence table
<110>Shanghai East Hospital
<120>Stablize cell model for expressing human endogenous INav and its preparation method and application
<141> 2018-01-12
<160> 41
<170> SIPOSequenceListing 1.0
<210> 1
<211> 4404
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
atgaaaaggc cggcggccac gaaaaaggcc ggccaggcaa aaaagaaaaa ggacaagaag 60
tacagcatcg gcctggccat cggcaccaac tctgtgggct gggccgtgat caccgacgag 120
tacaaggtgc ccagcaagaa attcaaggtg ctgggcaaca ccgaccggca cagcatcaag 180
aagaacctga tcggagccct gctgttcgac agcggcgaaa cagccgaggc cacccggctg 240
aagagaaccg ccagaagaag atacaccaga cggaagaacc ggatctgcta tctgcaagag 300
atcttcagca acgagatggc caaggtggac gacagcttct tccacagact ggaagagtcc 360
ttcctggtgg aagaggataa gaagcacgag cggcacccca tcttcggcaa catcgtggac 420
gaggtggcct accacgagaa gtaccccacc atctaccacc tgagaaagaa actggtggac 480
agcaccgaca aggccgacct gcggctgatc tatctggccc tggcccacat gatcaagttc 540
cggggccact tcctgatcga gggcgacctg aaccccgaca acagcgacgt ggacaagctg 600
ttcatccagc tggtgcagac ctacaaccag ctgttcgagg aaaaccccat caacgccagc 660
ggcgtggacg ccaaggccat cctgtctgcc agactgagca agagcagacg gctggaaaat 720
ctgatcgccc agctgcccgg cgagaagaag aatggcctgt tcggcaacct gattgccctg 780
agcctgggcc tgacccccaa cttcaagagc aacttcgacc tggccgagga tgccaaactg 840
cagctgagca aggacaccta cgacgacgac ctggacaacc tgctggccca gatcggcgac 900
cagtacgccg acctgtttct ggccgccaag aacctgtccg acgccatcct gctgagcgac 960
atcctgagag tgaacaccga gatcaccaag gcccccctga gcgcctctat gatcaagaga 1020
tacgacgagc accaccagga cctgaccctg ctgaaagctc tcgtgcggca gcagctgcct 1080
gagaagtaca aagagatttt cttcgaccag agcaagaacg gctacgccgg ctacattgac 1140
ggcggagcca gccaggaaga gttctacaag ttcatcaagc ccatcctgga aaagatggac 1200
ggcaccgagg aactgctcgt gaagctgaac agagaggacc tgctgcggaa gcagcggacc 1260
ttcgacaacg gcagcatccc ccaccagatc cacctgggag agctgcacgc cattctgcgg 1320
cggcaggaag atttttaccc attcctgaag gacaaccggg aaaagatcga gaagatcctg 1380
accttccgca tcccctacta cgtgggccct ctggccaggg gaaacagcag attcgcctgg 1440
atgaccagaa agagcgagga aaccatcacc ccctggaact tcgaggaagt ggtggacaag 1500
ggcgcttccg cccagagctt catcgagcgg atgaccaact tcgataagaa cctgcccaac 1560
gagaaggtgc tgcccaagca cagcctgctg tacgagtact tcaccgtgta taacgagctg 1620
accaaagtga aatacgtgac cgagggaatg agaaagcccg ccttcctgag cggcgagcag 1680
aaaaaggcca tcgtggacct gctgttcaag accaaccgga aagtgaccgt gaagcagctg 1740
aaagaggact acttcaagaa aatcgagtgc ttcgactccg tggaaatctc cggcgtggaa 1800
gatcggttca acgcctccct gggcacatac cacgatctgc tgaaaattat caaggacaag 1860
gacttcctgg acaatgagga aaacgaggac attctggaag atatcgtgct gaccctgaca 1920
ctgtttgagg acagagagat gatcgaggaa cggctgaaaa cctatgccca cctgttcgac 1980
gacaaagtga tgaagcagct gaagcggcgg agatacaccg gctggggcag gctgagccgg 2040
aagctgatca acggcatccg ggacaagcag tccggcaaga caatcctgga tttcctgaag 2100
tccgacggct tcgccaacag aaacttcatg cagctgatcc acgacgacag cctgaccttt 2160
aaagaggaca tccagaaagc ccaggtgtcc ggccagggcg atagcctgca cgagcacatt 2220
gccaatctgg ccggcagccc cgccattaag aagggcatcc tgcagacagt gaaggtggtg 2280
gacgagctcg tgaaagtgat gggccggcac aagcccgaga acatcgtgat cgaaatggcc 2340
agagagaacc agaccaccca gaagggacag aagaacagcc gcgagagaat gaagcggatc 2400
gaagagggca tcaaagagct gggcagccag atcctgaaag aacaccccgt ggaaaacacc 2460
cagctgcaga acgagaagct gtacctgtac tacctgcaga atgggcggga tatgtacgtg 2520
gaccaggaac tggacatcaa ccggctgtcc gactacgatg tggaccacat cgtgcctcag 2580
agctttctga aggacgactc catcgacaac aaggtgctga ccagaagcga caaggcccgg 2640
ggcaagagcg acaacgtgcc ctccgaagag gtcgtgaaga agatgaagaa ctactggcgg 2700
cagctgctga acgccaagct gattacccag agaaagttcg acaatctgac caaggccgag 2760
agaggcggcc tgagcgaact ggataaggcc ggcttcatca agagacagct ggtggaaacc 2820
cggcagatca caaagcacgt ggcacagatc ctggactccc ggatgaacac taagtacgac 2880
gagaatgaca agctgatccg ggaagtgaaa gtgatcaccc tgaagtccaa gctggtgtcc 2940
gatttccgga aggatttcca gttttacaaa gtgcgcgaga tcaacaacta ccaccacgcc 3000
cacgacgcct acctgaacgc cgtcgtggga accgccctga tcaaaaagta ccctaagctg 3060
gaaagcgagt tcgtgtacgg cgactacaag gtgtacgacg tgcggaagat gatcgccaag 3120
agcgagcagg aaatcggcaa ggctaccgcc aagtacttct tctacagcaa catcatgaac 3180
tttttcaaga ccgagattac cctggccaac ggcgagatcc ggaagcggcc tctgatcgag 3240
acaaacggcg aaaccgggga gatcgtgtgg gataagggcc gggattttgc caccgtgcgg 3300
aaagtgctga gcatgcccca agtgaatatc gtgaaaaaga ccgaggtgca gacaggcggc 3360
ttcagcaaag agtctatcct gcccaagagg aacagcgata agctgatcgc cagaaagaag 3420
gactgggacc ctaagaagta cggcggcttc gacagcccca ccgtggccta ttctgtgctg 3480
gtggtggcca aagtggaaaa gggcaagtcc aagaaactga agagtgtgaa agagctgctg 3540
gggatcacca tcatggaaag aagcagcttc gagaagaatc ccatcgactt tctggaagcc 3600
aagggctaca aagaagtgaa aaaggacctg atcatcaagc tgcctaagta ctccctgttc 3660
gagctggaaa acggccggaa gagaatgctg gcctctgccg gcgaactgca gaagggaaac 3720
gaactggccc tgccctccaa atatgtgaac ttcctgtacc tggccagcca ctatgagaag 3780
ctgaagggct cccccgagga taatgagcag aaacagctgt ttgtggaaca gcacaagcac 3840
tacctggacg agatcatcga gcagatcagc gagttctcca agagagtgat cctggccgac 3900
gctaatctgg acaaagtgct gtccgcctac aacaagcacc gggataagcc catcagagag 3960
caggccgaga atatcatcca cctgtttacc ctgaccaatc tgggagcccc tgccgccttc 4020
aagtactttg acaccaccat cgaccggaag aggtacacca gcaccaaaga ggtgctggac 4080
gccaccctga tccaccagag catcaccggc ctgtacgaga cacggatcga cctgtctcag 4140
ctgggaggcg acagcgctgg aggaggtgga agcggaggag gaggaagcgg aggaggaggt 4200
agcggaccta agaaaaagag gaaggtggcg gccgctggat ccggacgggc tgacgcattg 4260
gacgattttg atctggatat gctgggaagt gacgccctcg atgattttga ccttgacatg 4320
cttggttcgg atgcccttga tgactttgac ctcgacatgc tcggcagtga cgcccttgat 4380
gatttcgacc tggacatgct gtga 4404
<210> 2
<211> 349
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
tttcccatga ttccttcata tttgcatata cgatacaagg ctgttagaga gataattaga 60
attaatttga ctgtaaacac aaagatatta gtacaaaata cgtgacgtag aaagtaataa 120
tttcttgggt agtttgcagt tttaaaatta tgttttaaaa tggactatca tatgcttacc 180
gtaacttgaa agtatttcga tttcttggct ttatatatct tgtggaaagg acgaaacacc 240
gccaagcccc aggccgaacc cgttttagag ctagaaatag caagttaaaa taaggctagt 300
ccgttatcaa cttgaaaaag tggcaccgag tcggtgcttt tttgaattc 349
<210> 3
<211> 39
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
ctaccggact cagatctcga gatgaaaagg ccggcggcc 39
<210> 4
<211> 41
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
gtaccgtcga ctgcagaatt ctcacagcat gtccaggtcg a 41
<210> 5
<211> 44
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
tcttgtggaa aggacgaaac accgccaagc cccaggccga accc 44
<210> 6
<211> 41
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
tactattaat aactagaatt caaaaaagca ccgactcggt g 41
<210> 7
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
ccaagcccca ggccgaaccc 20
<210> 8
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
cgcgcccagg gctccgcacg 20
<210> 9
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
ggtgctccgc ccgctcggag 20
<210> 10
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 10
cacgcgttca ctttccttc 19
<210> 11
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 11
catcagccag cttcttcaca 20
<210> 12
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 12
attcttcggc ttcttcaccc 20
<210> 13
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 13
ctcttgccag gcatcggact 20
<210> 14
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 14
tgacccctac caccagtaca 20
<210> 15
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 15
gacattttga acccagccgc 20
<210> 16
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 16
gtcaatgcca acgaggaggt 20
<210> 17
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 17
tcagagccag agccgaagat 20
<210> 18
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 18
ttgtgcctca gaattgggct 20
<210> 19
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 19
gcaccatgtc accataccct 20
<210> 20
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 20
tctgctttta tcccgggcag 20
<210> 21
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 21
tgcagtgcga tttcaggtct 20
<210> 22
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 22
cattgtgtcc gtcctggtca 20
<210> 23
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 23
gagttctcca gatggggtgc 20
<210> 24
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 24
tccgaggtca acagcttcac 20
<210> 25
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 25
ttgggcattc atccgtgaca 20
<210> 26
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 26
gtaacgtcaa ggccaagagc 20
<210> 27
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 27
tcccattccc tactccactg 20
<210> 28
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 28
tgattccaac gccaccaatt c 21
<210> 29
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 29
gaggagtcca taggcgatta ct 22
<210> 30
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 30
atacacaact gaatttgtgg a 21
<210> 31
<211> 24
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 31
aaatgactga tatagttttc aggg 24
<210> 32
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 32
gtatgtatca gaaaatataa a 21
<210> 33
<211> 26
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 33
ggataactga aatagttttt agagct 26
<210> 34
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 34
ccttctgcag gtgtatgaag a 21
<210> 35
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 35
agtacttctt ctgctcctct gtc 23
<210> 36
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 36
atggtggaga cagatgacca a 21
<210> 37
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 37
agagcacagt gcctgtgaag at 22
<210> 38
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 38
gtgtgtgtgc ccatcgctgt 20
<210> 39
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 39
tcctctgggg tctgcttgct 20
<210> 40
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 40
gcgagatccc tccaaaatca 20
<210> 41
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 41
atggttcaca cccatgacga 20

Claims (7)

1. a kind of cell model of the stable human endogenous INav of expression, it is characterised in that：Using a host cell, the place Guiding RNA containing dCas9-VP64 fusion proteins and SCN5A in chief cell；The sequence of the dCas9-VP64 fusion proteins As shown in SEQ ID NO.1, the sequence of the guiding RNA of the SCN5A is as shown in SEQ ID NO.2.
2. a kind of cell model of stable human endogenous INav of expression according to claim 1, it is characterised in that：Described Host cell is HEK293 cells.
3. a kind of preparation method of the cell model of stable human endogenous INav of expression described in claim 1, it is characterised in that： DCas9-VP64 fusion proteins and SCN5A-gRNA are building up on carrier respectively, are then packaged into virus respectively, it will be above-mentioned Virus infection host cell, last screening positive clone express the cell model of human endogenous INav to get stablizing.
4. a kind of preparation method of the cell model of stable human endogenous INav of expression according to claim 3, feature It is：By on dCas9-VP64 fusion protein constructions to pLVX-Puro carriers, pLVX-dCas9-VP64-Puro carriers are obtained, SCN5A-gRNA is building up on pLVX-shRNA2 carriers, pLVX-SCN5A-gRNA-Zsgreen1 carriers are obtained, with three plasmids PLVX-dCas9-VP64-Puro and tri- plasmid corotation of psPAX2 and pMD2.G are packaged into virus by packaging system, with three matter PLVX-SCN5A-gRNA-Zsgreen1 and tri- plasmid corotation of psPAX2 and pMD2.G are packaged into virus by grain packaging system, will Two above-mentioned viruses infect host cell simultaneously, and last screening positive clone expresses the thin of human endogenous INav to get stable Born of the same parents' model.
5. a kind of preparation method of the cell model of stable human endogenous INav of expression according to claim 3, feature It is：
1）Full genome synthesizes dCas9-VP64, and dCas9-VP64 is inserted between XhoI the and EcoR I of pLVX-Puro carriers；
2）Effective SCN5A-gRNA segments are screened and synthesized, SCN5A-gRNA segments are inserted into pLVX-shRNA2；
3）By step 1）With step 2）Carrier after insertion is packaged into slow virus respectively；
4）It infects HEK293 cells respectively using slow virus, positive colony is filtered out with puromycin and green fluorescence, obtain steady Surely the cell model of human endogenous INav is expressed.
6. a kind of cell model of the human endogenous INav of stable expression described in claim 1 high flux screening drug in vitro In application.
7. application according to claim 6, it is characterised in that：The drug includes the drug for the treatment of arrhythmia cordis.
CN201810099687.7A 2018-01-15 2018-02-01 Stablize cell model for expressing human endogenous INav and its preparation method and application Pending CN108048405A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2018100335056 2018-01-15
CN201810033505 2018-01-15

Publications (1)

Publication Number Publication Date
CN108048405A true CN108048405A (en) 2018-05-18

Family

ID=62125279

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810099687.7A Pending CN108048405A (en) 2018-01-15 2018-02-01 Stablize cell model for expressing human endogenous INav and its preparation method and application

Country Status (1)

Country Link
CN (1) CN108048405A (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104894075A (en) * 2015-05-28 2015-09-09 华中农业大学 Method for preparing vaccine by editing pseudorabies virus genomes based on CRISPR/Cas9 and Cre/lox systems and application of method
WO2016205613A1 (en) * 2015-06-18 2016-12-22 The Broad Institute Inc. Crispr enzyme mutations reducing off-target effects
CN107151677A (en) * 2017-03-15 2017-09-12 陕西师范大学 The new method of low transfection efficiency cell line is knocked out based on CRISPR/Cas9 polygenes
AU2016228914A1 (en) * 2015-03-09 2017-09-21 Sinai Health System Tools and methods for using cell division loci to control proliferation of cells
CN107435050A (en) * 2017-06-20 2017-12-05 向孟清 A kind of method by human or animal's somatic induction for NSC

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2016228914A1 (en) * 2015-03-09 2017-09-21 Sinai Health System Tools and methods for using cell division loci to control proliferation of cells
CN104894075A (en) * 2015-05-28 2015-09-09 华中农业大学 Method for preparing vaccine by editing pseudorabies virus genomes based on CRISPR/Cas9 and Cre/lox systems and application of method
WO2016205613A1 (en) * 2015-06-18 2016-12-22 The Broad Institute Inc. Crispr enzyme mutations reducing off-target effects
CN107151677A (en) * 2017-03-15 2017-09-12 陕西师范大学 The new method of low transfection efficiency cell line is knocked out based on CRISPR/Cas9 polygenes
CN107435050A (en) * 2017-06-20 2017-12-05 向孟清 A kind of method by human or animal's somatic induction for NSC

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ANNELINE S.J.M. TE RIELE等: "Multilevel analyses of SCN5A mutations in arrhythmogenic right ventricular dysplasia/cardiomyopathy suggest non-canonical mechanisms for disease pathogenesis", 《CARDIOVASCULAR RESEARCH》 *
NCBI: "Homo sapiens sodium voltage-gated channel alpha subunit 5 (SCN5A), transcript variant 2, mRNA", 《GENBANK DATABASE》 *
徐望红: "《肿瘤流行病学》", 30 June 2017, 复旦大学出版社 *
杨骁: "心律失常调控相关的心脏特异性转录因子探讨", 《中国优秀硕士学位论文全文数据库医药卫生科技辑》 *

Similar Documents

Publication Publication Date Title
Buck et al. Efficient intracellular assembly of papillomaviral vectors
Babiss et al. Adenovirus type 5 early region 1b gene product is required for efficient shutoff of host protein synthesis
EP2871239B1 (en) Cell capable of producing adeno-associated virus vector
US10760096B2 (en) Human type 55 replication defective adenovirus vector, method for preparing same and uses thereof
JP2023543472A (en) Viral vectors and their use
WO2022170835A1 (en) Application of ionizable cationic lipid analogue material as nucleic acid drug delivery vector or transfection reagent
CN113106094B (en) Enhanced skeletal muscle cell efficient specific promoter, screening method and application
EP4177347A1 (en) Novel chimpanzee adenovirus vector, construction method therefor, and application thereof
CN106520779A (en) Method for improving 1L-2 protein expression efficiency of chicken through codon optimization of chicken 1L-2 gene
CN104178514B (en) A kind of method of foreign protein content inside raising AcMNPV polyhedral bodies
CN108048405A (en) Stablize cell model for expressing human endogenous INav and its preparation method and application
CN109943580A (en) Dual-gene recombination compound macrophage vaccine of one kind and its preparation method and application
CN115006424A (en) Application of CTC-497E21.4 as iron death regulation target in preparation of gastric cancer targeted drugs
CN108285892A (en) A kind of stable human endogenous Ito of generation, the cell model and construction method of s electric currents and application
CN114181973A (en) Self-constructed sT2 cell expression exogenous SLA-2 gene and preparation method thereof
US11578321B2 (en) Recombinant HBV reporter system
CN112210556A (en) Group of shRNA for targeted interference of IL-33 expression, recombinant adenovirus vector, and construction method and application thereof
CN106075396B (en) The application of Cul4 albumen
CN104450781A (en) Cell line for over-expression of CIAPIN1 protein as well as preparation method and application of cell line
CN116855503B (en) Stable transgenic cell strain over-expressing MRGPRX2 and construction method and application thereof
Holmes et al. Adenovirus expressing p53
CN106701692A (en) Recombinant adeno-associated virus for expressing HIV-1 (Human Immunodeficiency Virus-1) invasion inhibitor ECLD to inhibit HIV-1 infection
CN109266684A (en) A method of building pathogen infection sensitive animal model
CN113388626B (en) Application of novel coronavirus NSP13 gene
CN116574735B (en) Polynucleotide and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20180518